CN106676111A

CN106676111A - Tea tree caffeine synthetase gene promoter TCSP and application thereof

Info

Publication number: CN106676111A
Application number: CN201710096677.3A
Authority: CN
Inventors: 邓威威; 王荣秀; 张正竹; 江丽娜; 袁艳
Original assignee: Anhui Agricultural University AHAU
Current assignee: Anhui Agricultural University AHAU
Priority date: 2017-02-22
Filing date: 2017-02-22
Publication date: 2017-05-17
Anticipated expiration: 2037-02-22
Also published as: CN106676111B

Abstract

The invention provides tea tree caffeine synthetase gene promoter TCSP and application thereof in the preparation of transgenic plants. Tea tree DNA is used as a template to acquire a tee tree TCS gene promoter sequence by cloning through Genome Walking method, recombinant plant expression vector pKGWFS7-TCSP is constructed by using Gateway technology, Agrobacterium tumefaciens-mediated tobacco genetic transformation is utilized to carry out promoter activity function verification by means of expressing GUS (glucuronidase) gene. The specific caffeine synthetase gene promoter TCSP is acquired by cloning from tea trees for the first time, its activity is verified, and the promoter is significant to disclosing the synthetic mechanism of tea tree caffeine and biologically controlling the content of tea tree caffeine.

Description

Tea caffeine synthase promoter TCSP and its application

Technical field

The invention belongs to biological technical field, specifically, be related to tea caffeine synthase promoter TCSP and Its application.

Background technology

Caffeine (1,3,7- trimethyl xanthine) is a kind of nitrogen-containing compound, and the alkaloid in Camellia sinensis is based on purine base Body, and caffeine is the main body for constituting purine base, therefore caffeine plays very important effect in Camellia sinensis secondary metabolism. Caffeine not only can protect the plants from the injury of natural environment in plant, promote the growth of plant, while being also one Plant universal, there is the material of certain medical value.Appropriate intake caffeine can be with invigorating the stomach and promoting digestion, diuresis, reduction hypertension, raising Memory, anticancer, reduction type ii diabetes risk etc.；But it is abnormal that cause insomnia, anxiety, osteoporosises and fetus are understood in the intake of excess Shape etc..Therefore, the synthesis of caffeine in Camellia sinensis how is regulated and controled for the efficient utilization of Resources of Tea Plant has great significance.

Promoter is the DNA sequence of RNA polymerase specific recognition and combination, is an ingredient of gene, control The initial time of gene expression (transcription) and the degree of expression., just as " switch ", most genes are in regulating and expressing for promoter It is upper related to its controlling element, and present the characteristics of spatiality and timeliness.At present, plant genetic engineering research is main Content is the expression and regulation and control of gene, but exogenous gene expression amount deficiency be can not the preferable important original for obtaining transgenic plant Cause.Promoter plays pivotal role in terms of gene expression is determined, therefore it is to strengthen exogenous gene expression to study plant promoter Matter of utmost importance.

The content of the invention

It is an object of the invention to provide tea caffeine synthase promoter TCSP and its application.

In order to realize the object of the invention, the present invention is according to the tea caffeine synthase sequence included in GenBank (AB031280.1), primer is designed, tea caffeine synthase promoter is cloned using Genome Walking methods Sequence, expanding fragment length is 1357bp, and is named as TCSP.The tea caffeine synthase promoter of the present invention TCSP, its nucleotides sequence is classified as：

i)SEQ ID NO:Nucleotide sequence shown in 1；Or

ii)SEQ ID NO:Nucleotide sequence shown in 1 be substituted, lack and/or increase one or more nucleotide and Nucleotide sequence with identical function；Or

Iii) under strict conditions with SEQ ID NO:Sequence hybridization shown in 1 and the nucleotide sequence with identical function, The stringent condition be in 0.1 × SSPE containing 0.1%SDS or 0.1 × SSC solution containing 0.1%SDS, it is miscellaneous at 65 DEG C Hand over, and film is washed with the solution；Or

Iv) and i), ii) or nucleotide sequence iii) there is more than 90% homology and the nucleotide with identical function Sequence.

Using its function element of PlantCARE promoteres on-line analyses, analysis result is shown in Table 1.

The biological function credit analysis of the tea caffeine synthase promoter cis acting element of table 1

The present invention also provides the expression cassette containing tea caffeine synthase promoter TCSP.

