CN106661620A - Methods of linearly amplifying whole genome of a single cell - Google Patents

Abstract

Embodiments of the disclosure encompass methods of amplifying nucleic acid from one or more cells using MALBAC (multiple annealing and looping-based amplification cycles) primers. In particular embodiments, the nucleic acid is amplified as amplicons in a linear manner. Specific embodiments include the removal or effective destruction of nonlinearly produced amplicons.

Description

Unicellular full-length genome linear amplification method

This application claims the priority of U.S. Provisional Patent Application Serial No. 61/989,002 (is filed in May 6 in 2014 Day), it is hereby incorporated herein by reference.

Technical field

The embodiment of the disclosure includes the fields such as nucleic acid amplification, nucleic-acid manipulation, science of heredity, medical science.The enforcement of the disclosure The field of scheme is related to include such as genome from one or more cells or the amplification of transcript profile.

Background of invention

For to unicellular heterogeneous huge interest, people are attempted recently using whole genome amplification and robustness (robustness) carry out unicellular gene order-checking (Navin et al., 2011；Fan et al., 2011；Lao et al., 2008；Hou Et al., 2012；Cheng et al., 2011；Telenius et al., 1992；Zhang et al., 2006；Zhang et al., 1992).So And, so far, the method for being used is typically both under being limited to relatively low coverage rate.Polymerase chain reaction (PCR) is to spy Determine the goldstandard of the DNA cloning in region.Depend on using the exponential amplification of random primer, the whole genome amplification side of PCR-based Method introduces strong sequence dependent deviation, therefore represent homogeneous to whole gene group is undesirable.Have been developed for multiple Displacement amplification (MDA) with overcome PCR these shortcomings (Dean et al., 2002；Dean et al., 2001), but MDA still shows There is the deviation that can not ignore.For those reasons, to the single body class cell of permission accurate detection single nucleotide acid variant (SNV) Genome sequencing is also without trustworthy account.

To realize being used for single celled full-length genome SNV, and with the accuracy of a large amount of sequencings that can match in excellence or beauty, main skill Art obstacle is the amplification mistake for producing in non-linear amplification in prior art and multiplying.In non-linear amplification, polymerase The mistake of generation is copied when can be used as template with new synthetic product in subsequent circulation.For standard PCR amplification has thousands of Templates up to ten thousand can be used for starting, and these mistakes will not cause any problem, because each random error in concrete copy Diluted by substantial amounts of other separate copies.However, for unicellular amplification, situation but and is differed, because a cell is only There is the copy of each unique chromosomal as template.In non-linear amplification, the mistake produced in first circulation will be by The DNA product of half owns, and these mistakes will continue to be copied by the percentage to be similar to.Finally in sequencing data, it is impossible to These mistakes heterozygote variant real in unicellular with this is mutually distinguished.More importantly, this false positive rate can not be by letter Singly increase sequencing depth and reduce.In order to overcome the technical problem, need to carry out linear amplification.When amplification is linear, institute There is DNA product all directly by primary template copy.Therefore, it is independent generation to expand mistake, and can be produced in linear amplification Dilute in thing.

Invention summary

The present invention is directed system, the method and composition for expanding a large amount of nucleic acid.In a particular embodiment, institute State genome wholly or in part or one or more cells that multiple nucleic acids are one or more cells or acellular material or The transcript profile of acellular material, such as rare nucleic acid material or in apparent gene group, the i.e. genome after disulphide conversion Rare nucleic acid material in material, and for example selected genome, i.e. chromatin precipitation Post genome.The genome or transcript profile Can come from unicellular or multiple cells, such as two cells, three cells, four cells, five cells etc..Gene wherein In the embodiment of multiple cells, the plurality of cell can for the targeting district of group or transcript profile or apparent gene group or genome Being identical type, genotype or phenotype.In the case that wherein nucleic acid is derived from multiple cells, for example, the cell can come From identical source or from homologue.In certain embodiments, cell is fetal cell, cancer cell, doubtful cancerous cells Deng.Acellular nucleic acid material includes the nucleic acid in being present in blood or other body fluid.

The embodiment of the disclosure relates generally to for amplification gene group sequence, such as the full base of unicellular or optional many cells Because of the method and composition organized.The embodiment of the disclosure is also generally directed to for expanding part or all of transcript profile, such as slender The method and composition of the whole transcript profile of born of the same parents or optional many cells.It will be appreciated by those skilled in the art that disclosed method permits Perhaps linear amplification is carried out to concrete nucleic acid from genome or transcript profile, wherein the products therefrom of the present invention is a large amount of amplicons (representing all or part of respective genome or transcript profile), and at least in some cases the linear amplicon for producing can enter one Step is expanded in linearly or nonlinearly mode (as passed through PCR).

The embodiment of the disclosure include in whole gene group with high homogeneity and high fidelity to it is unicellular (or Optional many cells) method that carries out whole genome amplification.Such method allows for example to copy number variation (CNV) and mononucleotide becomes The accurate detection of different (SNV), and optionally for example by standard high-flux sequence platform or microarray or PCR-based gene point Type detects the presence of CNV or SNV according to the method for the present invention.

The embodiment of disclosed method provides significantly improving for method currently used in two teams this area.For example, Amplicon (that is, is produced from unicellular DNA profiling by the linear amplification from the primordial unicellular DNA fragmentation for covering full-length genome Separate copies) accuracy that carries out SNV detections is greatly enhanced relative to the method in this area.It is right that linear amplification is allowed Effective filtration of amplification mistake, therefore realize for example suitable with a large amount of sequencings for SNP detections precision.Provided herein is side The specific embodiment of method is that the amplicon of each separate copies introduces " bar code ".The bar code allows to determine on genome Each locus false positive rate.

There is provided herein can be used for extracting from the method that a single celled DNA fragmentation is expanded, although at some In the case of DNA it is extractable from more than one cell.Therefore, at least some of method permission is unicellular to one carries out homogeneous full base Because of a group amplification, it allows to copy number variation (CNV) and single nucleotide variations by standard high-flux sequence platform accurate detection (SNV)。

The embodiment of the disclosure allows to use accurate linear amplification method, and it will be that one and only one cell are provided Accurate SNV detections.Under specific circumstances, it is not necessary to which relationship cell is filtering false positive.The embodiment of the disclosure is to ability One of domain is improved by allowing to use histology clinical sample as the cell derived of nucleic acid to be amplified.

There is provided herein method be used for by by different DNA fragmentations be separated into millions of small sizes react compartments and The deviation in amplification is eliminated without being expanded under the interference between different amplicons and competition.Therefore, in specific embodiment In, single amplicon is present in reacting hole to be used to for example expand by PCR.In some aspects, the reaction in compartment is reacted Volume be ascend to heaven to nanoliter volume.

Provided herein is method embodiment by carrying out each DNA in reaction compartment separate in microfluidic devices The amplification of fragment or the separation produced for example, by emulsifying agent are reacted drop and significantly improve homogeneity.In some cases, exist Respective amplification is carried out with little into the thousands of of volume of ascending to heaven or more reaction compartments.In specific aspect, expand at each Saturation in individually reacting, non-linear amplification (the amplification deviation of sequencing dependence PCR deviation or MDA) is minimized.

In a particular embodiment, the polymerase that methods described is used have strong displacement intensity and it is high with primer- The binding constant of DNA compounds.

In one embodiment, there is the method for producing amplicon from one or more cellular linears, comprise the following steps： Polymerase by first a large amount of primers are contacted from the nucleic acid of one or more of cells and comprising strand-displacement activity, it is described to connect Triggering is born under the conditions of 0 DEG C to about 35 DEG C of temperature range, wherein the primer and the Nucleic acids anneal, and the primer passes through Polymerase is extended, wherein first a large amount of primers have following characteristics：A) it is rich in the G of 40%-60% or rich in 40%- 60% C；And restriction endonuclease site b) is included, so as to produce the nucleic acid-templated mixture comprising primer annealing； The nucleic acid-templated of primer annealing is carried out by two-wheeled or many wheel extensions, unwind and annealing steps, nucleic acid-templated, linear product is thus produced Raw half amplicon and the mixture of the full amplicon of non-linear generation；The mixture is placed in can make two of full amplicon Under conditions of end can anneal with one another, so as to produce the full amplicon of cyclization；The full amplicon contact of the cyclization is limited Property endonuclease so that full amplicon can not be with first a large amount of primers or second a large amount of primer annealings, wherein second largest G or C of the amount primer rich in 40%-60%；And first a large amount of primers or second a large amount of primers are made with remaining line in mixture Property produce half amplicon anneal and extend, wherein it is described annealing and extend in the case that nucleic acid will not further unwind send out It is raw, thus produce the linear full amplicon for producing.In a specific embodiment, the method is further included makes linear product The step of raw full amplicon is expanded.In one embodiment, outside polymerization azymia used in disclosed method Cut nuclease.In a particular embodiment, the contact in blend step is betided at a temperature of less than 60 DEG C.In some feelings Under condition, methods described is additionally provided with and obtains nucleic acid including from one or more cells, such as by cell lysis and from cell Extract suitable.In a particular embodiment, the nucleic acid includes genomic DNA.In some cases, the nucleic acid includes RNA And methods described further include from RNA produce cDNA the step of.

