CN106701650A

CN106701650A - Riemerella anatipestifer gene deletion low virulent strain and construction method and application thereof

Info

Publication number: CN106701650A
Application number: CN201710022087.6A
Authority: CN
Inventors: 刘马峰; 税芸; 黄觅; 程安春; 汪铭书; 朱德康; 贾仁勇; 陈舜
Original assignee: Sichuan Agricultural University
Current assignee: Sichuan Agricultural University
Priority date: 2017-01-12
Filing date: 2017-01-12
Publication date: 2017-05-24
Anticipated expiration: 2037-01-12
Also published as: CN106701650B

Abstract

The invention discloses a riemerella anatipestifer gene deletion low virulent strain and a construction method and application thereof. The strain is riemerella anatipestifer CH-1deltaB739_1343, is preserved in the Chinese typical culture collection center and is assigned the accession number CCTCC NO: M2016438, 2352bp of B739_1343 genes of a heme transfer system is deleted, and the deleted gene sequence is as shown in SEQ ID No. 1. Animal experimental results indicate that the LD50 value of the deleted strain is larger than 10<10>CFU, the LD50 value of RA-CH-1 is about 10<8>CFU, the duckling virulence of the deleted strain is reduced by at least 100 times, the toxin attacking protection rate of the low virulent strain against 100*LD50 wild virulent strain RA-CH-1 is 83.33%, and the strain can serve as a candidate strain for RA gene deletion vaccines.

Description

One plant of riemerella anatipestifer gene delection low virulent strain and its construction method and application

Technical field

The invention belongs to biological technical field, specifically, it is related to one plant of riemerella anatipestifer gene delection low virulent strain And its construction method and application.

Background technology

Riemerella anatipestifer disease is caused by riemerella anatipestifer (Riemerella anatipestifer, RA) A kind of main acute or chronic contagious disease for infecting various birds such as duckling.The disease has a very wide distribution, it has also become tight One of bacterial infectious disease of duck culturing industry is endangered again.At present, the major measure that China controls this sick is that vaccine prevention and medicine are controlled Treat.Because riemerella anatipestifer is present without cross-protection between various serotype and each serology, so a kind of vaccine Can only be worked for One serotype.And medicine is a large amount of using causing the drug resistance of RA constantly to strengthen, while also giving food Cause potential safety hazard.So the new generation vaccine for developing prevention RA diseases is following developing direction.

Ferro element is nutrient necessary to most biology growings, including bacterium.However, host is by " battalion Support immune " mechanism significantly limit iron using degree.Therefore pathogen must possess iron transfer mechanism could successfully infect Host.Conversely, if pathogen iron ion were damaged using system, the reduced capability of infection host.Can using this principle To produce riemerella anatipestifer low virulent strain and be used for immunoprophylaxis.

The content of the invention

In view of this, the present invention is directed to above-mentioned problem, there is provided one plant of riemerella anatipestifer gene delection low virulent strain And its construction method and application.

In order to solve the above-mentioned technical problem, the invention discloses one plant of riemerella anatipestifer gene delection low virulent strain, should Bacterial strain is riemerella anatipestifer CH-1 Δ B739_1343, is named as Riemerella anatipestifer CH-1 Δs B739_1343, China typical culture collection center is preserved on 30th in August in 2016, and its preserving number is CCTCC NO: M2016438, the bacterial strain has lacked the 2352bp of ferroheme movement system B739_1343 genes, and the gene order for being lacked is such as Shown in SEQ ID NO.1.

The invention also discloses a kind of construction method of riemerella anatipestifer gene delection low virulent strain, including following step Suddenly：

1) PCR amplifications RA-CH-1B739_1343 genes or so homology arm and Spec resistant genes；

2) the RA-CH-1B739_1343 genes that will have been expanded or so homology arm and Spec resistant genes carry out digestion and connect Night is taken over, B739_1343-LSR fragments are built；

3) recombination suicide vector pEX18GM Δs B739_1343-LSR is built；

4) RA-CH-1B739_1343 gene-deleted strains are built, RA-CH-1B739_1343 gene-deleted strains are in pest of duck Mo Shi bacillus genes lack low virulent strain.

Further, step 1) in PCR amplification RA-CH-1B739_1343 genes or so homology arm and Spec resistant genes Specially：

1.1) two couples of primer B739_1343-L F/R and B739_ are designed according to B739_1343 genes or so homology arm 1343-R F/R, and in primer 5 '-end addition restriction enzyme digestion sites；By the use of RA-CH-1 genomes as template, point It is primer amplification B739_1343 genes or so homology arm fragment not with B739_1343-L F/R and B739_1343-R F/R B739_1343-L and B739_1343-R；PCR conditions are：98 DEG C of denaturation 30s, through 98 DEG C of 10s, 55 DEG C of 30s, 72 DEG C of 30s circulations Amplification 30 times, 72 DEG C of extension 7min；

Wherein, B739_1343-L F/R include B739_1343-L F and B739_1343-L R, B739_1343-L F's Nucleotide sequence is BamHI in primer 5 '-end addition restriction enzyme digestion sites as shown in SEQ ID NO.5； The nucleotide sequence of B739_1343-L R adds digestion with restriction enzyme as shown in SEQ ID NO.6 at primer 5 '-end Site is NheI；

B739_1343-R F/R include the nucleotides of B739_1343-R F and B739_1343-R R, B739_1343-R F Sequence is EcoRI in primer 5 '-end addition restriction enzyme digestion sites as shown in SEQ ID NO.7；B739_1343- The nucleotide sequence of R R is KpnI in primer 5 '-end addition restriction enzyme digestion sites as shown in SEQ ID NO.8；

1.2) the Spec resistance gene fragments design primer Spec F/R in plasmid pAM238, and at primer 5 '-end Add NheI, EcoRI restriction enzyme site；By the use of plasmid pAM238 as template, Spec sequences are expanded by primer PCR of Spec F/R Row；PCR conditions are：98 DEG C of denaturation 30s, through 98 DEG C of 10s, 55 DEG C of 30s, 72 DEG C of 50s cyclic amplifications 30 times, 72 DEG C of extension 7min；

Wherein, the nucleotide sequence of Spec F/R including Spec F and Spec R, Spec F is as shown in SEQ ID NO.9, And add NheI restriction enzyme sites at primer 5 '-end；The nucleotide sequence of Spec R as shown in SEQ ID NO.10, and in primer 5 '-end adds EcoRI restriction enzyme sites.