The present invention also provides the carrier containing tea caffeine synthase promoter TCSP.

The present invention also provides engineering bacteria, transgenic cell line containing above-mentioned expression cassette or carrier.

The present invention also provides application of tea caffeine synthase promoter TCSP in regulation and control downstream gene expression.

Wherein, the downstream gene is including GUS etc..

The present invention also provides application of tea caffeine synthase promoter TCSP in prepare transgenosis plant.

Wherein, the plant is dicotyledon or monocotyledon.Preferably, the plant is including Nicotiana tabacum L. etc..

Aforementioned applications are successively building up to promoter TCSP on entry vector and purpose carrier using Gateway technologies, Then transgenic plant is prepared by Agrobacterium-mediated genetic transformation method.

Preferably, the entry vector and purpose carrier are respectively pDONR221 and pKGWFS7.

The present invention further provides the Specific PCR primers for expanding tea caffeine synthase promoter TCSP It is right, including GTP1:5 '-GGGGACAAGTTTGTACAAAAAAGCAGGCTATCAAAAACATAATCAAAACCAAAAC- 3 ' and GTP2:5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTGAGATACAAATCAAACAAACACAAA-3′。

First clone obtains a species specificity caffeine synthase promoter to the present invention from Camellia sinensis, and is built To in plant expression vector, the activity of the promoter is demonstrated in transgenic plant, for announcement tea caffeine synthesis Mechanism, the content of bioelectric detecting tea caffeine is significant.

Description of the drawings

Fig. 1 is Camellia sinensis genomic DNA testing result in the embodiment of the present invention 1；Wherein, M：DNA molecular amount standard, 1-2：Tea Tree genomic DNA.

Fig. 2 is tea caffeine synthase promoter GTP1 and GTP2 specific primer PCR detections in the embodiment of the present invention 1 As a result；Wherein, M：DNA molecular amount standard, 1-2：PCR primer.

Fig. 3 is the Agrobacterium PCR qualification results that recombinant vector pKGWFS7-TCSP is carried in the embodiment of the present invention 2；Its In, M：DNA molecular amount standard, 1-3：Agrobacterium (false positive clones) with recombinant vector pKGWFS7-TCSP, 4-10：Carry The Agrobacterium (positive colony) of recombinant vector pKGWFS7-TCSP.

Fig. 4 is the plasmid map of entry vector pDONR221 of the present invention.

Fig. 5 is the plasmid map of the object of the invention carrier pKGWFS7.

Fig. 6 is transgenic tobacco leaf tea caffeine synthase promoter regulation GUS bases in the embodiment of the present invention 2 Because of the result expressed；Wherein, A：Negative control (wild-type tobacco)；B：Positive control (pKGWFS7 empty carriers)；C：Recombinant vector pKGWFS7-TCSP。

Specific embodiment

Following examples are used to illustrate the present invention, but are not limited to the scope of the present invention.If not specializing, embodiment According to conventional laboratory conditions, such as Sambrook equimoleculars Cloning: A Laboratory Manual (Sambrook J＆Russell DW, Molecular Cloning:A Laboratory Manual, 2001), or according to the condition of manufacturer's description suggestion.

The clone of caffeine synthase promoter TCSP in the Camellia sinensis of embodiment 1

1.1 extract genome DNA (Biomiga test kits)

(1) weigh about 0.2g and relax tea morning Camellia sinensis tender leaf liquid nitrogen grinding in the mortar of pre-cooling plus appropriate to powder.

(2) powder is transferred in the centrifuge tube of 2ml, 900 μ l Buffer P1 and 10 μ l beta -mercaptoethanols is added immediately, It is placed in 65 DEG C of water-baths after instantaneous vortex, water-bath 10min, period reverse mixing 3-4 time.(5 μ l are added before water-bath RNaseA)

(3) 140 μ l Buffer P2, vortex concussion are added to mix.10min is centrifuged under 13000rpm.

(4) careful supernatant of drawing is moved in new 2ml centrifuge tubes, it is to avoid pick up precipitation, and the P3 for adding 0.5 times of volume is mixed Afterwards, the dehydrated alcohol of 0.5 times of volume of mixed liquor is added, it is fully reverse to mix.