In embodiment of the present disclosure, specific primer can be used, at least including first or second a large amount of primers.In tool In body embodiment, first, second or the primer of the two include following formula：

X_nY_mZ_p,

Wherein n is the G rich in 40%-60% or the C rich in 40%-60% more than 2 and X, wherein Y be any nucleotides simultaneously And m is 3-8 nucleotides, wherein working as X_nIt is to be G or work as X rich in Z during G_nIt is that Z is C when being rich in C, p is 2-4 nucleotides. Under concrete condition, m is 5 nucleotides；P is 3 nucleotides；N is 20-40 nucleotides；N is 25-35 nucleotides；Or n is 24-28 nucleotides.In a specific embodiment, polymerase is Bst large fragments or the polymerases of pyrophage 3173. Under specific circumstances, the nucleic acid-templated extension step of primer annealing occurs within the temperature range of 30 DEG C to 65 DEG C.Concrete In embodiment, after the nucleic acid-templated extension of primer annealing, nucleic acid unwinds at a temperature of at least 90 DEG C.In some feelings Under condition, after nucleic and melting, nucleic acid is cooled to into the temperature less than primer melting temperature, and addition can heat-inactivated polymerase. In some cases, add can be after heat-inactivated polymerase, in the temperature of the Tm less than PCR primer and higher than PCR primer Tm temperature between, such as the temperature at 58 DEG C -67 DEG C carries out thermal cycle.In some cases, thermal cycle can include 10- 30 circulations.In a particular embodiment, hot inactivation is carried out to polymerase, is subsequently added restriction endonuclease.

In some embodiments, to have a primer annealing it is nucleic acid-templated carry out three to ten continuously extend, unwind and Annealing steps.In some aspects, restriction endonuclease can at a temperature of more than 50 DEG C digesting nucleic acid, such as BtsCI/ BseGI.In certain embodiments, the isothermal duplication (LAMP) for being mediated by polymerase chain reaction (PCR) or ring is produced to linear Raw full amplicon is expanded.In a particular embodiment, at least linear full amplicon for producing of great majority is to be separated from each other 's.In particular aspects, at least linear full amplicon for producing of great majority is each placed in separate container, such as microporous substrate Hole in.In certain embodiments, this some holes includes one or more amplification reaction reagent.

In a particular embodiment, the amplicon to separately including is expanded, for example, enter performing PCR or LAMP.At some In embodiment, the linear full amplicon for producing is undergone in uracil-DNA- glycosylases and DNA glycosylases-lyases The effect of nuclease VIII mixtures is cut, the effect of S1 nucleases or T4 polymerases is then subjected to.In a particular embodiment, it is right The linear full amplicon for producing is sequenced or is carried out library construction.In a particular embodiment, one or more are determined linear Certain nucleotides or nucleotide sequence for the full amplicon for producing, for example, represent in the amplicon of nucleic acid mutation and be mutated.Concrete In embodiment, the mutation is disease related mutation.In a particular embodiment, one or more of cells are from tire Youngster, baby, children or adult.One or more of cells can be fixed in Histological preparations.However, in certain situation Under, one or more of cells are fresh.One or more of cells can suffer from doctor from medical condition or suspection Learn the individual acquisition of the patient's condition (such as genetic disease).Under specific circumstances, the medical condition includes cancer.

In one embodiment, a kind of method determines the nucleic acid from individuality so as to identify the medical condition or mirror of individuality The fixed individual risk with the medical condition, including by the linear generation as obtained by disclosed method from individual sample The step of part or all of sequence of full amplicon is compared with standard items.In a particular embodiment, the nucleic acid includes Genomic DNA.In some cases, the nucleic acid includes the cDNA produced from the RNA from sample.Standard items can be comprising next From the nucleic acid of individual normal cell, such as the nucleic acid of other individual normal cells from one or more.In specific embodiment party In case, the expression of the cell amplifying nucleic acid in individual sample is represented with the number of the linear full amplicon for producing.One In the case of a little, comparison step is included the number of at least some linear full amplicon for producing of the cell in individual sample It is compared with standard items.In a particular embodiment, described at least some linear full amplicon for producing includes one or many Individual concrete gene.In certain embodiments, comparison step include determining the linear full amplicon for producing compared with standard items its In one or more specific nucleotide whether there is

The feature and technical advantage of the present invention have quite widely been outlined above, so as to more fully understand hereafter Detailed description of the present invention.Supplementary features of the invention of the theme to form the claims in the present invention and excellent are described below Gesture.It will be appreciated by those skilled in the art that disclosed concept and specific embodiment can be easily used as changing or designing For realizing the basis of the other structures of the identical purpose of the present invention.It should also be realized by those skilled in the art that such etc. The structure of valency is without departing from the spirit and scope of the present invention illustrated in such as claims.It is considered as the new of feature of present invention Clever feature when considered in conjunction with the accompanying drawings, will be better understood from the following description, including its organizing and operating method, with And further objects and advantages.It is to be expressly understood, however, that the purpose that each accompanying drawing is merely to illustrate that and describes, And be not intended as limiting the definition of the present invention.

Brief description

In order to the present invention is more fully understood, with reference to following description with reference to the accompanying drawings, wherein：

Fig. 1 examples show a kind of known referred to as based on many reannealings and the amplification of the amplification cycles (MALBAC) of cyclization Form.The unicellular whole genome amplification of low deviation (WGA).(left side) MALBAC workflows.Genomic DNA is unwind as single-stranded After DNA molecular, crack unicellular.MALBAC is carried out before additional PCR amplifications to expand in advance.First, MALBAC primers are moved back at random Fire is extended on single strand dna by the polymerase with substitute activity, produces half amplicon.It is raw in next circulation Into two ends all single-stranded amplicons with complementary series.3' ends are protected at moderate temperatures by forming ring, and this prevents Only chimeric formation and further amplification.The amplification that above-mentioned circulating repetition is covered for 5 times with generation with overlapping genes group Son, it is all used for subsequent PCR and expands at two ends containing general complementary series；

Fig. 2 provides the overview of an embodiment of amplification scheme of the present invention.In this scenario, do not use in MALBAC The full amplicon of middle generation is for PCR amplifications.Conversely, for example removing the primer sequence of the full amplicon of cyclization by digestion.It Afterwards, full amplicon linearly can again be produced for half amplicon linearly produced from original gene group template.This complete line Property amplification full amplicon be used for following PCR expand, for example；

Fig. 3 illustrates the overview that bar code is sequenced.The reading of sequencing is alignment.There are two kinds of possible heterozygous mutations, by Red and blue dot (in artwork master, they are respectively the points on the left side and the right in each hurdle) is represented.In left side, sequencing reading is not With bar code, therefore obtain two kinds of mutation.Compare, the sequencing on right side reads has bar code α, β, γ and ζ, and it is represented The independent DNA copy generated in linear amplification.Obviously, compared to the mutation marked by blue dot (by with two different bar shapeds The reading of code is represented), the mutation by red point mark is obvious false positive (being represented by the reading of an only bar code)；

Fig. 4 shows the linear example for producing half amplicon.

Fig. 5 shows the example for linearly producing full amplicon.

Fig. 6 provides the example of whole genome amplification in droplet or hole.

Fig. 7 is illustrated and primer sequence is removed in primer using concrete enzyme.

Fig. 8：Infantile tumour general situation of development.In precursor, it is contemplated that mutation Limited Number.In depauperation, can be with Expected, compared with neoplasia, the genome of the significant amount of mutation of Cellular Accumulation and high level is heterogeneous.

Fig. 9：Linear relationship between yield and amplification cycles number.The success of the as shown by data linear amplification.X-axis represents pre- Amplification cycles number.Y-axis represents the amplicon yield that qPCR is measured.Linear relationship confirms to have reached linear amplification.Experimental procedure is pressed Carry out according to the description in embodiment 1.

Figure 10：The figure shows the example that example shows the step after linear amplification.The linear amplicons of DNA half for producing are complete Amplicon is assigned in multiple pipes.Therefore independent linear copy is expanded in different pipes.Using the DNA amplification from each pipe Sequencing library is built, and is sequenced with sequenator of future generation.Under illustrate the snapshot results of sequencing data.Each can be seen Interchromosomal has similar average covering.The data include six libraries, its 16 pipe being divided into by the amplicon of linear amplification In 6 and build.

Figure 11：Sequencing result of future generation shows that linear amplification allows to detect system genitale/somatic mutation and identify expansion Increase mistake.It is mapped and shows the reading tested from sequencing, as depicted in figure 10.True mutation and the allusion quotation of false positive readings Type form is represented in mapping.Mutation in right figure is displayed in the cell being sequenced compared with data with existing storehouse and detects from the beginning The mutation of beginning.

Detailed description of the invention

I. define

As it is used herein, term " half amplicon " is referred to only in many of end generation by primer sequence extension Nucleotides.It is half product of full amplicon.

As it is used herein, term " amplicon " refers to the polynucleotides as template in PCR reactions.

As it is used herein, term " full amplicon " refers to the primer for having (different from each other or complementation) two ends Sequence, easily enters performing PCR amplification.

As it is used herein, term " linear amplification " is represented directly from the amplified production of primary template copy, so DNA The increase of product is linear.Conversely, for non-linear amplification, product copies the product two come from primary template and copy Person.Such as PCR reactions are exactly a kind of typical non-linear amplification, and wherein product is with exponential form increase.It is specific in particular aspects The copy of per part of (or most of) specific template that the linear amplification of template is defined as in substantial amounts of template copy is all by this Specific template is directly produced.In the non-linear amplification of specific template, the copy of template can be by another copy of specific template Produce.