Further, step 2) in structure B739_1343-LSR fragments be specially：The left side homology arm that will be expanded B739_1343-L carries out double digestion with BamHI, NheI, and the right side homology arm B739_1343-R of amplification is entered with EcoRI, KpnI Row double digestion, double digestion is carried out by the Spec sequences of amplification with NheI, EcoRI；Will reclaim three fragment B739_1343-L, Spec, B739_1343-R are connected overnight；Then with connection product as mould, with primer B739_1343-L F, B739_1343-R R Amplification B739_1343-LSR fragments.

Further, step 3) in structure recombination suicide vector pEX18GM Δs B739_1343-LSR be specially：Will The B739_1343-LSR fragments and plasmid pEX18GM of amplification carry out double digestion with BamHI and KpnI, the fragment and matter that will be reclaimed Grain is connected overnight with T4 ligases, and connection product is transformed into Escherichia coli XL1-Blue competence, is coated big mould containing celebrating The LB flat boards of element are screened；The monoclonal that will be obtained enters performing PCR identification, filters out and contains plasmid pEX18GM Δs B739_ The positive colony of 1343-LSR；Take out kit extracting recombinant plasmid and carry out digestion identification using plasmid is small；To identify correct Recombinant plasmid transformed is in S17-1 Escherichia coli.

Further, step 4) in structure RA-CH-1B739_1343 gene-deleted strains be specially：By Escherichia coli S17-1pEX18GM Δs B739_1343-LSR is inoculated in the LB fluid nutrient mediums of 10mL, and RA-CH-1 is lined containing 5% degreasing In the LB solid mediums of sheep blood, 37 DEG C of cultures to exponential phase；Scraping RA-CH-1 is 10mmol/mL's in 1mL concentration MgSO₄In solution, then use MgSO₄Solution is washed 2 times；Calculate donor bacterium S17-1pEX18GM Δs B739_1343-LSR up to 2.5 × 10⁸ Individual bacterium number, recipient bacterium CH-1 is up to 10⁹Volume required for individual bacterium number；Donor bacterium, recipient bacterium are mixed according to the volume for calculating, then Filtered in injection filter；Remove filter membrane to be laid on blood plate, 30 DEG C of 5%CO₂Culture 8h；By the bacterium MgSO on filter membrane₄It is molten Liquid is eluted, and it is on the blood plate containing the spectinomycin that kanamycins and concentration are 80 μ g/mL of 50 μ g/mL to coat concentration Cultivated；The monoclonal of picking growth enters performing PCR identification, and structure obtains riemerella anatipestifer gene delection low virulent strain.

Further, PCR authentication methods are as follows：

A) using RA-CH-1 conserved sequence primer 16s rRNA F/R, PCR expands the 16s rRNA fragments of RA-CH-1, root Judge whether Candidate Mutant strain is RA-CH-1 according to electrophoresis result；If the band that electrophoresis is obtained expands with by template of wild strain CH-1 Increase the stripe size for consistent, judge that Candidate Mutant strain is RA-CH-1 accordingly, wherein, the nucleotide sequence of 16s rRNA F As shown in SEQ ID NO.11；The nucleotide sequence of 16s rRNA R is as shown in SEQ ID NO.12；

B) using the primer Spec P1/P2 of Spec resistant genes, Spec resistance gene fragments are expanded, according to electrophoresis result Judge whether the replacement of producer；If the band that electrophoresis is obtained is in the same size with positive control, and is with wild strain RA-CH-1 Template fails to amplify band, judges that Spec genes have been substituted into Candidate Mutant pnca gene group accordingly；The nucleosides of Spec F Acid sequence is as shown in SEQ ID NO.13；The nucleotide sequence of Spec R is as shown in SEQ ID NO.14；

C) utilize whether primer B739_1343F/R, amplifying target genes detect B739_1343 genes according to electrophoresis result Lacked；If failing to amplify band by template of Candidate Mutant strain RA-CH-1 Δs B739_1343, it is with wild strain RA-CH-1 The band that template amplification is obtained, and it is in the same size with purpose band expection, the gene B739_1343 of Candidate Mutant strain is judged accordingly Lacked；Wherein, the nucleotide sequence of B739_1343F is as shown in SEQ ID NO.15；The nucleotide sequence of B739_1343R As shown in SEQ ID NO.16；

D) primer SacB F/R are utilized, is expanded, detect whether suicide vector is thrown out of genome according to electrophoresis result； If in the same size with the expection of SacB genes with the band that plasmid pEX18GM is obtained as template amplification, and dashed forward with RA-CH-1, candidate Mutant RA-CH-1 Δs B739_1343 fails to amplify band for template, judges that suicide vector is thrown out of genome accordingly；Wherein, The nucleotide sequence of SacB F is as shown in SEQ ID NO.17；The nucleotide sequence of SacB R is as shown in SEQ ID NO.18.

The weak poison of Riemerlla anatipestifer is being prepared the invention also discloses a kind of riemerella anatipestifer gene delection low virulent strain Application in vaccine.

Further, low virulent strain RA-CH-1 Δs B739_1343 is to dosage>100×LD₅₀Wild virulent strain RA-CH-1 Attack malicious protective rate up to 83.33%, can be used as the candidate strain of RA gene-deleted vaccines.

Compared with prior art, the present invention can be obtained including following technique effect：

1) the low virulent strain Riemerella anatipestifer CH-1 Δs B739_1343 that the present invention builds is to wild type Velogen strain attacks malicious protective rate up to 83.33%, can used as the candidate of RA gene-deleted vaccines.

2) present invention sets about from the Nutrition and Metabolism mechanism of pathogen, constructs pnca gene missing low virulent strain, is subsequently to open The vaccine for sending out new is ensured there is provided recent studies on methods and techniques.

Certainly, implement any product of the invention to it is not absolutely required to while reaching all the above technique effect.

