CN111321202A - Gene fusion variation library construction method, detection method, device, equipment and storage medium - Google Patents

Abstract

The present invention relates to a gene fusion variation library construction method, detection method, device, computer equipment and computer storage medium. The above-mentioned gene fusion mutation library construction method, gene fusion mutation detection method and device of the present invention are based on the DNA probe hybridization capture multi-gene RNA targeted sequencing technology, and the fusion gene capture probe hybridization captures the target fusion gene to construct a gene fusion mutation library. The library can be used for high-throughput sequencing, and after bioinformatics analysis, the core genes that constitute breakpoints and their partner genes can be identified. Further, the present invention also designs a method for quantitative analysis of fusion genes, through which the variation ratio of fusion genes can be obtained, and then the accurate expression value of fusion genes can be obtained. The method for quantitative analysis of fusion genes is pioneering and solves the problem of NGS Quantitative analysis problems for detection of fusion genes.

Description

Gene fusion variant library construction method, detection method, device, equipment and storage medium

technical field

The present invention relates to the technical field of molecular biology and bioinformatics, in particular to a gene fusion variant library construction method, detection method, device, equipment and storage medium.

Background technique

Cytogenetic studies have found that there are multiple chromosomal translocations in a series of hematological tumors, including AML, ALL, CML, and NHLs, which lead to abnormal expression of oncogenes and/or transcriptional expression of fusion genes, which promote the transformation and survival of cancer cells. . These core driver genes (such as MLL, ALK, etc.) often have multiple fusion gene partners, and may also have different breakpoints with the same fusion gene, thus forming different subtypes. For example, there are 54 MLL genes. Known fusion partners, and the COSMIC database includes up to 15 fusion isoforms of the KMT2A-AFF1 fusion gene (https://cancer.sanger.ac.uk/cosmic/fusion/overview?fid=359723&gid=271430). These fusion gene variants affect clinical prognosis and can guide molecular typing and targeted therapy of hematological tumors. Therefore, the development of a genomic detection reagent to identify gene fusion variants in hematological tumors is an unfinished need.

RT-PCR and fluorescence in situ hybridization (FISH) are two commonly used gene fusion detection techniques. Both detect a single specific type of known gene fusion, which is narrow in scope and low in efficiency, and cannot detect new gene fusion variants. Therefore, the lack of fusion gene detection technology still limits the auxiliary diagnosis and precision medicine of hematological tumors.

SUMMARY OF THE INVENTION

Based on this, it is necessary to provide a gene fusion mutation library construction method, detection method, device, computer equipment and computer storage medium that have a wide range of applications, high detection efficiency and can detect new gene fusion mutations.

A method for constructing a gene fusion variant library, comprising the following steps:

Extract the total RNA of the sample and remove the rRNA;

Reverse transcription of the total RNA after removing the rRNA to synthesize double-stranded cDNA, and use dUTP instead of dTTP to synthesize the second strand of the double-stranded cDNA;

performing end repair on the synthesized double-stranded cDNA and adding a ligation linker;

Enzymatic digestion digests the dUTP in the double-stranded DNA after end repair and addition of the ligation linker, so that the double-stranded cDNA is nicked;

Amplify the double-stranded DNA after digestion and digestion to construct a cDNA pre-library;

Use a fusion gene capture probe to hybridize and capture the target fusion cDNA in the cDNA pre-library, the target fusion cDNA is composed of fusion of at least two different genes, and the fusion gene capture probe contains a cDNA capable of being fused with the target The sequence of the complementary pairing of the sequences of one of the genes;

Amplify the captured target fusion cDNA to obtain the gene fusion variant library.

In one embodiment, the design principles of the fusion gene capture probe are as follows:

(1) The fusion gene capture probe is designed for the core gene in the target fusion cDNA, and the core gene refers to a gene that has multiple gene partners and is prone to fusion mutation, or is in the cell growth or proliferation signaling pathway. key genes, or driver genes;

(2) the fusion gene capture probe is designed for the transcript sequence of the core gene;

(3) The fusion gene capture probe is designed for the core gene in the hg19 reference genome, and the coverage density is 2 × tiling sequences;

(4) the length of the fusion gene capture probe is 120bp;

(5) The fusion gene capture probe needs to be compared to the human transcriptome sequence during design, and the number of all Blast matches is counted. If the number of Blast matches is not greater than 50, it is qualified. If the number of Blast matches is greater than 50, then Redesign by replacing mismatched bases until the highest match to the target gene sequence is obtained and the number of Blast matches is not more than 50.