II. general embodiment

The embodiment of the disclosure provides the amplification for expanding part or all of nucleic acid from one or more cells Method.In specific aspect, the nucleic acid is the part or all of mRNA of the part or all of genome of cell or cell, by inverse Transcription is represented from the cDNA of mRNA.These amplification methods generate the full amplification of linear half amplicon for producing and non-linear generation Son, the full amplicon of subsequent non-linear generation is nearly all converted into double-stranded DNA with biotinylated PCR primer, then by chain The reaction of mould Avidin magnetic bead is extracted, or is effectively removed (such as by making it not from sediment in the later step of method Can be by concrete one group of primer annealing), thereafter linear half amplicon for producing is through annealing and extends step, and without step of unwinding Suddenly, so as to producing the full amplicon of linear generation.Then optionally unwind the linear generation full amplicon and carry out other Method, such as linearly or nonlinearly expands (such as by PCR).

According to some aspects of the disclosure, the DNA in reactant mixture from unicellular or multiple cells is by least one Archaeal dna polymerase is expanded.

According on one side, by from the double-stranded DNA of sample before unicellular nucleic acid amplification or the amplification of multiple nucleus Denaturation is to permission primer annealing in the single-chain state of DNA.Subsequently, reaction temperature is reduced to allows the first end of primer 3 ' random Annealing oligonucleotide to DNA forms the double-helical temperature of hybridization.Hybridize Double-spiral into rear, in incubation period reaction mixture One or more archaeal dna polymerase existing or now adding extends complementary dna chain from 3 ' ends of the first primer.DNA gathers Synthase can be wrapped with or without 5 ' -3 ' exonuclease activity or strand-displacement activity.

Fig. 1 illustrates a kind of overview of the first technical method for being referred to as MALBAC, and the present invention is the improvement to it.Cracking is slender Born of the same parents, then unwind into single strand dna by genomic DNA.MALBAC is carried out before additional PCR amplifications to expand in advance.First, MALBAC primers are annealed at random on single strand dna and are extended by the polymerase with substitute activity, form half and expand Son.In next circulation, generating two ends has the single-stranded amplicon of complementary series.3' ends are at moderate temperatures by forming ring And protected, this prevents chimeric formation and further amplification.By above-mentioned circulating repetition about (such as) 5 times producing tool There is the amplicon that overlapping genes group is covered, it is all used for subsequent PCR and expands at two ends containing general complementary series.

In advance amplification is not fairly linear to the MALBAC of this area.In MALBAC is expanded in advance, half amplicon direct copying From original DNA template, therefore it is linear generation.However, half amplicon is used as template in ensuing amplification cycles. For example, half amplicon for producing in first circulation is used in ensuing five circulations；Produce in second circulation Half amplicon be used for it is ensuing four circulation in, etc..Amplification flagship, if polymerase first circulation in Mistake is produced in half amplicon, mistake is just copied five times in ensuing amplification cycles.Because this amplification mistake is occupied most In end readout 30%, therefore it may be considered as mutation.Accordingly, it would be desirable to for example, at least three relationship cells are sequenced obtains essence True single nucleotide acid variant (SNV) result.

In order to overcome the variability of this technical generation, the embodiment of the disclosure provide realize it is real linear pre- The new process of amplification.Because half amplicon is linear generation, linearly without distortions copy is to make these half amplicons Full amplicon is useful.It will provide fairly linear amplification scheme after realizing.In order to realize the purpose, the enforcement of the disclosure Scheme includes the content shown in Fig. 2；After pre- amplification, (such as) downstream PCR is not taken to expand, it is possible to use suitably to limit digestion The primer sequence region being cut in the full amplicon of ring.Full amplicon can also be converted into biotinylated PCR primer double Chain DNA, is then extracted by Streptavidin MagneSphere from reaction.Meanwhile, half single-stranded amplicon keeps complete.Subsequent In step, restriction enzyme can be inactivated, and immediately new full amplicon is regenerated by half amplicon and (be schemed with ensureing linearly to represent 2).Can be annealed by a wheel or more wheel and extend step and produce full amplicon again.Or, half amplicon can have tail, and And tail region can be with new primer hybridization producing full amplicon.

Therefore, embodiment of the present invention includes the method from one or more cellular linear amplification of nucleic acid.Methods described In some respects by the nucleic acid samples for providing, although in some cases the nucleic acid must (such as by conventional method) Available from the cell.In DNA amplification, will process via RNase from whole nucleic acid of cell extraction.When amplification (with from The cDNA forms of mRNA) transcript profile when, by whole nucleic acid before the reverse transcription of mRNA via DNA enzymatic process.From The nucleic acid of one or more cells is contacted with first a large amount of primers and the cell also connects with the polymerase comprising strand-displacement activity Touch；The step for for example occur under conditions of 0 DEG C to about 30 DEG C of temperature range.In this step, primer and Nucleic acids anneal, And primer is extended by polymerase.In specific embodiments, first a large amount of primers are rich in the G of 40%-60% or are rich in The C of 40%-60% and also comprising restriction endonuclease site.When primer contacts nucleic acid, generate and include primer annealing Nucleic acid-templated mixture.Then the nucleic acid-templated of primer annealing is made to carry out two-wheeled or the extension taken turns more, unwind and step of annealing And these steps produce the mixture of half amplicon of nucleic acid-templated, linear generations and the full amplicon of non-linear generation suddenly,.Will The mixture be exposed to enable full amplicon two ends anneal with one another under conditions of, so as to produce cyclization full expansion Increase son.The full amplicon of the cyclization is subsequently contacted the restriction enzyme of the annealing end of the full amplicon that can digest cyclization Nuclease.This is done so that full amplicon is no longer able to by least some of primer annealing, including first a large amount of primers or second batch A large amount of primers, wherein G or C of the second a large amount of primers rich in 40%-60%.Stay half amplicon of linear generation in the mixture By first a large amount of primers or a large amount of primer annealings of second batch and can extend.It is described to anneal and extend in nucleic acid and further unwind In the case of occur, thus produce the linear full amplicon for producing.In some cases, the full amplicon quilt of the linear generation Further amplification for example passes through linear or nonlinear method, including such as standard pcr.

In embodiments of the invention, it is possible to achieve for first of unicellular full-length genome (or transcript profile) amplification Exact linear amplification method.The sensitivity that unicellular SNV (such as) detections are reached by the innovation and accuracy, this public affairs The method and composition opened can produce wide influence in biology and/or clinical research and purposes.

In the embodiment of the disclosure, there is provided pre-existing primer can be effectively removed to allow half amplicon Effective tailing method.If primer is not effectively digested, the tailing of residual primers is mutually competing with the tailing of half amplicon Striving causes the amplification in later step to fail.Therefore, in specific embodiments, there is provided pre-existing primer it is effective Digestion, it is achieved that the successful generation and amplification of full amplicon.

T4 polymerases can be used or less than other in a low temperature of (30 DEG C lower) with exonuclease activity Polymerase and ExoI exonucleases only digest other exonucleases of single stranded DNA.Enzyme can be heated inactivation.Tailing grinds Studying carefully can be carried out with the C bases of high concentration.In specific embodiments, the region of dC tailings can with GAT5N3G primer hybridizations and Only produce full amplicon.

III. bar code

Although the scheme of Fig. 2 illustrate it is linear, in some embodiments, it is also possible to have wherein and the amplicon of not all half All effectively copy helps the situation of amplicon, such as in last several circulations.As the result of this aspect, at least in some feelings Under condition, there may be the full amplicon of a limited number of independence.If the number is still difficult to differentiate between less than (such as) four copies True mutation and amplification mistake.In specific aspect, need the sufficient amount separate copies with primary template to dilute final reading Amplification mistake in number presentation.In order to solve this problem, (can have variable to introduce random " bar code " in primer The random dna sequence (such as NNNNN, wherein N represent the mixture of four nucleotides) of length), it will index each linear expansion Half amplicon of increasing is simultaneously registered in each full amplicon on corresponding half amplicon (Fig. 3).By being read each with bar code Number is indexed, it can be estimated that whether reading is linear distribution.In the case of having residual nonlinear, it is possible to use bar code Identification amplification is wrong and improves the degree of accuracy of SNV results, as shown in Figure 3.

IV. the exemplary application of method of disclosure

Method of disclosure can be used in research, clinical and/or other application.In particular embodiments, the disclosure Method be used for such as diagnosis to one or more individual therapy and/or prognosis and/or monitoring, macroscopical base of microorganism Because group analysis and forensic dna are tested.

In an example of the application of one or more methods of the disclosure, methods described be used to determine from individuality Nucleic acid content or expression in one or more change；The change can be relative to known standard items, for example, Such as the corresponding wild-type sequence of concrete nucleic acid.The nucleotides that the change of content can compare wild type comprising one or more is poor It is different, such as displacement, deletion, inversion, etc..The change of expression can include standard that is specifically specific known compared to certain or determining Normal expression level rise or downward.The standard items can be included in known type and/or phenotype normal cell just Normal nucleic acid content or expression.

On other occasions, available from from individual sample, the individuality suffers from medical condition or suspection to the nucleic acid to be determined Suffer from medical condition or have the risk for suffering from medical condition or receiving to be directed to the treatment of medical condition.The sample can be any Species, as long as directly or indirectly nucleic acid can be obtained from one or more cells of sample.In specific embodiment party In case, nucleic acid is available from one or more cells in individual sample.The sample can be blood, tissue, hair, work Inspection sample, urine, nipple aspirate, amniotic fluid, cheek scrape bits, fecal matter or embryo.