(5) a DNA adsorption column is inserted into 2ml collecting pipes, sample liquid is added in adsorption column, 12000rpm centrifugation 30s, Waste liquid is outwelled, adsorption column is reinserted in collecting pipe.

(6) 650 μ lDNA Wash Buffer (having added ethanol), 12000rpm centrifugation 30s are added, waste liquid is outwelled, will be inhaled Attached column is reinserted in collecting pipe.

(7) 450 μ l DNA Wash Buffer rinsings are added, waste liquid is outwelled after centrifugation adsorption column is reinserted into collecting pipe In.

(8) 13000rpm uncaps and 1min is centrifuged.

(9) DNA adsorption columns are inserted in 1.5ml centrifuge tubes, 100-150 μ l Elution is added in adsorption column Buffer (65 DEG C of preheatings).It is stored at room temperature 2min, 13000rpm centrifugation 1min.Repeat hanging column.

(10) integrity of electrophoresis detection DNA：1-2 μ l sample DNA point samples are taken, with the quick electrophoresis of 1% agarose gel 30-40min, detects DNA integrity.Whether there are pollution, concentration 404ng/ μ l, D260/ using accounting quantitative instrument detection sample DNA 280 (1.8-2.0), D260/230 (1.8-2.0).Sample is put into into -20 DEG C of preservations.Camellia sinensis genomic DNA testing result is shown in figure 1。

1.2 genomic DNA enzyme action and purification

(1) genomic DNA enzyme action

From Stu I, tetra- kinds of restricted enzyme of Pvu II, EcoR V, Dra I, Camellia sinensis genomic DNA is carried out respectively Enzyme action, endonuclease reaction system is：

Gently overturn uniform up and down, after 37 DEG C of water-bath 2h, be vortexed at a slow speed 5-10s, and 37 DEG C of enzyme action are overnight.

After enzyme action terminates, 5 μ l are taken in each reaction system and detects enzyme action effect in 1% agarose gel electrophoresiies, if electrophoresis Represent that enzyme action is complete in shape is uniformly smeared.

(2) purification of digestion products

1) equal-volume phenol is added in each reaction system, at a slow speed after vortex 5-10s, of short duration centrifugation makes water phase and organic faciess Separate.

2) upper strata aqueous phase is transferred in the centrifuge tube of a new 1.5ml with pipettor, abandons organic faciess.

3) and then in each centrifuge tube add isopyknic chloroform, at a slow speed after vortex 5-10s, it is of short duration centrifugation make water phase and Organic phase separation.

4) upper strata aqueous phase is transferred in a new 1.5ml centrifuge tubes with pipettor, abandons organic faciess.

5) in each centrifuge tube add 2 times of volume pre-coolings 95% ethanol, the 3M sodium acetates (pH4.5) of 1/10 volume, 20g glycogens, at a slow speed after vortex 5-10s, 15000rpm is centrifuged 10min.

6) supernatant liquid is slowly poured out, adds the μ l of the 80% ethanol 100 washing precipitations of pre-cooling.

7) 15000rpm, is centrifuged 5min, slowly pours out after supernatant, drying at room temperature precipitation.

8) with 20 μ l TE (10mM Tris, 0.1mM EDTA, pH7.5) dissolution precipitation.

9) at a slow speed after vortex 5-10s, agarose gel sample detection DNA mass after purification of the 1 μ l 1% is respectively taken.

The connection of 1.3 joints and digestion products

Reaction system needs to set up 4 coupled reactions, i.e. Camellia sinensis genomic DNA digestion products and is provided with test kit respectively Joint be connected.Concrete operation step is as follows：

(1) from each centrifuge tube, 4 μ l are respectively taken through restricted enzyme Stu I, Pvu II, EcoR V, Dra I enzymes Cut with the DNA of purification respectively in the centrifuge tube of new 0.5ml, then sequentially add：

BD Genomewalker Adaptor(25μM) 1.9μl

10×Ligation Buffer 1.6μl

T₄DNA Ligase(6Units/μl) 0.5μl

(2) 16 DEG C, connection is overnight.

(3) 70 DEG C, 5min, with terminating reaction.

(4) in each pipe, 72 μ l TE (10mM Tris, 1mM EDTA, pH7.5) are added, at a slow speed after vortex 10-15s, After of short duration centrifugation, DNA library-Stu I, DNA library-Pvu II, DNA library-EcoR V are respectively obtained, DNA library-Dra I, are placed in -20 DEG C of refrigerators stand-by.