Brief description of the drawings

Accompanying drawing described herein is used for providing a further understanding of the present invention, constitutes a part of the invention, this hair Bright schematic description and description does not constitute inappropriate limitation of the present invention for explaining the present invention.In the accompanying drawings：

Fig. 1 is PCR amplifications B739_1343 genes of the present invention or so homology arm and Spec resistant gene amplifications；Wherein, M：Mark, 1：The left side homology arm B739_1343-L of amplification, 2：The right side homology arm B739_1343-R of amplification, 3：Amplification Spec resistance gene sequences；

Fig. 2 is that recombination suicide vector pEX18GM Δs B739_1343-LSR of the present invention builds schematic diagram；

Fig. 3 is that RA-CH-1 Δs B739_1343 gene-deleted strains of the present invention build identification；Wherein, M：mark；1,2 represents amplification The conserved sequence of RA-CH-1, RA-CH-1 Δ B739_1343；The 3 Spec sequences for representing amplification, are positive control；4,5 represent expansion The Spec sequences of RA-CH-1, RA-CH-1 Δ B739_1343 of increasing；6,7 RA-CH-1, RA-CH-1 Δ B739_ for representing amplification 1343 B739_1343 sequences；The 8 SacB sequences for representing amplification, are positive control；9,10 RA-CH-1, RA- for representing amplification The SacB sequences of CH-1 Δs B739_1343；

Fig. 4 is that RA-CH-1 Δ B739_1343 low virulent strains attack duckling survival rate statistics knot in malicious Protection in the present invention Really.

Specific embodiment

Describe embodiments of the present invention in detail below in conjunction with embodiment, thereby to the present invention how application technology hand Section can fully understand and implement according to this to solve technical problem and reach the implementation process of technology effect.

The structure side of embodiment 1Riemerella anatipestifer CH-1 Δ B739_1343 gene delection low virulent strains Method

1) the PCR amplifications of RA-CH-1B739_1343 genes or so homology arm and Spec resistant genes：

The nucleotide sequence of B739_1343 genes left side homology arm B739_1343-L as shown in SEQ ID NO.2, B739_ The nucleotide sequence of 1343 gene right homology arm B739_1343-R as shown in SEQ ID NO.3, the nucleosides of Spec resistant genes Acid sequence is as shown in SEQ ID NO.4.

Two couples of primers (B739_1343-L F/R, B739_1343-R are designed according to B739_1343 genes or so homology arm ), F/R and in primer 5 '-end addition restriction enzyme digestion sites.

B739_1343-L F:CGGGATCCCGGTACCACCTTGGTTAATAATATTC, its nucleotide sequence such as SEQ ID It is BamHI in primer 5 '-end addition restriction enzyme digestion sites shown in NO.5；

B739_1343-L R:CTAGCTAGCTAGTCCAATCCAGATTGATTTC, its nucleotide sequence such as SEQ ID It is NheI in primer 5 '-end addition restriction enzyme digestion sites shown in NO.6；

B739_1343-R F:CGGAATTCCGCTATTAACATTTTTAATTAAAAC, its nucleotide sequence such as SEQ ID It is EcoRI in primer 5 '-end addition restriction enzyme digestion sites shown in NO.7；

B739_1343-R R:GGGGTACCCCTACTTAGAGAGCGTACAGCTCC, its nucleotide sequence such as SEQ ID It is KpnI in primer 5 '-end addition restriction enzyme digestion sites shown in NO.8；

By the use of RA-CH-1 genomes as template, respectively with B739_1343-L F/R and B739_1343-R F/R to draw Thing amplification B739_1343 genes or so homology arm fragment B739_1343-L and B739_1343-R.PCR conditions are：98 DEG C of denaturation 30s, through 98 DEG C of 10s, 55 DEG C of 30s, 72 DEG C of 30s cyclic amplifications 30 times, 72 DEG C of extension 7min.Electrophoresis result shows that amplification obtains two The band (see Fig. 1) of treaty 800bp, it is in the same size with expected B739_1343-L and B739_1343-R.

Spec resistance gene fragments design primer Spec F/R in plasmid pAM238, and added at primer 5 '-end NheI, EcoRI restriction enzyme site.

Spec F：CTAGCTAGCTAGCTCGACTTCGCTGCTGCCC, its nucleotide sequence as shown in SEQ ID NO.9, And add NheI restriction enzyme sites at primer 5 '-end；

Spec R：CGGAATTCCGCGAATTGTTAGACATTATTTG, its nucleotide sequence such as SEQ ID NO.10 institutes Show, and EcoRI restriction enzyme sites are added at primer 5 '-end；

By the use of plasmid pAM238 as template, Spec sequences are expanded by primer PCR of Spec F/R.PCR conditions are：98℃ Denaturation 30s, through 98 DEG C of 10s, 55 DEG C of 30s, 72 DEG C of 50s cyclic amplifications 30 times, 72 DEG C of extension 7min.Electrophoresis result shows to expand To the band (see Fig. 1) of a treaty 1200bp, it is expected with Spec resistance gene fragments in the same size.

2) structure of B739_1343-LSR fragments

The left side homology arm B739_1343-L of amplification is carried out into double digestion with BamHI, NheI, the right side that will be expanded is homologous Arm B739_1343-R carries out double digestion with EcoRI, KpnI, and the Spec sequences of amplification are carried out into double digestion with NheI, EcoRI.

Three fragments B739_1343-L, Spec, the B739_1343-R connections that will be reclaimed are overnight.Then it is with connection product Mould, B739_1343-LSR fragments are expanded with primer B739_1343-L F, B739_1343-R R.

3) recombination suicide vector pEX18GM Δs B739_1343-LSR is built

The B739_1343-LSR fragments and plasmid pEX18GM of amplification are carried out into double digestion with BamHI and KpnI, will be reclaimed Fragment and plasmid with T4 ligases connect overnight, connection product is transformed into Escherichia coli XL1-Blue competence, be coated with Screened in the LB flat boards containing gentamicin.

The monoclonal that will be obtained enters performing PCR identification, filters out the positive containing plasmid pEX18GM Δs B739_1343-LSR Clone.Take out kit extracting recombinant plasmid and carry out digestion identification using plasmid is small.To identify that correct recombinant plasmid transformed is arrived In S17-1 Escherichia coli.Recombination suicide vector pEX18GM Δs B739_1343-LSR builds schematic diagram and sees Fig. 2.

4) structure of RA-CH-1 B739_1343 gene-deleted strains

The present invention uses mating transfer method, with Escherichia coli S17-1 pEX18GM Δs B739_1343-LSR as confession Body bacterium, RA-CH-1 carries out engagement transfer for recipient bacterium, comprises the following steps that：

Escherichia coli S17-1 pEX18GM Δs B739_1343-LSR is inoculated in the LB fluid nutrient mediums of 10mL, RA- CH-1 is lined in the LB solid mediums (blood plate) containing 5% degreasing sheep blood, 37 DEG C of cultures to exponential phase；Scraping RA- CH-1 is the MgSO of 10mmol/mL in 1mL concentration₄In solution, then use MgSO₄Solution is washed 2 times；Calculate donor bacterium S17- 1pEX18GM Δs B739_1343-LSR is up to 2.5 × 10⁸Individual bacterium number, recipient bacterium RA-CH-1 is up to 10⁹Volume required for individual bacterium number； Donor bacterium, recipient bacterium are mixed according to the volume for calculating, is then injected into being filtered in filter；Remove filter membrane to be laid on blood plate, 30 DEG C 5%CO₂Culture 8h；By the bacterium MgSO on filter membrane₄Eluant solution gets off, and coats containing kanamycins (50 μ g/mL) and strengthens Cultivated on the blood plate of miromycin (80 μ g/mL)；The monoclonal of picking growth enters performing PCR identification.