Appropriate sample is obtained from the individuality, and the side of the disclosure can be directly or indirectly carried out by the individuality of acquisition sample Method, or methods described can be carried out by the opposing party or in many ways.

A. Genetic Detection

In a particular application, it may be desirable to know the sequence of one or more the concrete nucleic acid in individual sample. The individuality can be any age.The individuality can carry out conventional detection, or former in a certain specifically desired or medical science Thus tested.The individual possible suspection suffers from certain concrete medical condition, such as due to having one or more with the doctor Learn the related symptom of the patient's condition and/or with the individual or family history related to the medical condition.The individuality may have suffers from certain The risk of medical condition, such as known to the family's medical history with the medical condition or one or more with the medical condition Risk factors, such as high cholesterol in heart disease, smoking in the plurality of medical patient's condition, hypertension in heart disease or in Wind, with genetic marker related to the medical condition, etc..

On other occasions, the individuality is fetus, and the fetus can have a certain concrete core with or without suspecting Acid sequence or expression of nucleic acid are compared wild type and are changed, and this sequence content or expression change are related to medical condition.At some In the case of, although the fetus may need to be tested for conventional purpose, the fetus is due to such as family history or environment Risk (radiating) or Old-aged pregnancy, and there is the risk of a certain concrete medical condition.Wherein expect from fetus to learn at those In the case of the interior perhaps expression of particular sequence, sample of the collection comprising one or more fetal cells.The sample can be with From the biopsy specimen of fetus, although in particular situations, sample is the embryo of amniotic fluid or maternal blood or mesoderm growing early stage.

In the one side of the disclosure, obtain amniotic fluid from pregnant mothers and therefrom separate one or more fetal cells.It is described Fetal cell is separated and can carried out by this area conventional method, such as distinguishes fetus by using the mark on fetal cell surface thin Born of the same parents and mother cell.Three kinds of different types of fetal cells may be present in maternal circulation：Trophocyte, leucocyte and fetus Red blood cell (erythroblast).The cell of most probable enrichment is FE, and in certain embodiments it can pass through size Chromatographic column identification, subsequently carries out CD71- antibody stainings or ε globulin chain immunophenotypings, is then based on fluorescence intensity and is scanned Or sort and identify.

Once isolating fetal cell, i.e., nucleic acid is therefrom extracted, such as by this area conventional method.To thin from fetus Karyon acid produces the amplicon of linear generating, its at least part of, most or all of institute of covering using disclosed method State the genome of fetal cell.After linear amplification, one or more sequences of amplicon can be further expanded, also it can be surveyed Sequence, at least partly sequencing, or microarray technology can be implemented.In certain embodiments, SNV or CNV is for example determined, and is surveyed Determine result and be used for determining whether corresponding fetus suffers from concrete medical condition or whether suspect the concrete medical condition of trouble.In specific feelings Under condition, for example, the treatment of the medical condition can be carried out to fetus or can be used for preventing or postponing the medical condition morbidity Method, and this can in uterus and/or childbirth after carry out.

Although fetal samples can be determined SNV or CNV presence situation (any of which can be disease it is related or cause disease Disease), in a particular embodiment fetal samples are determined with the genetic mutation related to any concrete medical condition.It is measurable The gene example related to antenatal medical condition include it is following in one or more：ACAD8、ACADSB、ACSF3、 C7orf10、IFITM5、MTR、CYP11B1、CYP17A1、GNMT、HPD、TAT、AHCY、AGA、PLOD2、ATP5A1、 C12orf65、MARS2、MRPL40、MTFMT、SERPINF1、FARS2、ALPL、TYROBP、GFM1、ACAT1、TFB1M、MRRF、 MRPS2、MRPS22、MRPL44、MRPS18A、NARS2、HARS2、SARS2、AARS2、KARS、PLOD3、FBN1、FKBP10、 RPGRIP1、RPGR、DFNB31、GPR98、PCDH15、USH1C、CERKL、CDHR1、LCA5、PROM1、TTC8、MFRP、 ABHD12CEP290、C8orf37、LEMD3、AIPL1、GUCY2D、CTSK、RP2、IMPG2、PDE6B、RBP3、PRCD、RLBP1、 RGR、SAG、FLVCR1、ZNF513、MAK、NDUFB6、TMLHE、ALDOA、PGM1、ENO3、LARS2、ATP7A、ATP7B、 TNFRSF11B、LMBRD1、MTRR、FAM123B、FAM20C、ANKH、TGFB1、SOST、TNFRSF11A、CA2、OSTM1、 CLCN7、PPIB、TCIRG1、SLC39A13.COL1A2、TNFSF11、SLC34A1、NDUFAF5、FOXRED1、NDUFA2、 NDUFA8、NDUFA10、NDUFA11、NDUFA13、NDUFAF3、SP7、NDUFS1、NDUFV3、NUBPL、TTC19、UQCRB、 UQCRQ、COX4I1、COX4I2、COX7A1、TACO1、COL3A1、SLC9A3R1、CA4、FSCN2、BCKDHA、GUCA1B、 KLHL7、IMPDH1、PRPF6、PRPF31、PRPF8、PRPF3、ROM1、SNRNP200、RP9、APRT、RD3、LRAT、TULP1、 CRB1、SPATA7、USH1G、ACACB、BCKDHB、ACACA、TOPORS、PRKCG、NRL、NR2E3、RP1、RHO、BEST1、 SEMA4A、RPE65、PRPH2、CNGB1、CNGA1、CRX、RDH12、C2orf71、DHDDS、EYS、IDH3B、MERTK、PDE6A、 FAM161A、PDE6G、TYMP(ECGF1)、POLG(POLG1、POLGA)、TK2、DGUOK(dGK)、SURF1、SCO2(SCO1L)、 SCO1、COX10、BCS1L、ACADM、HADHA、ALDOB、G6PC(GSD1a)、PAH(PH)、OTC、GAMT、SLC6A8、 SLC25A13、CPT2、PDHA1、SLC25A4(ANT1)、C10orf2(TWINKLE)、SDHA、SLC25A15、LRPPRC、GALT、 PMM2、ATPAF2(ATP12)、GALE、LPIN1、ATP5E、B4GALT7、ATP8B1(ATPIC、PFIC)、ABCB11(ABC16、 PFIC-2、PGY4)、ABCB4(GBD1、MDR2、PFIC-3)、MPV17(SYM1)、TIMM8A(DDP、MTS)、CPS1、NAGS、 ACADVL、SLC22A5(OCTN2)、CPT1A(CPT1-L、L-CPT1)、CPT1B、SUCLA2、POLG2(HP55、MTPOLB)、 ACADL、SUCLG1、MCEE、GAA、PDSS1(COQ1、TPT)、PDSS2(bA59I9.3)、COQ2(CL640、FLJ26072)、 RRM2B(p53R2)、ARG1、SLC25A20(CACT)、MMACHC(cblC)、FAH、MPI、GATM、OPA1、TFAM、TOMM20 (MAS20P、TOM20)、NDUFAF4(HRPAP20、C6orf66)、NDUFA1(CI-MWFE、MWFE)、SLC25A3(PHC)、 BTD、OPA3(FLJ22187、MGA3)、GYS2、NDUFAF2(B17.2L、MMTN)、HLCS(HCS)、COX15、FASTKD2、 NDUFS4、NDUFS6、NDUFS3、MMAA(cblA)、MUT、NDUFV1、MOCS1、NDUFS7(PSST)、TAZ(BTHS、G4.5、 XAP-2)、MOCS2、COX6B1(COXG)、HADHB、MCCC1(MCCA)、MCCC2(MCCB)、TSFM(EF-TS、EF-Tsmt)、 PUS1、ISCU、AGL、SDHAF1、IVD、GCDH、ADSL、DARS2、RARS2、TMEM70、ETHE1、PC、JAG1、MRPS16、 PCCA、PCCB、COQ9、LDHA、PYGL、GALK1、PYGM、PGAM2、TUFM、TRMU、PFKM、GBE1、SLC37A4、GYS1、 ETFDH、NDUFS8、CABC1(ADCK3)、ETFA、ETFB、DBT、SLC25A19、MMADHC、PDP1、PDHB、ACAD9、AUH、 DLAT、PDHX、ACADS、NDUFS2、FBP1、NDUFAF1(CIA30、CGI65)、YARS2、SUCLG2、TCN2、CBS、PHKB、 PHKG2、PHKA1、PHKA2、LIPA、ASL、HPRT1、OCRL、PNP、TSHR、ADA、ARSB、ALDH5A1、PNP、AMT、 DECR1、HSD17B10、IYD、IL2RG、MGME1、HMGCL、IQCB1、OTX2、KCNJ13、CABP4、NMNAT1、ALG2、 DOLK、ABCD4、ALDH4A1、ALG1、GPR143、UBE3A、ARX、GJB2(CX26、NSRD1)、APC、HTT、IKBKG (NEMO)、DMPK、PTPN11、MECP2、MECP2、RECQL4、ATXN1、ATXN10、RMRP、CDKL5、PLP1、GLA、DMD、 RUNX2、PLP1、CHD7、ASS1、AIRE、EIF2B、LDLR、HPRT1、RPS19、LMX1B、COL10A1、CRTAP、LEPRE1、 PORCN、ASL、CFTR、ARSA、IDUA、IDS、MYO7A、GLANS、GALC、KRAS、SOS1、RAF1、AR、PTEN、BLM、 SLC9A6、HRAS、GJC2(GJA12)、NPC1、NPC2、FMR1、FMR1、PLOD1、COL2A1、COL5A1、COL5A2、ABCA4、 FOXG1、TINF2、USH2A、CDH23、CLRN1、CREBBP、ABCA4、POU3F4、NRAS、CHRNA7、FOXF1、MEF2C、 DHCR7、RAI1、VHL、TYR(OCAIA)、OCA2(BEY、BEY1、BEY2、EYCL)、TYRP1(b-PROTEIN、CATB、GP75、 SLC45A2(AIM-1)、PCDH19、SHOC2、BRAF、MAP2K1、MAP2K2、HEXA、STXBP1、ALDH7A1、SLC2A1、 WDR62, MAGEL2, SDHB and FH.