The design of 1.4 specific primer GSP1 and GSP2 and synthesis

Before performing PCR amplification is entered, the known cDNA sequence of caffeine synthase (TCS) gene is analyzed and is drawn Thing is designed.During design of primers, it is ensured that specific primer GSP1 can not be overlap with nested primer GSP2, and designed Specific primer should be held as close as the 5 ' of known array.Meanwhile, designed gene-specific primer should have 25-30 Individual length of nucleotides, between 40-60%, the annealing temperature of recommendation is 67 DEG C to G/C content, and gene-specific primer GSP1, The adapter-primer that GSP2 is provided respectively with test kit (BD Genomewalker Universal Kit, Clontech, USA) AP1, AP2 pairing is good.

Ensure above principle on the basis of, using the softwares of DNAStar and Primer Premier 5 on Genbank Tea caffeine synzyme cDNA sequence (AB031280.1) design gene-specific primer GSP1 and GSP2 that Jing is logged in, and hand over Synthesized by Shanghai life work.Primer sequence is respectively：

GSP1:5′-CACAACCCAAGTCCGCTGCGTTAAGA-3′

GSP2:5′-AACAACACTTCGTTCACCTTCCCCGC-3′

AP1:5′-GTAATACGACTCACTATAGGGC-3′

AP2:5′-ACTATAGGGCACGCGTGGT-3′

1.5 nest-type PRCs are once expanded

(1) four PCR pipes of labelling, according to following sample-adding amount biased sample：

It is vortexed and mixes, and after of short duration centrifugation, add template, i.e., respectively takes the DNA library-Stu I of 2 μ l, DNA In above-mentioned PCR pipe, of short duration centrifugation makes for library-Pvu II, DNA library-EcoR V, DNA library-Dra I Solution combines in ttom of pipe.

(2) four mixed systems are placed in PCR thermal cyclers, using following two-step method performing PCR amplification is entered.98 DEG C pre- Degeneration 3min, by 94 DEG C of 30s, 67 DEG C of 30s, 72 DEG C of 95s, circulates 30 times, then 72 DEG C of 15min, using 1.2% agarose gel Sample detection PCR primer.

1.6 nest-type PRCs carry out secondary amplification

(1) four 0.5ml centrifuge tubes are taken, the above-mentioned PCR primers of 1 μ l and 49 μ l ddH is taken respectively₂O is mixed simultaneously in centrifuge tube Of short duration centrifugation, respectively obtains four diluted PCR primers as nest-type PRC template.

(2) four PCR pipes of labelling, according to following sample-adding amount biased sample：

After mixing, it is vortexed and mixes, and after of short duration centrifugation, respectively take 48 μ l mixed liquors in four PCR pipes, then is separately added into 2 μ In above-mentioned PCR pipe, of short duration centrifugation makes solution combine in ttom of pipe to the above-mentioned diluted nest-type PRC templates of l.

(3) four mixed systems are placed in PCR thermal cyclers, using following two-step method performing PCR amplification is entered.98 DEG C pre- Degeneration 3min；94 DEG C of 30s, 67 DEG C of 30s, 72 DEG C of 95s, circulate 30 times；72 DEG C of 15min, using 1.2% agarose gel loading Detection PCR primer.

(4) specific band after is terminated electrophoresis cuts glue, reclaims and is attached, and sample presentation enters to Shanghai life work after conversion Row sequencing.

1.7 the connection conversion of genes of interest

Take the μ l of PCR purified products 6.5, the μ l of PMD18-T 0.5, the mix homogeneously of Solution I, after being put into 16 DEG C of water-baths overnight It is placed on ice；During mixed liquor is added in 25 μ l competence, mix, ice bath 30min is flicked once every 10min；42 DEG C of heat shocks 45s, is placed at once 3min on ice.Add 500 μ l LB fluid mediums, 37 DEG C of 200rmp, 1h.Take 50-100 μ l to be uniformly applied to On solid LB containing AMP, 37 DEG C are put into, incubated overnight.