The step of PCR is identified be：

A) using RA-CH-1 conserved sequence primer 16s rRNA F/R, PCR expands the 16s rRNA fragments of RA-CH-1 (960bp), judges whether Candidate Mutant strain is RA-CH-1.Electrophoresis result shows with Candidate Mutant strain (RA-CH-1 Δs B739_ 1343) band (see Fig. 3) of a treaty 1000bp is obtained for template amplification, with the band gone out as template amplification with wild strain CH-1 It is in the same size, judge that Candidate Mutant strain is RA-CH-1 accordingly；

Wherein, 16s rRNA F/R include 16s rRNA F and 16s rRNA R, 16s rRNA F： CTTCGGATACTTGAGAGCG, its nucleotide sequence is as shown in SEQ ID NO.11；16s rRNA R： GCAGCACCTTGAAAATTGT, its nucleotide sequence is as shown in SEQ ID NO.12；

B) using the primer Spec P1/P2 of Spec resistant genes, amplification Spec resistance gene fragments (1140bp) judges Whether the replacement of producer.Electrophoresis result shows with Candidate Mutant strain (RA-CH-1 Δ B739_1343) as template amplification is obtained The band (see Fig. 3) of one treaty 1000bp, it is in the same size with positive control, and fail amplification by template of wild strain RA-CH-1 Shaping band, judges that Spec genes have been substituted into Candidate Mutant pnca gene group accordingly；

Wherein, Spec P1/P2 include Spec P1 and Spec P2, Spec P1：CTCGACTTC GCTGCTGCCC, its core Nucleotide sequence is as shown in SEQ ID NO.13；Spec P2：CGAAT TGTTAGACATTATTTG, its nucleotide sequence such as SEQ Shown in ID NO.14；

C) primer B739_1343F/R is utilized, amplifying target genes are detecting whether B739_1343 genes are lacked.Electrophoresis Result shows with Candidate Mutant strain (RA-CH-1 Δ B739_1343) as template fails to amplify band, with wild strain RA-CH-1 The band (see Fig. 3) of a treaty 2000bp is obtained for template amplification, it is in the same size with purpose band expection, judge that candidate dashes forward accordingly The gene B739_1343 of mutant is lacked.

Wherein, B739_1343F：CATGCCATGGATGATGCTGTTTTTCAGCACCG, its nucleotide sequence such as SEQ ID Shown in NO.15；B739_1343R：CTAGTCTAGATTAA AAATTAAATTGACAAGTG, its nucleotide sequence such as SEQ ID Shown in NO.16；

D) primer SacB F/R are utilized, is expanded to detect whether suicide vector is thrown out of genome；Electrophoresis result table It is bright to obtain an about band of 1000bp by template amplification of plasmid pEX18GM, it is in the same size with the expection of SacB genes, and with RA-CH-1, Candidate Mutant strain (RA-CH-1 Δ B739_1343) fail to amplify band (see Fig. 3) for template, judge accordingly certainly Kill carrier and be thrown out of genome.

Wherein, SacB F:CATGCCATGGATGAACATCAAAAAGTTTGC, its nucleotide sequence such as SEQ ID NO.17 It is shown；SacB R:CTAGTCTAGACTAGTTATTTGTT AACTGTTAATTGTCCTTGTTCAAGG, its nucleotide sequence is such as Shown in SEQ ID NO.18.

Whether the detection of embodiment 2 gene-deleted strain RA-CH-1 Δs B739_1343 weakens to the virulence of duckling

Determine the LD of RA-CH-1 Δ B739_1343 gene-deleted strains₅₀Value.Comprise the following steps that：

RA-CH-1, RA-CH-1 Δ B739_1343 gene-deleted strains are inoculated in TSB respectively, 37 DEG C of 180rpm shaken cultivations To exponential phase.Collects thalline under normal temperature, is washed 3 times with PBS, determines bacterium solution OD₆₀₀Value.It is ready for bacterium solution dense to following 4 Degree gradient：5×10¹⁰CFU/mL、5×10⁹CFU/mL、5×10⁸CFU/mL、5×10⁷CFU/mL。

3 age in days Beijing ducks are divided into 4 groups, every group 10, every is inoculated with 0.2mL bacterium solutions through intramuscular injection path, attacks toxic agent Amount is respectively 10¹⁰CFU、10⁹CFU、10⁸CFU、10⁷CFU.Observed and recorded attacks duck survival condition in malicious one week after.By Reed- Muench methods calculate median lethal dose.

As a result：The LD of RA-CH-1 Δ B739_1343 gene-deleted strains₅₀Value is more than 10¹⁰The LD of CFU, RA-CH-1₅₀Value is about 10⁸CFU (is shown in Table 1)；RA-CH-1 Δ B739_1343 gene-deleted strains have dropped at least 100 times to the pathogenicity of duckling.

Table 1RA-CH-1 Δ B739_1343 gene-deleted strains LD₅₀Measurement result

Embodiment 3 provides applications of the low virulent strain RA-CH-1 Δs B739_1343 as gene delection candidate vaccine

1) preparation of gene delection candidate vaccine：

Low virulent strain RA-CH-1 Δs B739_1343 is cultivated to exponential phase, bacteria containing amount is diluted to after collects thalline and is about 5 ×10⁸CFU/mL。

2) immunisation route and dosage：

Through leg muscle injecting immune, only, immunizing dose is about 10 to 0.2ml/ to 3 age in days ducklings⁸CFU。

3) the safety examination result of the gene delection low virulent strain is provided：

The clinical manifestation of duckling and changes of weight are immunized low virulent strain RA-CH-1 Δs as evaluation index after being immunized B739_1343 groups and non-immunized controls group substantially indifference.

4) immune protective effect of the gene delection low virulent strain is provided：

The low virulent strain to high dose (>100×LD₅₀) wild virulent strain RA-CH-1 attacks malicious protective rate up to 83.33%, and And the duck of the survival of immune RA-CH-1 Δ B739_1343 groups can normally search for food, drink water with inactivated vaccine group, spirit well, The basic indifference of body weight increment.