B. cancer test

In some embodiments of the disclosure, to just being supervised from cancer stricken or suspection cancer stricken or treatment of cancer result The individual sample of survey implements the method for the present invention.In addition to disclosed method, can be with sample or similar sample Run other diagnosis or prognosis test.The sample can be obtained by conventional method, and can include biopsy specimen, its bag Containing seemingly, suspect and be or be known to be the cell or tissue of canceration.Exemplary sample for cancer detection includes blood, urine Liquid, biopsy specimen, fecal matter, nipple aspirate, cheek scrape bits etc..In some cases, from the individuality with cancer stricken risk Obtain sample；The individuality can have family and/or individual history, and may contact known or suspection can cause the environment bar of cancer Part, can be with known with genetic marker related at least one cancer types, etc..The biopsy specimen of particular type includes Skin, lung, breast, colon, cervix, liver, kidney, sample of prostate, etc..

In a particular embodiment, to implementing disclosed method to determine in wherein sequence from individual testing sample Hold the change compared to known sample, or determine change (such as or many of a certain sequence expression levels compared to normal level The rise or downward of individual gene).In some cases, representated by the quantity of the amplicon for being produced by disclosed method Or there is cancer or suffer from cancer risk situation or the success or not to treatment of cancer in the expression instruction of multiple specific genes.

The measurable example with concrete cancer related gene includes APC, MLH1, MSH2, MSH6, PMS2, MUTYH (MYH)、RECQL4、TP53(LFS1、P53)、PTEN、RUNX1、TPMT、VHL、EPCAM(TACSTD1)、ERBB2(HER2/ neu)、ALK、RET、EGFR、MET、IGH、ROS1、BRAF、NPM1、JAK2、MPL、AKT1(AKT)、PIK3CA、FLT3、IgVH、 CEBPA、MAX、KIT、KRAS、NF1、SDHAF2、SDHB、SDHC、SDHD、TMEM127、BMPR1A、SMAD4、STK11、 BRCA1、BRCA2、CDH1、PALB2、CDKN1C、FH、FLCN、GPC3、PALB2、WTL、CDC73、MEN1、PRKAR1A、ATM、 NBN, NF2, PHOX2B, PTCH1, SUFU and/or UGT1A1.

V. sample treatment and the nucleic acid from cell of the present invention

One or more sample can be obtained from the individuality tested with method of disclosure by any appropriate means Product.In some embodiments, sample can be processed before nucleic acid is extracted.When nucleic acid is extracted, sample can be fresh , or sample may pass through the process of fixed or other treatment technologies when nucleic acid is extracted.

Sample can be any kind of.The enforcement that wherein one or more aim cells mix with other cells In scheme, the specific characteristic of desired one or more cells, the such as protein of cell surface expression, separation one can be based on Or multiple aim cells.Wherein based on cell sign thing in the embodiment of isolation of fetal cells, cell sign thing can be with For CD71 or ε globulin chains, etc., in separating the embodiment of cancer cell based on cancer markers wherein, cell sign Thing can be (Bigbee W, the Herberman such as ER/PR, Her-2/neu, EGFR, KRAS, BRAF, PDFGR, UGT1A1 RB.Tumor markers and immunodiagnosis.In:Bast RC Jr., Kufe DW, Pollock RE, et al., editors.Cancer Medicine.6th ed.Hamilton,Ontario,Canada:BC Decker Inc.,2003.)。

Cell there can be surfactant (i.e. Trion-X100, tweet-20, NP-40 etc.) and protease (i.e. albumen Kinases K) lysis buffer in incubation and crack separated cell.Can also be by alkaline solution (i.e. detergent dodecyl Sodium sulphate (C12H25SO4Na) and highly basic such as NaOH) cell lysis, this will cause the denaturation of double-stranded DNA.Alkaline solution leads to Peracetic acid potassium or sodium acetate are neutralized.

VI. kit of the invention

Arbitrary composition described herein or the like may be embodied in kit.In a non-limiting examples, The reactant of the method for being used for amplification of nucleic acid one or more may be included in kit.These reactants may include enzyme, buffering Liquid, nucleotides, salt, primer etc..Reagent constituents are provided in suitable vessel form.

Some components of these kits can be packed in water-borne thing or with lyophilized form.The container of kit Form generally includes at least one bottle, test tube, flask, bottle, syringe or other vessel forms, wherein component is equipped with, and it is excellent Choosing is suitably dispensed.When having more than a kind of component in kit, the kit usually contain second, third or other it is additional Container, wherein annexing ingredient separately can be placed in these containers.However, the multiple combination of component may be included in bottle.This Bright kit is also typically comprised for these components to be included in closed container the mode for being used for commercial distribution.The appearance Device may include the plastic containers of injection or blow molding, wherein retain having desired bottle.

When the component of the kit is provided with a kind of and/or plurality of liquid solution, the liquid solution is water-soluble Liquid, wherein sterile water solution are particularly useful.In some cases, the vessel form itself can be syringe, suction nozzle and/or Other similar devices, or can be that there is the substrate for carrying out multiple compartments of desired reaction.

Some components of the kit can be provided with dry powder.When reactant and/or component are provided with dry powder, can be with By adding suitable solvent to reconstruct the powder.Predictably, the solvent also can be carried in other vessel forms For.These kits can also include second vessel form, for the acceptable buffer solution comprising sterilizing and/or other dilutions Agent.

In specific embodiments, reactant and material are included for expanding the primer of expectation sequence, nucleotides, suitable Buffer solution or buffering reactant, salt etc., and in some cases, the reactant is included for separating specific expectation cell Device or reactant.

In a particular embodiment, there is one or more device to be applied to from individual in kit and extract one or more sample Product.The device can be syringe, fine needle, scalpel etc..

Embodiment

Including following examples illustrating the preferred embodiments of the invention.It will be clear for those skilled in the art that Those according to the inventors have found that representative art embodiment disclosed in those technologies in the practice of the invention can Work well, and therefore can be considered as constituting preferred practice form.However, those skilled in the art are according to the disclosure It should be understood that various changes can be carried out in the specific embodiments which are disclosed and still obtain similar or similar result and Without departing from the spirit and scope of the present invention.

Embodiment 1

Separate from tissue sample complete unicellular

Histological tissue section is prepared using commercialization freezing-microtome.The paraformaldehyde for preparing 100-200 μ m-thicks is fixed Solid tissue section.The cell of purpose is cut out from histotomy with laser microdissection microscope (Leica, MMI etc.).Make With standard cell lines dissociation operating process by individual cells from it is micro- cut dissociate in histotomy come.Unicellular collect complete In respective pipe.In lysis buffer (the 30mM Tris-Cl PH 7.8,2mM EDTA, 20mM KCl, 0.2% of 3 to 5 μ l Triton X-100,12 μ g/ml Qiagen protease) in the cracking individual cells and be added on the side of PCR pipe, from The heart gets off.Then the cell that thermal cracking is captured, uses following temperature program(me) in PCR instrument：50 DEG C 2 hours, 75 DEG C 20 minutes, 80 DEG C 5 minutes.

The linear Multiple Cycle (Fig. 4) for producing half amplicon

In first round amplification, an alignment degenerate primer is used for the amplicon overlapped in the starting of whole gene group DNA.It is described Primer is designated as NG, NT primer, as follows：

NG primer 5'-GTGAGTGATGGTTGAGGATGAGTGGTNNNNNGGG-3'(SEQ ID NO：1)

NT primer 5'-GTGAGTGATGGTTGAGGATGAGTGGTNNNNNTTT-3'(SEQ ID NO：2)

Following buffer solution is added in PCR pipe and for expanding for the first time：6.0 μ l ThermoPol buffer solutions (NEB), The dNTP (10mM) of 1.0 μ l, the H of 26 μ l₂NG the and NT primers (100 μ Μ) of O (Jing UV process) and 0.3 μ l.

PCR buffer solutions are added to after the single celled PCR pipe containing cracking, sample are heated 1-2 minutes at 94 DEG C, So that DNA denaturation is into single stranded DNA.Sample is added immediately it is quenched in ice and to about 0 DEG C of temperature, is drawn during this period Thing is annealed.Then the mixture of the polymerase Bst large fragments of 0.6 μ l is added in PCR pipe.Following temperature is run in PCR instrument Degree circulation.In second and subsequent circulation, PCR pipe is then transferred on ice reaction, and the new primer of starting is quenched Cause.By fresh polymerase mixture be added in PCR pipe and in the PCR instrument operation is following circulates to produce amplicon.