1.8 bacterium colony PCR and positive detection

Bacterium line is chosen, cultivating 5-6h, then choose bacterium carries out bacterium colony PCR.Bacterium colony PCR system：The μ l of rTaq mix 25, upstream and downstream The each 1 μ l of primer, choose single bacterium colony and add mixing in PCR pipe with toothpick, add ddH₂The μ l of O to 50, centrifugation is mixed, mixed liquor equivalent point Loaded in four PCR pipes, of short duration centrifugation makes solution combine in ttom of pipe.PCR programs：95 DEG C of 3min denaturations；98 DEG C of 10s, 67 DEG C 30s, 72 DEG C of 95s, circulate 30 times；72℃15min.Electrophoresis detection is carried out to PCR primer and Shanghai life work is sent to being sequenced, selected Select the correct monoclonal of overlap joint sequence.Positive bacterium colony containing genes of interest is protected into bacterium and upgrading grain.Sample is put into into -20 DEG C of guarantors Deposit.

The amplification of 1.9 tea caffeine synthase promoteres TCSP

According to promoter sequence design specific primer GTP1 and GTP2 that clone obtains, the primer for verifying empty carrier is EGFP-C and EGFP-N：

GTP1:5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTATCAAAAACATAATCAAAACCAAAAC-3′,

GTP2:5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTGAGATACAAATCAAACAAACACAAA-3′

EGFP-C:5′-CATGGTCCTGCTGGAGTTCGTG-3′

EGFP-N:5′-CGTCGCCGTCCAGCTCGACCAG-3′

PCR is expanded

(1) one PCR pipe of labelling, according to following sample-adding amount biased sample：

It is vortexed and mixes, and after of short duration centrifugation, mixed liquor equivalent is sub-packed in of short duration centrifugation in four PCR pipes, combines in solution Ttom of pipe.

(2) four mixed systems are placed in PCR thermal cyclers, according to following procedure performing PCR amplification is entered.98 DEG C of denaturations 3min；94 DEG C of 30s, 73.5 DEG C of 30s, 72 DEG C of 95s, circulate 30 times；72 DEG C of 15min, are examined using 1.2% agarose gel loading Survey PCR primer.Testing result is shown in Fig. 2.

The length of pcr amplification product is 1357bp, is named as tea caffeine synthase promoter TCSP, its Nucleotide sequence such as SEQ ID NO:Shown in 1.With its function element of PlantCARE promoteres on-line analyses, analysis result is shown in Table 1。

The structure of the Transgenic Tobacco plant of embodiment 2 and the checking of promoter activity

Promoter sequence is imported in plant expression vector (pKGWFS7) using Gateway technologies, builds recombinant plant table Up to carrier, pKGWFS7-TCSP is named as, and using agriculture bacillus mediated Nicotiana tabacum L. genetic transformation, by expressing gus gene Mode carries out the functional verification of promoter activity.

2.1 vector constructions and identification

(1) BP reactions

System is incubated overnight at being placed in 25 DEG C, and after reaction, plus the Proteinase K of the μ g/ μ l of 2 μ l 2 are processed at 37 DEG C 10min, then BP product (entry vector) is proceeded in 50 μ l escherichia coli Trans1-T1, sieve on the LB plates containing Kan Choosing, detection is obtained extracts plasmid and is put into -20 DEG C of preservations after positive single bacterium colony.

(2) LR reactions

System is incubated overnight at being placed in 25 DEG C, and after reaction, plus the Proteinase K of the μ g/ μ l of 2 μ l 2 are processed at 37 DEG C 10min, then product is proceeded to into the screening on the LB plates containing Spec in 50 μ l escherichia coli Trans1-T1, detection obtains sun Property single bacterium colony after extract and plasmid and be put into -20 DEG C of preservations.The recombinant plant expression vector that structure is obtained is named as into pKGWFS7- TCSP。

Carrier pKGWFS7-TCSP is imported Agrobacterium by 2.2 with electric shocking method

The recombinant vector and unloaded (pKGWFS7) plasmid for taking 5 μ l is added in the EHA105 Agrobacterium competence of 50 μ l, is mixed Afterwards ice bath 30min, is moved to mixed liquor in electric shock cup using liquid-transfering gun, after being shocked by electricity twice under A9r patterns with electroporation, transfer To in the centrifuge tube of 1.5ml, 1ml LB are added, be put into 200rpm, 3h in 28 DEG C of shaking tables.After 2000rpm centrifugations, by 900 μ l It is clear careful to suction out, stay 100 μ l to be centrifuged after bottom of the tube thalline fully beats, it is evenly coated on the LB flat boards containing rif and Spec, 28 DEG C are cultivated 2-3 days.The line of monoclonal bacterium is chosen, cultivating 1-2 days, then choose bacterium carries out bacterium colony PCR.Positive single bacterium colony is carried out to shake bacterium And it is stored in -80 DEG C.