Embodiment 4RA-CH-1 Δ B739_1343 low virulent strains as gene delection candidate vaccine evaluation

Safety examination after the immune duckling of RA-CH-1 Δ B739_1343 low virulent strains is determined with malicious protection is attacked.

Selection Beijing duck is animal model, low dosage through the immune RA-CH-1 Δ B739_1343 of intramuscular injection, then with wild Strain RA-CH-1 attacks poison, to determine and attack malicious protection after immune low virulent strain RA-CH-1 Δs B739_1343.Comprise the following steps that：

1) low virulent strain RA-CH-1 Δs B739_1343 is inoculated in TSB, 37 DEG C of 180rpm shaken cultivations to logarithmic growth Phase.

2) under normal temperature, 6500rmp is collected by centrifugation thalline, is washed 3 times with PBS, and bacterium solution OD is determined after dilution₆₀₀Value.

3) according to the OD for determining₆₀₀Value, dilution RA-CH-1 Δs B739_1343 is about 5 × 10 to concentration⁸CFU/mL。

4) 3 age in days Beijing ducks are divided into 4 groups, every group 20.First group of I makees through leg muscle injection 0.2mL sterilizing PBS It is negative control；Second group of II is about 5 × 10 through leg muscle injection 0.2mL concentration⁸The RA-CH-1 Δs B739_ of CFU/mL 1343, immunizing dose is about 10⁸CFU；3rd group of III through neck hypodermic injection 0.25mL commodity inactivated vaccine, (give birth to by Chengdu day nation Tetramune Co., Ltd, slurry profit is good), as positive control；4th group of IV is not immunized and does not attack poison, used as blank.Monitoring is exempted from The clinical manifestation of duck after epidemic disease, while the body weight of each group duck is weighed, the safety of assessment low virulent strain RA-CH-1 Δs B739_1343 Property.

5) head exempt from rear 12d to first group of I, second group of II, the 3rd group of III RA-CH-1 bacterium solution through leg injection attack poison, join According to the LD for determining before₅₀Value, attacks toxic agent amount for every and is about 2.28 × 10¹⁰(>100×LD₅₀).Duck in 10 days is attacked after poison in monitoring Health condition and changes of weight.

As a result：

Safety examination after the immune duckling of RA-CH-1 Δ B739_1343 low virulent strains：Before poison is attacked, RA-CH-1 is immunized Δ B739_1343 groups and other three groups of duck average weight no significant differences, and duck feeding, drinking-water, mental status etc. face Bed feature is acted normally (be shown in Table 2), shows that the low virulent strain has no effect on the growth performance of duck, using upper safe and reliable.

Duck body weights and clinical manifestation during the observation of table 2

Wherein, group I represents immune PBS groups, and group II represents immune RA-CH-1 Δ B739_1343 groups, group III generations The immune commodity inactivated vaccine group of table, group IV represents blank control group.

Malicious protection measurement result is attacked after the immune duckling of RA-CH-1 Δ B739_1343 low virulent strains：RA-CH-1 attacks poison Afterwards, commodity inactivated vaccine group and blank control group duck survival rate are 100%；RA-CH-1 Δ B739_1343 immune group survival rates are 85%；PBS groups survival rate is 25% (see Fig. 3).The duck performance of PBS groups survival is become thin, drowsiness, nervous symptoms etc., and is immunized The duck of the survival of RA-CH-1 Δ B739_1343 groups can normally search for food, drink water with inactivated vaccine group, blank control group, spirit Well, and body weight is rised in value basic indifference (being shown in Table 2).RA-CH-1 Δ B739_1343 low virulent strains are attacked poison protection result and show weak poison Strain to high dose (>100×LD₅₀) wild type velogen strain RA-CH-1 attacks malicious protective rate up to 83.33% (being shown in Table 3).

RA-CH-1 Δs B739_1343 low virulent strains attack malicious protection measurement result in the present invention of table 3

Wherein, the immunizing dose of RA-CH-1 Δs B739_1343 is about 10 in group II⁸CFU。

Result above shows that the low virulent strain is upper safe and reliable in application, and malicious protecting effect is attacked with higher, can be used as grinding The candidate strain of the gene-deleted vaccine for sending out new.

Described above has shown and described some preferred embodiments of invention, but as previously described, it should be understood that invention is not Form disclosed herein is confined to, the exclusion to other embodiment is not to be taken as, and can be used for various other combinations, modification And environment, and can be carried out by the technology or knowledge of above-mentioned teaching or association area in invention contemplated scope described herein Change.And the change and change that those skilled in the art are carried out do not depart from the spirit and scope of invention, then all should be in the appended power of invention In the protection domain that profit is required.

SEQUENCE LISTING

<110>Sichuan Agricultural University

<120>One plant of riemerella anatipestifer gene delection low virulent strain and its construction method and application