Step 1：10 DEG C -45 seconds

Step 2：20 DEG C -45 seconds

Step 3：30 DEG C -45 seconds

Step 4：40 DEG C -30 seconds

Step 5：55 DEG C -30 seconds

Repeat step 1-5,4 times

Step 6：65 DEG C -60 seconds

Step 7：95 DEG C -20 seconds

Step 8：Polymerase is quenched and added again on ice

Repeat step 1-8, n times

4℃–∞

Number of repetition N can be adjusted according to condition.In certain embodiments, N is 3.

The double-strand conversion of full amplicon

It is the mixture of full amplicon and half amplicon from the product of said procedure.The 100 μ Μ PCR of 0.3 μ l are drawn Thing is added in reaction and carries out following Thermal Cycling (for example：58 DEG C 20 seconds -70 DEG C -10 seconds, repeat 30 times), will expand entirely Son changes into the DNA of double-strand, and single-stranded half amplicon keeps constant.After the conversion of above-mentioned double-strand.

PCR primer：GTGAGTGATGGTTGAGGATGAGTGGT(SEQ ID NO：4)

The restrictive diges-tion of full amplicon

Include half amplicon of linear amplification and the full amplicon of non-linear amplification from the product of above-mentioned thermal cycle.By temperature Degree is heated to 94 DEG C, continues 30 seconds with the double stranded DNA product that unwinds, and is then maintained at 50 DEG C.At 50 DEG C, full amplicon will be due to 5 ' End sequence and 3 ' end sequences are complementarily shaped to cyclization, and half amplicon is with single stranded DNA presence.Primer sequence is integrated with GGATG sequence motifs, can be recognized and cutting DNA by restriction endonuclease BtsCI.As a result, full amplicon half with On primer sequence be deleted, therefore, Jing digestion DNA product downstream PCR reaction in be no longer amplified.By temperature after digestion 72 DEG C to 80 DEG C of scope is increased to inactivate restriction enzyme.

Linearly produce full amplicon (Fig. 5)

After above-mentioned digestion, sample is heated 20 seconds so that DNA denaturation is single stranded DNA at 94 DEG C.Sample is added immediately About 0 DEG C of temperature is quenched and reached in ice, and primer annealing occurs during this.Hereafter rejoin polymerase and carry out following heat Circulation, from half amplicon of amplification full amplicon is linearly reproduced.Also half amplicon can be assigned in multiple pipes and be continued into The following multiple annealing steps of row, to form amplicon.The linear yield of amplicon is shown in Fig. 9.

Step 1：10 DEG C -45 seconds

Step 2：20 DEG C -45 seconds

Step 3：30 DEG C -45 seconds

Step 4：40 DEG C -30 seconds

Step 5：55 DEG C -30 seconds

Repeat step 1-5,4 times

Step 6：65 DEG C -60 seconds

Alternatively, also half amplicon can be assigned in multiple pipes, and proceed following examples including digestion, tailing With extend step, to form amplicon：

Pre- amplified production is digested with the combination of T4 polymerases and ExoI nucleases, it is as follows：0.4 μ l ExoI are added, at 25 DEG C Digestion 30 minutes, then adds 0.4 μ l T4 polymerases, digests 150 minutes at 25 DEG C.20 minutes are carried out to enzyme at 80 DEG C Heat inactivation, subsequently enter tailing program.

10X TdT reaction buffers by 0.35 μ l TdT buffer solutions, the dCTP of 0.4 μ l 100mM, 0.1 μ l TdT ends Transferase and 2.75 μ l H2O are constituted.TdT mixtures are added into sample, is mixed and is carried out tailings reactions using temperature below：37 DEG C 15 minutes, 72 DEG C 15 minutes.

After tailing, the following extension buffer solutions of addition (dNTP (each 10 μM) of 1.5 μ l 10X Thermopol, 1.25 μ l, 10 μM of GAT21 5n3G of 1.25ul and 12 μ l H2O).After being sufficiently mixed reaction, sample is placed in 95 DEG C of heating in module 1min, cools the temperature to 50 DEG C, keeps at least 20s；Add the deepvent archaeal dna polymerases or other polymerases of 0.4 μ l, mix It is even and carry out following circulation：

Step 1：50 DEG C 45 seconds

Step 2：72 DEG C 45 seconds

Repeat step 1 to 2,10 times

Embodiment 2

The single tube or multitube amplification of amplicon is carried out using standard method

Following reaction buffer is prepared, and addition is maintained in PCR pipe on ice.

3.0 μ l ThermoPol buffer solutions (NEB)

1.0μl dNTP(10mM)

26μl H₂O (Jing UV process)

0.1 μ l primers (100 μM) (5 '-GTGAGTGATGGTTGAGGATGAGTG-3 '；SEQ ID NO:5)

Amplification buffer can be assigned in multiple pipes.Linear amplification product will be assigned to (Figure 10) in each pipe.With such as subscript Quasi- PCR programs carry out amplification, to generate the DNA materials of 1-2 μ g.

94 DEG C -20 seconds

58 DEG C -20 seconds

65 DEG C -1 minute

72 DEG C -1 minute

The above-mentioned circulation of repetition 20 times

72 DEG C -5 minutes

4℃–∞

After the second wheel amplification, can purify DNA with Qiagen posts, and storage is expanded for next program with removing DNA Increase the prime end of son.

Amplicon product can be used for full-length genome or orientation (for example, any list of extron group and gene panel) is surveyed Sequence/sequence of resurveying and methods of genotyping, including Sanger sequencings, next generation's sequencing and microarray etc..The result of next generation's sequencing It is shown in Figure 10 and Figure 11.

Embodiment 3

The single fragment amplification of full-length genome in droplet/micropore

The amplicon of gained linear amplification covers the full-length genome of unicellular DNA from embodiment 1, and can be used as following The parent material (see Fig. 6) of program.

Other amplification methods well known by persons skilled in the art can be used as described below.

Product is divided into into ten million picoliters level droplet/micropore or a grade droplet/micropore of ascending to heaven.Can use it is commercially available based on The drop emulsifying agent of microfluid has picoliters or the microfluidic device in hole of ascending to heaven.By reaching in each reaction droplet/micropore Amplification saturation (or limiting amplification by available primer or dNTP) is by single DNA fragment amplification to similar level.

The method that other form extensive individual reaction well known by persons skilled in the art can be used as described below.

PCR can be carried out in each in 1,000 ten thousand droplet/micropores to react to expand single amplicon.

94 DEG C -20 seconds

58 DEG C -20 seconds

65 DEG C -1 minute

72 DEG C -1 minute

The above-mentioned circulation of repetition 20 times

72 DEG C -5 minutes

4℃–∞

DNA product is collected from each droplet/micropore and is purified using business purification column or ethanol precipitation.

Embodiment 4

Remove primer sequence in amplicon

With following uracil primer pair from the DNA for expanding completely that embodiment II is collected 6 circulations can be again expanded (see example Such as Fig. 7)：

5'-GTGAGTGATGGTTGAGGATGAGTGGU-3'(SEQ ID NO：3)

After amplification, using DNA purification columns DNA product is purified.Uracil-DNA glycosylase (UDG) and DNA glycosylases The mixture of lyases endonuclease VIII is used to remove the U bases in primer sequence.UDG is catalyzed cutting for uracil group Remove, and endonuclease VIII removes non-pyrimidine bases.

Purify the DNA jaggy with DNA purification columns.With Zn++ ions as catalytic ionic S1 nucleases in otch Cut single stranded DNA in site.Thus, the original primers sequence in two ends of DNA is all removed.

T4 polymerases can also be used for removing primer sequence.Enzyme can find breach and be disappeared in breach site from 3 ' to 5 ' Change.After removing top chain, enzyme will remove 3 ' and project, i.e. bottom chain.

Purify DNA product with DNA purification columns.The DNA will be used directly for library construction and carry out sequencing experiment of future generation.

Embodiment 5

The PCR amplifications of unicellular DNA fragmentation are separately carried out in a large amount of droplet/micropores

The PCR amplicons of full-length genome of unicellular DNA can be covered as parent material.

Other amplification methods well known by persons skilled in the art can be used as described below.

Product is divided into into ten million picoliters level droplet/micropore or a grade droplet/micropore of ascending to heaven.Can use it is commercially available based on The drop emulsifying agent of microfluid has the microfluidic device in picoliters or the hole ascended to heaven.By reaching in each reaction droplet/micropore To amplification saturation (or limiting amplification by available primer or dNTP) by single DNA fragment amplification to similar level.

PCR can be carried out in each in 1,000 ten thousand droplet/micropores to react to expand single amplicon.

94 DEG C -20 seconds

58 DEG C -20 seconds

65 DEG C -1 minute

72 DEG C -1 minute

The above-mentioned circulation of repetition 20 times

72 DEG C -5 minutes

4℃–∞

DNA product is collected from each droplet/micropore and is purified using business purification column or ethanol precipitation.

Embodiment 6

The SDA of unicellular DNA fragmentation is separately carried out in a large amount of droplet/micropores

Strand displacement amplification (SDA) is used to form individual chip.However, compared with normal SD A is reacted, proliferation time is minimized For 10 to 30 minutes.This will be avoided the amplification deviation that the formation of super-branched (hyperbranch) and hyperbranched single stranded DNA cause.