The Agrobacterium PCR qualification results for carrying carrier pKGWFS7-TCSP are shown in Fig. 3.Carrier pDONR221 and pKGWFS7 Plasmid map see Fig. 4 and Fig. 5 respectively.

2.3 Agrobacteriums inject osmosis transformation of tobacco, tobacco leaf gus gene transient expression

(1) Agrobacterium with conversion carrier plasmid and the control strain with empty carrier are on the LB flat boards containing 50mg/L Line recovery, picking single bacterium colony shakes bacterium overnight in the LB fluid mediums containing identical antibiotic, and bacterial concentration reaches OD₆₀₀Value For 0.8-1.2.

(2) respectively Jing 6000rpm centrifugations 10min discards LB culture medium to bacterium solution, and thalline is suspended in 1/2MS, and adds second Acyl syringone (As) to 200 μm of ol/L of final concentration, the concentration of suspension are adjusted to OD₆₀₀It is worth for 0.6-0.8 or so, is stored at room temperature Activation 2h.

(3) bacterium solution is drawn respectively with disposable syringe, syringe is pressed in into blade top on tobacco leaf, with finger Blade bottom is propped up, is gently exerted oneself bacterium solution force feed in syringe and is penetrated in leaf tissue, by whole blade injector bacterium solution.

(4) tobacco plant of Jing injections cultivates 2-3d at 25 DEG C under dark treatment.

(5) clip injection blade carries out GUS histochemical stain detections, and blade material uses the card punch of a diameter of 15mm Punched, in being placed in GUS dyeing liquors, dyeed 16h.

(6) with 70%, 80%, 90% dehydrated alcohol decolourize to chlorophyll to completely remove respectively, observation contrast whether there is GUS tables Up to coloration, record and take pictures, as a result see Fig. 6.

From fig. 6, it can be seen that blue or blue spot is not presented on (A) negative control (wild-type tobacco) blade, And encircled portion and experimental group (C, containing recombinant vector) on (B) positive control (containing pKGWFS7 empty carriers) blade are whole The position or site of GUS activity is presented blue on blade, shows that the promoter gene is active.

Although above with a general description of the specific embodiments the present invention is described in detail, On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause This, without departing from theon the basis of the spirit of the present invention these modifications or improvements, belong to the scope of protection of present invention.

Sequence table

<110>Agricultural University Of Anhui

<120>Tea caffeine synthase promoter TCSP and its application

<130> PI201710390

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 1357

<212> DNA

<213>Camellia sinensis (Camellia sinensis)