<130> 2016

<160> 18

<170> PatentIn version 3.5

<210> 1

<211> 2352

<212> DNA

<213>Ferroheme movement system B739_1343 genes

<400> 1

atgatgctgt ttttcagcac cgttctaaat gcacagcttt accttataga aggtcaggta 60

agagatttgc acgacaatac acctttagct aatgctaaaa taagtattaa cggaaaactc 120

attaccactt ctgatactca aggaaatttt aatttttctt acaaaaaagg cactcatcat 180

cttttgataa cccacttaga ttgtgaacct tttactaaaa agataatact tgatagaaat 240

attaaaatca acattttcct tgagcatcat actaatgaaa tagaaaccgt agtagtacat 300

ggcattcata aaaagtcagg gacggcggtt atcaaaacat tagaacagtc ttttttagag 360

caaaaaacta ccgaaaatct aggcaacata ttgtctgaaa tttctggagt aaatagtatt 420

aaaacaggga ataacatttc taaacctgtt atacaaggac tttacggcag tagagtgttg 480

gtaatgaaca acggcatcaa aatggcagaa caagaatggg gcatagaaca cgctcctagc 540

gtggatccca acgcttttga ccatatagat gttgtaaagg gagcatctgc actaaagtac 600

ggtggagatg ccataggtgg cgttatacta ttagaaagtc ctaaataccc taaaaaagac 660

acccttatgg gtaaagtagc tttatcaggc atcagcaatg gtaaaggctt ggctctgaat 720

acggacatta caaagacttg gcaaaacggt tgggctttgc ggacgcaagg ttctgccaaa 780

aagctaggag atttggaaac acccaattat agtttacaaa atacgggtgc agatgaaaac 840

gcctcccact tttccctaca aaaaagggaa tacgaatacg gaatcacggc taaatattct 900

ttcatcaacc aaaattttgg aatttataaa ggggctcata tcagtaatgc aagaaacttt 960

gccgatgcca tcaataacgg acaatcctac tttacaggta attttggtta taaaatagag 1020

aatcctaaac aagaagttag ccatcacatt gctaaattgg aggcttacaa aagattagga 1080

aggctaggaa aatttacttt agaatatgcc tttcagcaaa atcatagatt tgaatacgat 1140

attcgtagag gagcgtacaa tgataaacct gctaccgacc tactactaac cacccaaagt 1200

ttggctcttt atcatctatt agaaagaccc aactggcagt gggaaacagg tctatcagga 1260

aattatcaag ttaattttcc cgacccaaaa acggagcgtt ctcgtttaat accagattac 1320

cataggtatg atgctggtgc tttttctatt ttcaaatatc aaaaaaatct ttggaaatgg 1380

gaagcagctt tgcggtacga tatgaatttc tacgatgtgt ataaatatta ccttaataaa 1440

gattgggcag cttacagcca agcgtttcat caatttgtaa ttgaaagtaa aggagtgaaa 1500

acattggtgc gtccaaaact ttattaccat aatatatcag catcgttggg tatggaatat 1560

cagcccactc gctttcttac taccaaattt aatttgataa gaaatagccg aagtcctaat 1620

gttgcagaat tattcgctga tgggctacac cacgctgctg ccattattga aaagggagat 1680

atgactatca aaaacgagga aacctaccaa gcccacctaa gcattggtat aaaagcctcc 1740

gttcttaatg gttttaaact taatcttaat ccgtattatt tcacttccga tagttttatt 1800

aaccaaacac ctaacggagt ggaaagtacc attcgtggga atttccctgt atggcaatat 1860

caacagatta aagccaaaat gtatgggata gacatagatt cagaacttaa catcactcca 1920

aaattacaat ggaatggagc gatgagctat gtgtacggac aagacttaac ccataatgaa 1980

cccttgatac ttatgcctcc aatgcagatt aaaaacgccc taagatatga taacaaaggt 2040

aaaaaaccgt ggcatataca aatagaaaac ctagtggtat ttaagcagaa aagatttcct 2100

atgaggcttt tatcctacga tgtatatgag aacaatacaa taaccaaaga gtggctagac 2160

attagtacac cacccgcagg ttatcaaatt tggaacctca atgctggagc aaagctcact 2220

agaaacattc agcttaattt gagtgttaat aatatattca atacaactta tagagaatat 2280

cttaaccgtt tgagattttt ctctgatgct ttgggacgaa atattatttt cacttgtcaa 2340

tttaattttt aa 2352

<210> 2

<211> 796

<212> DNA

<213>B739_1343 genes left side homology arm sequence

<400> 2

gtaccacctt ggttaataat attcttaaca gacctaggtc ccattttaat catgttccct 60

tctataagcc cattgtaccc ttctctaatc cccatacatt ctataccata ataatgagct 120

gttcttacca ctgcccttat cgccgcattc atacctggag aatcccctcc agaagtaaga 180

actcctatcc ttttcaactt tgattctgac ataattaaat actttttagc ctagcaaata 240

taagaaattt taactacatt attttaagat ttatatcata ttattactcc tacatctatt 300

cattacatgt tcatttgtat cttagtaaat aaaagttttt ttacctttgc aaaatgtttt 360

cagggaaact tcttttcaga aaagttacaa gtataagcct tgcatgggtt tatgcattag 420

ctttactgat ggctagtgta ttccactcgc atcaagagac ttttaatagt aattataatt 480

cttcccaaaa acagaatcac aaaataatca gtttaaaggg agatgattgt tctatctgtc 540

attttttcat ttcagggcat tctctgcttc ccgaaaaggt aaactttgaa gttttagtat 600

cagtagctac tacacttata ataggctaca agacactgga catccttcag aatcaaattg 660

tttatttctt acttagagga ccgccttcta ttttatagaa ataatatcat tttcactagg 720

tgttctaccg ttttgttagg acacggtttt aaccttttaa ttttcatatc tttaaatgaa 780

atcaatctgg attgga 796

<210> 3

<211> 803

<212> DNA

<213>B739_1343 gene right homology arm sequences

<400> 3

ctattaacat ttttaattaa aacaatttta aaacattatg aaacattcat ttttaaaaac 60

cgcagtatta tccgcagtaa gtattttagc cctcaactct tgtagagata atgatgaagc 120

acctgccgat gtacacaacc acgacgaagt acaatacctt accgttacac ttaccaatac 180

tgctgataac agcacccaaa ccgctacatt cagtgcagaa ggagctgata aagagttagt 240

tttaaaagaa aacaacactt atgatgttca gttatcatta gtagctcctc atgacgacca 300

tacccacgat gttactgatg aaatcataga actaaaagag gaacattttt tcacttataa 360

tttctctaat gtagatgtta aagttactag aaaagatgaa gctgaaagca ctagaaaaga 420

tgggtctaaa ataggtctaa aaacacagtg gcaagtaaca tctgcaccaa aaacaggagc 480

taaagctaac attagacttt accaccttcc tacctctgtg aaaatgagcg gtgctaatgg 540

agacgaagca ggaactgtaa caggtggtga agaggatatt gatgctactt ttaatgttaa 600

ataatgaaat atatctatgt agacacagat attgatactt taatatgatg tttaactcaa 660

aaaatcaaac aaaatgaaaa aagtattttt actaggagca ttagctctgt acagtgctac 720

aaatgcacaa cttaaatttg gtggaaaagc aggatacgcc ttatccgaag tcggagatac 780

aggagctgta cgctctctaa gta 803

<210> 4

<211> 1140

<212> DNA

<213>Spec resistant genes

<400> 4

ctcgacttcg ctgctgccca aggttgccgg gtgacgcaca ccgtggaaac ggatgaaggc 60

acgaacccag tggacataag cctgttcggt tcgtaagctg taatgcaagt agcgtatgcg 120

ctcacgcaac tggtccagaa ccttgaccga acgcagcggt ggtaacggcg cagtggcggt 180

tttcatggct tgttatgact gtttttttgg ggtacagtct atgcctcggg catccaagca 240

gcaagcgcgt tacgccgtgg gtcgatgttt gatgttatgg agcagcaacg atgttacgca 300

gcagggcagt cgccctaaaa caaagttaaa catcatgagg gaagcggtga tcgccgaagt 360

atcgactcaa ctatcagagg tagttggcgt catcgagcgc catctcgaac cgacgttgct 420