Add new substituted enzyme (Phi29), and by reaction be divided into 1,000 ten thousand picoliters level droplet/micropores or a grade droplet of ascending to heaven/ Micropore.Can be using the commercially available drop emulsifying agent based on microfluid or the microfluidic device in hole for having picoliters or ascending to heaven.

Strand displacement amplification (SDA) can be proceeded under 30 degree to expand single DNA fragment in each droplet/micropore. Without DNA fragmentation in most of individual droplet/micropores, or DNA fragmentation limited amount.Extend the implementation time (12 hours) of SDA To reach saturation.

By expanding individual chip in separate hole, the reaction avoids the interference and competition of fragment.By at each The saturation (or limiting amplification by available primer or dNTP) that amplification is reached in reaction droplet/micropore expands single DNA fragment Increase to similar level.

DNA product is collected from each droplet/micropore and is purified using business purification column or ethanol precipitation.

Other amplification methods well known by persons skilled in the art can be used as described below.Can be with use this area as described herein skill The known method that other form extensive single reaction of art personnel.

Embodiment 7

The PCR amplifications of unicellular RNA fragments are separately carried out in a large amount of droplet/micropores

The cDNA that can be produced with the reverse transcription by unicellular RNA transcript is used as parent material.

Other amplification methods well known by persons skilled in the art can be used as described below.

Product is divided into into ten million picoliters level droplet/micropore or a grade droplet/micropore of ascending to heaven.Can use it is commercially available based on The drop emulsifying agent of microfluid has the microfluidic device in picoliters or the hole ascended to heaven.By reaching in each reaction droplet/micropore Amplification saturation (or limiting amplification by available primer or dNTP) is by single DNA fragment amplification to similar level.

Can be in each central PCR reaction for carrying out single amplicon of 1,000 ten thousand droplet/micropores.

94 DEG C -20 seconds

58 DEG C -20 seconds

65 DEG C -1 minute

72 DEG C -1 minute

The above-mentioned circulation of repetition 20 times

72 DEG C -5 minutes

4℃–∞

DNA product is collected from each droplet/micropore and is purified using business purification column or ethanol precipitation.

Embodiment 8

For the method for human cancer sample

Can be used to characterize the evolution process of tumorigenic complexity using the method and composition of the present embodiment.With entity The effort of the large scale sequencing of cancer is compared, and can push the forward position of sequencing research to what is can be restored in such as clinical setting Tumour earliest period.This only becomes reasonable when there is unicellular whole genome amplification to determine, and the measure allows to obtain above-described Accurately SNV results and carry out effective unicellular separation determination method using clinical sample.

Separate from clinical tissue specimen samples unicellular

In order to single cell analysis novel described in clinical sample application, it is possible to use effective ways enter to the cell of purpose Row is separated.The single cell suspension that enzymolysis obtains tissue samples can for example be passed through.However, so can lose near dissociated cell Information.It is that micro laser is dissected that another kind can obtain the method for morphologic information.However, with regard to the availability of laser microdissection, Itself it cannot be guaranteed that obtain one it is complete unicellular.In order to obtain complete cell from purpose institutional framework, can be in research The described two measure of middle combination.The histotomy of 100 microns of thickness can be prepared and single organizational unit is cut from the tissue dissected (i.e. single body of gland, pipeline etc.).This section.By doing that, it is ensured that have complete unicellular in anatomical tissue.It is next Step can using enzymolysis from.Whole digestion process can be recorded by light field microscope imaging.

The developing genome of infantile tumour is heterogeneous

Mutation is randomly driven in view of certain cell having in tissue in thousands of cells, therefore organ very Possible no wonder.It is the set of 3,000,000,000 bases in view of genome, after driving mutation at first, I haven't seen you for ages for this cell polar Obtain second and drive mutation.In fact, after first driving mutation is obtained (Kras in PanIN), cell can be escaped just Normal differentiation simultaneously starts to breed and reprograms.After expansion, the precursor of this group of exceptions can run into inside and outside crisis, That is telomere crisis, immune attack and anoxic.As a result, people are it is anticipated that increased cell death and the propagation for slowing down. The presence in the stage can show as depauperation, and this is probably the critical stage of cancer development.Depauperation can survive for many years, The genome of accumulation height is heterogeneous.

With the genome sequencing to tumour, it is different types of into human cancer (Stratton, 2011) in tumour it is thin Born of the same parents generally accumulate the mutation of 1000-10000 individual cells.The numeral sets precursor and develops into mutation count necessary to cancer Amount scope.Therefore, it is contemplated that thousands of mutation is accumulated in the incubation period of depauperation cell.Dispute is only when a large amount of precursors When cell has obtained extensively mutation, wherein certain cell can be through the important driving mutation of next round.Once occur, can be pre- The cell can obtain comparing the proliferative advantage of other giant cells and be formed much bigger clonal expansion phase；The proliferation period correspondence Swollen neoplastic period (Fig. 8).In the face of various types of crises, depauperation and tumour are formed may multiple period and it will Coexist in a tumour.However, because cell colony is increasing, Clonal evolution accelerates and ultimately results in vicious transformation.

According to the scene of above-mentioned early-stage cancer development, it is intended that see high genetic group in depauperation period heterogeneous Property.It is heterogeneous possible less between neoplastic cell.By contrasting the mutation between depauperation and tumour formation, Wo Menneng Find the potential mutation for causing this to convert.

In the case of cancer of pancreas, Kras, p16, p53 and SMAD4 are substantially that most significant driving is mutated.People are universal Think, Kras gene mutations are the first driving mutation, because it is betided in more than 90% cancer of pancreas.Even if in low level Also Kras gene mutations are included in the pathology of PanIN-1A.When tumprigenicity essence is not also clearly set up, PanIN/ is designated as L-1A.The rank correspondence can be with the PanIN pathologies of the earliest period of collection in clinical sample.Due to cell poor, so can use Unicellular genome sequencing discloses the genome inhibition in low level PanIN/L-1A.The phase from PanIN-1A to PanIN-2, Other key mutation such as p16, p53 or SMAD4 can be obtained, the development of tumour is now contemplated that.

The heterogeneous early stage of genome will also include the aneuploid caused due to telomere crisis or other pressure.This Plant chromosome abnormality extensively to be observed in colorectal cancer and breast cancer adenoma.By replicating or deleting big chromosome piece Section, aneuploid may result in cell death, or alternatively cell pressure carried out towards reprogramming direction.Obviously it is non-whole Knowing from experience again affects evolutionary dynamics, if these are deleted occurred in the region for having crucial tumor suppressor gene, it may also function as Driving effect causes vicious transformation.Whether aneuploid plays causes to swell neoplastic driving effect or simply plays supporting function To increase the survival of depauperation cell, this point will be resolved in our current research.

Bibliography

Cheng J,Vanneste E,Konings P,Voet T,Vermeesch JR,Moreau Y.Single-cell copy number variation detection.Genome biology.2011；12(8):R80.doi:10.1186/gb- 2011-12-8-r80.PubMed PMID:21854607；PubMed Central PMCID:PMC3245619.

Dean FB,Hosono S,Fang L,Wu X,Faruqi AF,Bray-Ward P,et al.Comprehensive human genome amplification using multiple displacement amplification.Proceedings of the National Academy of Sciences.2002；99(8): 5261-6.doi:10.1073/pnas.082089499.

Dean FB,Nelson JR,Giesler TL,Lasken RS.Rapid Amplification of Plasmid and Phage DNA Using Phi29DNA Polymerase and Multiply-Primed Rolling Circle Amplification.Genome Res.2001；11(6):1095-9.doi:10.1101/gr.180501.

Fan HC,Wang J,Potanina A,Quake SR.Whole-genome molecular haplotyping of single cells.Nature biotechnology.2011；29(1):51-7.doi:10.1038/ nbt.1739.PubMed PMID:21170043.

Hou Y,Song L,Zhu P,Zhang B,Tao Y,Xu X,et al.Single-cell exome sequencing and monoclonal evolution of a JAK2-negative myeloproliferative neoplasm.Cell.2012；148(5):873-85.doi:10.1016/j.cell.2012.02.028.PubMed PMID: 22385957.

Lao K,Xu N,Straus N.Whole genome amplification using single-primer PCR.Biotechnol Journal.2008；3(3):378.

Navin N,Kendall J,Troge J,Andrews P,Rodgers L,Mclndoo J,et al.Tumour evolution inferred by single cell sequencing.Nature.2011；472(7341):90-4.doi: 10.1038/nature09807.PubMed PMID:21399628.

Stratton MR.Exploring the genomes of cancer cells:progress and promise.Science.2011；331(6024):1553-8.doi:10.1126/science.1204040.PubMed PMID:21436442.

Telenius H,Carter NP,Bebb CE,Nordenskjold M,Ponder BA,Tunnacliffe A.Degenerate oligonucleotide-primed PCR:general amplification of target DNA by a single degenerate primer.Genomics.1992；13(3):718-25.PubMed PMID:1639399.

Zhang K,Martiny AC,Reppas NB,Barry KW,Malek J,Chisholm SW,et al.Sequencing genomes from single cells by polymerase cloning.Nature biotechnology.2006；24(6):680-6.doi:10.1038/nbt 1214.PubMed PMID:16732271.