<400> 1

atcaaaaaca taatcaaaac caaaacaaat tatcaaaatc aaatatgtct aacaaaatac 60

ataagaatac gaaaagtgta ctgaattttt gtattttttg tatttatatt tttggtaatt 120

agtaaatttt ttaaagattt tttttacaaa tattatactt tttaagtata tttatgttag 180

gtgtatctaa aaattttaaa aaattgctta gaatattaaa aaaaatttag tgaaaacaaa 240

aaaaaaaatg aaaaaaaaaa attcaatttt ctaaaaagtg aatcctgaaa attcaaacca 300

aacaaactaa atttgtcgtt agagtattaa ataatttctc tataagtgtt tgtcaatttt 360

agtacttctt ttaaagtctt aagattgata tttaaactca ttaaattgga tcagaattat 420

tttttaaagt ttttcgtaga tgggtcggat ttggaaatgt ttcttcctgc tcgccctagc 480

atgattatta atatatatta tgtacatgta aaattttact ataaatactt cttattgtat 540

gtattcttaa cttatattat acttttaagt tacacaaatt ttttttttca gttataatta 600

attttttttt gtagttgcga tcttatttta gttatgactc ataatatctc atgtattatt 660

tggttgactt tttttttgct tttttgtttt gactttaaag tatgaaatta tgtcattttt 720

tttttagtta taaggtgcat acgatacata ccctttaaat ttttcttgta tatacatatg 780

tacatattaa tatctgtata tatataattt acaaaatttt acttagaata aaaagatata 840

cttaaaatga aaaatgtatt tatttaagtt aatatttaag atgtaatgac taaatattaa 900

ggtgtaattt taattagctc gattttgatt ttaaattttt aactttgtct caatttggtc 960

aaatggatta caactcttaa tattttctaa taaaaaaata tgtatataag tgtcatgtgt 1020

ctcaaaatta tgaatttatc tagctcagta agtgaacctc aactaattta gtgataattt 1080

ttcttaaaaa acactaatga tattattaat ttgatcaaat tgacgtaaaa tctaaaatta 1140

aggatcaaaa tcaaatcaat taaaaatgta aaaactaaaa taaaacaaaa gataaaatat 1200

aaggacatcc gtgtaattca cccacaaaat tatcattttt cagttttata atattttaaa 1260

ttgtttatat gagtttgttg ggcaagttcg agattgtact agcaagattt taacgctagc 1320

ttgggaggga ttttgtgttt gtttgatttg tatctca 1357

<210> 2

<211> 55

<212> DNA

<213>Artificial sequence

<400> 2

ggggacaagt ttgtacaaaa aagcaggcta tcaaaaacat aatcaaaacc aaaac 55

<210> 3

<211> 55

<212> DNA

<213>Artificial sequence

<400> 3

ggggaccact ttgtacaaga aagctgggtt gagatacaaa tcaaacaaac acaaa 55

<210> 4

<211> 26

<212> DNA

<213>Artificial sequence

<400> 4

cacaacccaa gtccgctgcg ttaaga 26

<210> 5

<211> 26

<212> DNA

<213>Artificial sequence

<400> 5

aacaacactt cgttcacctt ccccgc 26

<210> 6

<211> 22

<212> DNA

<213>Artificial sequence

<400> 6

gtaatacgac tcactatagg gc 22

<210> 7

<211> 19

<212> DNA

<213>Artificial sequence

<400> 7

actatagggc acgcgtggt 19

<210> 8

<211> 22

<212> DNA

<213>Artificial sequence

<400> 8

catggtcctg ctggagttcg tg 22

<210> 9

<211> 22

<212> DNA

<213>Artificial sequence

<400> 9

cgtcgccgtc cagctcgacc ag 22

Claims

1. tea caffeine synthase promoter TCSP, it is characterised in that its nucleotides sequence is classified as：

i)SEQ ID NO:Nucleotide sequence shown in 1；Or

ii)SEQ ID NO:Nucleotide sequence shown in 1 is substituted, lacks and/or increases one or more nucleotide and has The nucleotide sequence of identical function；Or

Iii) under strict conditions with SEQ ID NO:Sequence hybridization shown in 1 and the nucleotide sequence with identical function, it is described Stringent condition is in 0.1 × SSPE containing 0.1%SDS or in the 0.1 × SSC solution containing 0.1%SDS, to hybridize at 65 DEG C, and Film is washed with the solution；Or

Iv) and i), ii) or nucleotide sequence iii) there is more than 90% homology and the nucleotides sequence with identical function Row.

2. containing the expression cassette of promoter TCSP described in claim 1.

3. containing the carrier of promoter TCSP described in claim 1.

4. containing the engineering bacteria of carrier described in expression cassette described in claim 2 or claim 3.

5. application of promoter TCSP described in claim 1 in regulation and control downstream gene expression.

6. application according to claim 5, it is characterised in that downstream gene includes GUS.

7. application of promoter TCSP described in claim 1 in prepare transgenosis plant, wherein the plant includes Nicotiana tabacum L..

8. application according to claim 7, it is characterised in that successively built promoter TCSP using Gateway technologies To on entry vector and purpose carrier, then transgenic plant is prepared by Agrobacterium-mediated genetic transformation method.

9. application according to claim 8, it is characterised in that.The entry vector and purpose carrier are respectively pDONR221 And pKGWFS7.

10. it is used to expand the Specific PCR primers pair of promoter TCSP described in claim 1, it is characterised in that including GTP1: 5 '-GGGGACAAGTTTGTACAAAAAAGCAGGCTATCAAAAACATAATCAAAACCAAAAC- 3 ' and GTP2:5′- GGGGACCACTTTGTACAAGAAAGCTGGGTTGAGATACAAATCAAACAAACACAAA-3′。