ggccgtacat ttgtacggct ccgcagtgga tggcggcctg aagccacaca gtgatattga 480

tttgctggtt acggtgaccg taaggcttga tgaaacaacg cggcgagctt tgatcaacga 540

ccttttggaa acttcggctt cccctggaga gagcgagatt ctccgcgctg tagaagtcac 600

cattgttgtg cacgacgaca tcattccgtg gcgttatcca gctaagcgcg aactgcaatt 660

tggagaatgg cagcgcaatg acattcttgc aggtatcttc gagccagcca cgatcgacat 720

tgatctggct atcttgctga caaaagcaag agaacatagc gttgccttgg taggtccagc 780

ggcggaggaa ctctttgatc cggttcctga acaggatcta tttgaggcgc taaatgaaac 840

cttaacgcta tggaactcgc cgcccgactg ggctggcgat gagcgaaatg tagtgcttac 900

gttgtcccgc atttggtaca gcgcagtaac cggcaaaatc gcgccgaagg aggtcgctgc 960

cgactgggca atggagcgcc tgccggccca gtatcagccc gtcatacgtg aagctagaca 1020

ggcttatctt ggacaagaag aagatcgctt ggcctcgcgc gcagatcagt tggaagaatt 1080

tgtccactac gtgaaaggcg agatcaccaa ggtagtcggc aaataatgtc taacaattcg 1140

<210> 5

<211> 34

<212> DNA

<213>Artificial sequence

<400> 5

cgggatcccg gtaccacctt ggttaataat attc 34

<210> 6

<211> 31

<212> DNA

<213>Artificial sequence

<400> 6

ctagctagct agtccaatcc agattgattt c 31

<210> 7

<211> 33

<212> DNA

<213>Artificial sequence

<400> 7

cggaattccg ctattaacat ttttaattaa aac 33

<210> 8

<211> 32

<212> DNA

<213>Artificial sequence

<400> 8

ggggtacccc tacttagaga gcgtacagct cc 32

<210> 9

<211> 31

<212> DNA

<213>Artificial sequence

<400> 9

ctagctagct agctcgactt cgctgctgcc c 31

<210> 10

<211> 31

<212> DNA

<213>Artificial sequence

<400> 10

cggaattccg cgaattgtta gacattattt g 31

<210> 11

<211> 19

<212> DNA

<213>Artificial sequence

<400> 11

cttcggatac ttgagagcg 19

<210> 12

<211> 19

<212> DNA

<213>Artificial sequence

<400> 12

gcagcacctt gaaaattgt 19

<210> 13

<211> 19

<212> DNA

<213>Artificial sequence

<400> 13

ctcgacttcg ctgctgccc 19

<210> 14

<211> 21

<212> DNA

<213>Artificial sequence

<400> 14

cgaattgtta gacattattt g 21

<210> 15

<211> 32

<212> DNA

<213>Artificial sequence

<400> 15

catgccatgg atgatgctgt ttttcagcac cg 32

<210> 16

<211> 32

<212> DNA

<213>Artificial sequence

<400> 16

ctagtctaga ttaaaaatta aattgacaag tg 32

<210> 17

<211> 30

<212> DNA

<213>Artificial sequence

<400> 17

catgccatgg atgaacatca aaaagtttgc 30

<210> 18

<211> 48

<212> DNA

<213>Artificial sequence

<400> 18

ctagtctaga ctagttattt gttaactgtt aattgtcctt gttcaagg 48

Claims

1. one plant of riemerella anatipestifer gene delection low virulent strain, it is characterised in that the bacterial strain is riemerella anatipestifer CH-1 Δ B739_1343, is named as Riemerella anatipestifer CH-1 Δ B739_1343, is protected within 30th in August in 2016 China typical culture collection center is hidden in, its preserving number is CCTCC NO:M2016438, the bacterial strain has lacked ferroheme transhipment The 2352bp of system B7391343 genes, the gene order for being lacked is as shown in SEQ ID NO.1.

2. the construction method of riemerella anatipestifer gene delection low virulent strain, it is characterised in that comprise the following steps：

2) the RA-CH-1B739_1343 genes that will have been expanded or so homology arm and Spec resistant genes carry out digestion and connected At night, build B739_1343-LSR fragments；

3) recombination suicide vector pEX18GM Δs B739_1343-LSR is built；

4) RA-CH-1B739_1343 gene-deleted strains are built, RA-CH-1B739_1343 gene-deleted strains are Mo Shi in pest of duck Bacillus gene lacks low virulent strain.

3. the construction method of riemerella anatipestifer gene delection low virulent strain according to claim 2, it is characterised in that institute The step of stating 1) in PCR amplification RA-CH-1B739_1343 genes or so homology arms and Spec resistant genes be specially：

1.1) two couples of primer B739_1343-L F/R and B739_1343-R are designed according to B739_1343 genes or so homology arm F/R, and in primer 5 '-end addition restriction enzyme digestion sites；By the use of RA-CH-1 genomes as template, respectively with B739_1343-L F/R and B739_1343-R F/R are primer amplification B739_1343 genes or so homology arm fragment B739_ 1343-L and B739_1343-R；PCR conditions are：98 DEG C of denaturation 30s, through 98 DEG C of 10s, 55 DEG C of 30s, 72 DEG C of 30s cyclic amplifications 30 It is secondary, 72 DEG C of extension 7min；

Wherein, B739_1343-L F/R include B739_1343-L F and B739_1343-L R,

The nucleotide sequence of B739_1343-L F adds restriction enzyme as shown in SEQ ID NO.5 at primer 5 '-end Restriction enzyme site is BamHI；The nucleotide sequence of B739_1343-L R is added as shown in SEQ ID NO.6 at primer 5 '-end Restriction enzyme digestion sites are NheI；

B739_1343-R F/R include the nucleotide sequence of B739_1343-R F and B739_1343-R R, B739_1343-RF As shown in SEQ ID NO.7, and it is EcoRI in primer 5 '-end addition restriction enzyme digestion sites；B739_1343-R R Nucleotide sequence as shown in SEQ ID NO.8, and be KpnI in primer 5 '-end addition restriction enzyme digestion sites；

1.2) the Spec resistance gene fragments design primer Spec F/R in plasmid pAM238, and added at primer 5 '-end NheI, EcoRI restriction enzyme site；By the use of plasmid pAM238 as template, Spec sequences are expanded by primer PCR of Spec F/R；PCR Condition is：98 DEG C of denaturation 30s, through 98 DEG C of 10s, 55 DEG C of 30s, 72 DEG C of 50s cyclic amplifications 30 times, 72 DEG C of extension 7min；

Wherein, Spec F/R include the nucleotide sequence of Spec F and Spec R, Spec F as shown in SEQ ID NO.9, and Primer 5 '-end adds NheI restriction enzyme sites；The nucleotide sequence of Spec R as shown in SEQ ID NO.10, and at primer 5 '-end Add EcoRI restriction enzyme sites.