Zhang L,Cui X,Schmitt K,Hubert R,Navidi W,Arnheim N.Whole genome amplification from a single celkimplications for genetic analysis.Proceedings of the National Academy of Sciences of the United States of America.1992；89 (13):5847-51.PubMed PMID:1631067；PubMed Central PMCID:PMC49394.

Although the present invention and its advantage is described in detail, but it is to be understood that without departing from by claims In the case of the spirit and scope of the present invention of restriction, various change can be carried out to this, replace and change.Additionally, the application Scope be not intended to be limited to process described in specification, machine, making, material composition, mode, method and steps it is concrete Embodiment.Those of ordinary skill in the art will readily appreciate that from the disclosure, can be used according to the present invention The process that presently, there are or can develop later, machine, making, material composition, mode, method or step carry out substantially with herein The corresponding embodiment identical function of description realizes substantially the same result.Therefore, claims are intended to this A little process, machine, making, material composition, mode, method or steps are included in the range of it.

Sequence table

<110> Zong, Chenghang

<120>Unicellular full-length genome linear amplification method

<130> BAYM.P0124WO

<140> UNKNOWN

<141> 2015-05-05

<150> 61/989,002

<151> 2014-05-06

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 34

<212> DNA

<213>Artificial sequence

<220>

<223>The primer of synthesis

<220>

<221> misc_feature

<222> (27)..(31)

<223>N is a, c, g, or t

<400> 1

gtgagtgatg gttgaggatg agtggtnnnn nggg 34

<210> 2

<211> 34

<212> DNA

<213>Artificial sequence

<220>

<223>The primer of synthesis

<220>

<221> misc_feature

<222> (27)..(31)

<223>N is a, c, g, or t

<400> 2

gtgagtgatg gttgaggatg agtggtnnnn nttt 34

<210> 3

<211> 26

<212> DNA

<213>Artificial sequence

<220>

<223>The primer of synthesis

<400> 3

gtgagtgatg gttgaggatg agtggu 26

<210> 4

<211> 26

<212> DNA

<213>Artificial sequence

<220>

<223>The primer of synthesis

<400> 4

gtgagtgatg gttgaggatg agtggt 26

<210> 5

<211> 24

<212> DNA

<213>Artificial sequence

<220>

<223>The primer of synthesis

<400> 5

gtgagtgatg gttgaggatg agtg 24

Claims (52)

1. the method for producing amplicon by one or more cellular linears, comprises the following steps：

Polymerase by first a large amount of primers are contacted from the nucleic acid of one or more of cells and comprising strand-displacement activity, institute State contact to betide under conditions of 0 DEG C to about 35 DEG C temperature range, wherein the primer and the Nucleic acids anneal, and the primer Extended by polymerase, wherein first a large amount of primers have following characteristics：

A) G or the C rich in 40%-60% rich in 40%-60%；With

B) restriction endonuclease site is included,

So as to produce the nucleic acid-templated mixture comprising primer annealing；

Nucleic acid-templated two-wheeled or the more wheels of carrying out of primer annealing are extended, are unwind and annealing steps, thus produce it is nucleic acid-templated, The mixture of linear half amplicon for producing and the full amplicon of non-linear generation；

The mixture is placed in enable full amplicon two ends anneal with one another under conditions of, so as to produce cyclization it is complete Amplicon；

By the full amplicon contact restriction endonuclease of the cyclization, so that full amplicon can not in a large number draw with first Thing or second a large amount of primer annealings, wherein G or C of the second a large amount of primers rich in 40%-60%；And

Half amplicon of remaining linear generation is annealed and is extended with mixture to make first a large amount of primers or second a large amount of primers, It is wherein described to anneal and extend in generation in the case that nucleic acid further unwind, thus produce the linear full amplification for producing Son.

2. the method for claim 1, the step of it further includes to make the full amplicon of linear generation to be expanded.

3. the method for claim 1 wherein it is described polymerization azymia exonuclease activity.

4. the method for claim 1 wherein that the contact in blend step betides the temperature less than 60 DEG C.

5. the method for claim 1, it further includes to obtain nucleic acid from one or more of cells.

6. the method for claim 5, wherein the acquisition step includes the one or more of cells of cracking and therefrom extracts core Acid.

7. the method for claim 1 wherein that the nucleic acid includes genomic DNA.

8. the method for claim 1 wherein that the nucleic acid includes RNA, and methods described also includes preparing cDNA from described RNA The step of.

9. the method for claim 1 wherein first a large amount of primers, second a large amount of primers or the two include following formula：

X_nY_mZ_p,

Wherein n is the G rich in 40%-60% or the C rich in 40%-60% more than 2 and X, and wherein Y is any nucleotides, and m is 3-8 nucleotides, and wherein work as X_nIt is that Z is G when being rich in G, works as X_nIt is that Z is C when being rich in C, wherein p is 2-4 nucleotides.

10. the method for claim 9, wherein m is 5 nucleotides.

The method of 11. claims 9, wherein p are 3 nucleotides.

The method of 12. claims 9, wherein n are 20-40 nucleotides.

The method of 13. claims 12, wherein n are 25-35 nucleotides.

The method of 14. claims 12, wherein n are 24-28 nucleotides.

15. the method for claim 1 wherein that the polymerase is Bst large fragments or pyrophage3173 polymerases.

16. temperature ranges of the nucleic acid-templated extension step at 30 DEG C to 65 DEG C that the method for claim 1 wherein primer annealing Interior generation.

The method of 17. claims 16, wherein after the nucleic acid-templated extension of primer annealing, the nucleic acid is at least 90 DEG C Temperature unwind.

The method of 18. claims 17, wherein after the nucleic and melting, the nucleic acid is cooled to less than primer melting temperature Temperature, and add can heat-inactivated polymerase.

The method of 19. claims 18, wherein can be temperature in the Tm less than PCR primer after heat-inactivated polymerase adding The thermal cycle of the temperature between degree and the temperature higher than the Tm of PCR primer.

The method of 20. claims 19, wherein carrying out the thermal cycle at 58 DEG C -67 DEG C.

The method of 21. claims 19 or 20, wherein the thermal cycle includes 10-30 circulation.

The method of 22. claims 19, wherein carrying out hot inactivation to polymerase, is subsequently added restriction endonuclease.

The method of 23. claims 1, it is included to there is the nucleic acid-templated of primer annealing to carry out three to ten continuous extensions, solutions Chain and annealing steps.

24. the method for claim 1 wherein that the restriction endonuclease can be in the temperature digesting nucleic acid more than 50 DEG C.

The method of 25. claims 24, wherein the restriction endonuclease is BtsCI/BseGI.

26. the method for claim 1 wherein by polymerase chain reaction (PCR) or the isothermal duplication (LAMP) of ring mediation to line Property produce full amplicon expanded.

27. the method for claim 1 wherein that at least linear full amplicon for producing of great majority is separated from each other.

28. the method for claim 1 wherein that at least linear full amplicon for producing of great majority is each placed in separate container In.

The method of 29. claims 28, wherein hole of the separate container for microporous substrate.

The method of 30. claims 29, wherein the hole includes one or more amplification reaction reagent.

31. the method for claim 27, wherein the amplicon to separately including is expanded.

The method of 32. claims 31, wherein the amplification is PCR or LAMP.

33. the method for claim 1 wherein that the full amplicon for making linear generation is subject to uracil-DNA- glycosylases and DNA sugared The effect of the mixture of base enzyme-lyases endonuclease VIII, is then acted on by S1 nucleases or T4 polymerases.

34. the method for claim 1 wherein that the full amplicon to linear generation is sequenced or library construction.

35. the method for claim 1 wherein certain nucleotides or nucleosides for determining one or more linear full amplicons for producing Acid sequence.

The method of 36. claims 35, wherein the specific nucleotide or nucleotide sequence are the mutation in amplicon, represents core Mutation in acid.

The method of 37. claims 36, wherein the mutation is disease related mutation.

38. the method for claim 1 wherein one or more of cells from fetus, baby, children or adult.

39. the method for claim 1 wherein that one or more of cells can be fixed in Histological preparations.

40. the method for claim 1 wherein that one or more of cells are fresh.

41. the method for claim 1 wherein that one or more of cells can suffer from medical science disease from medical condition or suspection The individual acquisition of condition.

The method of 42. claims 41, wherein the medical condition is genetic disease.

The method of 43. claims 41, wherein the medical condition includes cancer.

44. determine the method from individual nucleic acid, and the medical condition or identification for identifying individuality is individual to have medical condition Risk, part including the full amplicon of the linear generation that will be generated from individual sample by the method for claim 1 or entirely The step of portion's sequence is compared with standard items.

The method of 45. claims 44, wherein the nucleic acid includes genomic DNA.

The method of 46. claims 44, wherein the nucleic acid includes the cDNA produced from the RNA from sample.

The method of 47. claims 44, wherein the standard items include the nucleic acid from individual normal cell.

The method of 48. claims 44, wherein the standard items include other individual normal cells from one or more Nucleic acid.

The method of 49. claims 44, wherein the expression of the cell amplifying nucleic acid in individual sample is with linear generation The number of full amplicon is represented.

The method of 50. claims 44, wherein comparison step include at least some of the cell in individual sample is linear The number of the full amplicon for producing is compared with standard items.

The method of 51. claims 44, wherein described at least some linear full amplicon for producing includes that one or more are concrete Gene.

The method of 52. claims 44, wherein comparison step include determining the linear full amplicon for producing compared with standard items, its In one or more specific nucleotide whether there is.