4. the construction method of riemerella anatipestifer gene delection low virulent strain according to claim 3, it is characterised in that institute The step of stating 2) in structure B739_1343-LSR fragments be specially：The left side homology arm B739_1343-L that will be expanded is used BamHI, NheI carry out double digestion, and the right side homology arm B739_1343-R of amplification is carried out into double digestion with EcoRI, KpnI, will expand The Spec sequences of increasing carry out double digestion with NheI, EcoRI；Three fragments B739_1343-L, Spec, the B739_ that will be reclaimed 1343-R is connected overnight；Then with connection product as mould, B739_ is expanded with primer B739_1343-L F, B739_1343-R R 1343-LSR fragments.

5. the construction method of riemerella anatipestifer gene delection low virulent strain according to claim 4, it is characterised in that institute The step of stating 3) in structure recombination suicide vector pEX18GM Δs B739_1343-LSR be specially：The B739_ that will be expanded 1343-LSR fragments and plasmid pEX18GM carry out double digestion with BamHI and KpnI, the fragment and plasmid T4 ligases that will be reclaimed Connection overnight, connection product is transformed into Escherichia coli XL1-Blue competence, is coated the LB flat boards containing gentamicin and is entered Row screening；The monoclonal that will be obtained enters performing PCR identification, filters out positive gram containing plasmid pEX18GM Δs B739_1343-LSR It is grand；Take out kit extracting recombinant plasmid and carry out digestion identification using plasmid is small；To identify that correct recombinant plasmid transformed is arrived In S17-1 Escherichia coli.

6. the construction method of riemerella anatipestifer gene delection low virulent strain according to claim 5, it is characterised in that institute The step of stating 4) in structure RA-CH-1B739_1343 gene-deleted strains be specially：By Escherichia coli S17-1pEX18GM Δs B739_1343-LSR is inoculated in the LB fluid nutrient mediums of 10mL, and RA-CH-1 lines the LB solids training containing 5% degreasing sheep blood Support in base, 37 DEG C are cultivated to exponential phase；Scraping RA-CH-1 is the MgSO of 10mmol/mL in 1mL concentration₄In solution, then use MgSO₄Solution is washed 2 times；Calculate donor bacterium S17-1pEX18GM Δs B739_1343-LSR up to 2.5 × 10⁸Individual bacterium number, recipient bacterium RA- CH-1 is up to 10⁹Volume required for individual bacterium number；Donor bacterium, recipient bacterium are mixed according to the volume for calculating, mistake in filter is then injected into Filter；Remove filter membrane to be laid on blood plate, 30 DEG C of 5%CO₂Culture 8h；By the bacterium MgSO on filter membrane₄Eluant solution gets off, It is to be cultivated on the blood plate containing the spectinomycin that kanamycins and concentration are 80 μ g/mL of 50 μ g/mL to coat concentration；Choose The monoclonal for taking growth enters performing PCR identification, and structure obtains riemerella anatipestifer gene delection low virulent strain.

7. the construction method of riemerella anatipestifer gene delection low virulent strain according to claim 6, it is characterised in that institute The PCR authentication methods stated are as follows：

A) using RA-CH-1 conserved sequence primer 16s rRNA F/R, PCR expands the 16s rRNA fragments of RA-CH-1, according to electricity Whether the Candidate Mutant strain of swimming result judgement is RA-CH-1；If the band that electrophoresis is obtained goes out with by template amplification of wild strain CH-1 Stripe size it is consistent, judge that Candidate Mutant strain is RA-CH-1 accordingly, wherein, the nucleotide sequence such as SEQ of 16s rRNA F Shown in ID NO.11；The nucleotide sequence of 16s rRNA R is as shown in SEQ ID NO.12；

B) using the primer Spec P1/P2 of Spec resistant genes, Spec resistance gene fragments are expanded, is judged according to electrophoresis result Whether the replacement of producer；If the band that electrophoresis is obtained is in the same size with positive control, and with wild strain RA-CH-1 as template Fail to amplify band, judge that Spec genes have been substituted into Candidate Mutant pnca gene group accordingly；The nucleotides sequence of Spec F Row are as shown in SEQ ID NO.13；The nucleotide sequence of Spec R is as shown in SEQ ID NO.14；

C) primer B739_1343F/R, amplifying target genes is utilized to detect whether B739_1343 genes are lacked according to electrophoresis result Lose；If failing to amplify band by template of Candidate Mutant strain RA-CH-1 Δs B739_1343, with wild strain RA-CH-1 as template The band that amplification is obtained, it is in the same size with purpose band expection, judge that the gene B739_1343 of Candidate Mutant strain is lacked accordingly Lose；Wherein, the nucleotide sequence of B739_1343F is as shown in SEQ ID NO.15；The nucleotide sequence of B739_1343R such as SEQ Shown in ID NO.16；

D) primer SacB F/R are utilized, is expanded, detect whether suicide vector is thrown out of genome according to electrophoresis result；If with The band that plasmid pEX18GM is obtained for template amplification, it is in the same size with the expection of SacB genes, and with RA-CH-1, Candidate Mutant strain RA-CH-1 Δs B739_1343 fails to amplify band for template, judges that suicide vector is thrown out of genome accordingly；Wherein, SacB The nucleotide sequence of F is as shown in SEQ ID NO.17；The nucleotide sequence of SacB R is as shown in SEQ ID NO.18.

8. the riemerella anatipestifer gene delection low virulent strain described in claim 1 is preparing standby Riemerlla anatipestifer attenuated vaccine In application.

9. application according to claim 8, it is characterised in that low virulent strain RA-CH-1 Δs B739_1343 is to dosage>100 ×LD₅₀Wild virulent strain RA-CH-1 attack malicious protective rate up to 83.33%, can used as the candidate bacterium of RA gene-deleted vaccines Strain.