In one embodiment, the 5' end of the fusion gene capture probe is labeled with a linker for capture;

Optionally, the linker is biotin or streptavidin.

In one embodiment, the total RNA of the sample is total RNA of peripheral blood or bone marrow samples.

In one embodiment, the end repair is the addition of a dATP to the 3' end of the synthesized double-stranded cDNA;

The linker format introduced by the added linker is P5-Real1primer-DNAINSERT-IndexReadprimer-index-P7, specifically: 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCGATC*T-DNA fragment sequence to be tested-GTTCGTCTTCTGCCGTATGCTCTA-index-C ACTGACCTCAAGTCTGCACACGAGAAGGCTAG-P, wherein P5 And P7 is the linker, Real1primer and IndexReadprimer are the primer sequences, DNAINSERT is the DNA fragment sequence to be tested, index is the unique sample tag of 12nt, and p is the phosphate group.

In one embodiment, the amplification of the double-stranded DNA digested by the amplifying enzyme and the amplification of the captured target fusion cDNA is performed using primers paired with the sequences of linkers P5 and P7.

A gene fusion mutation detection method, comprising the following steps:

Obtain the sequencing data of the gene fusion variant library, the gene fusion variant library is an amplification library of the target fusion gene obtained by hybridizing and capturing the transcription sequence of the sample to be tested by the fusion gene capture probe, and the target fusion gene is composed of at least one. Composed of two different genes fused, the fusion gene capture probe contains a sequence capable of complementary pairing with the sequence of one of the target fusion genes;

Comparing the sequencing data with human transcriptome and genome data, and screening reads that can match at least two genes at the same time;

It is analyzed whether the reads that can match at least two genes at the same time meet the preset threshold requirements, and if so, it means that a plurality of genes included in the reads have undergone gene fusion.

In one embodiment, before the step of comparing the sequencing data with the human transcriptome and genome data, and screening reads that can match at least two genes at the same time, the step further includes:

The quality of the sequencing data is evaluated, and low-quality reads are eliminated to obtain clean sequencing data.

In one embodiment, the culling of low-quality reads comprises:

Remove reads containing linker sequences;

Remove reads with low-quality bases with a quality value below 15 accounting for ≧50%;

Reads containing more than 1% of N were removed.

In one of the embodiments, it further includes the step of eliminating false positive events in the clean sequencing data according to a preset control standard after comparing the sequencing data with the human transcriptome and genome data;

Specifically, annotate the gene fusion mutation events obtained by screening, remove the false and preserve the true, and eliminate the gene fusion mutation events that meet the following criteria:

The different genes of the fusion gene are paralogous to each other;

The different genes of the fusion gene are pseudogenes;

The gene fusion variant has been detected in normal healthy people.

In one embodiment, the preset threshold requirement refers to: if the fusion gene mutation has clinical significance, more than 3 unique spanning reads matching the two genes at the same time; if the fusion gene mutation is clinically significant If it is not clear, there are more than 10 unique spanning reads matching the two genes at the same time.

In one embodiment, it also includes:

Calculate the mutation ratio of the fusion gene according to the following formula:

in,

The fusion supporting read pairs refers to the number of read pairs supporting the gene fusion;

Described #mappable reads refers to the number of reads of the genome in comparison;

The weighted-average of Insertsize-read length refers to the weighted average length of the inserted cDNA fragments in the library;

The refgeneFPKM is the normalized expression value of the internal reference gene;

The FPKM is defined as Reads Per Kilobase of exon model per Million mappedreads, that is, the number of reads aligned to every 1K bases of an exon in every 1 million aligned reads.

A gene fusion mutation detection device, comprising:

The sequencing data acquisition module is used to obtain the sequencing data of the gene fusion variant library. The gene fusion variant library is an amplification library of the target fusion gene obtained by hybridizing and capturing the transcription sequence of the sample to be tested by using the fusion gene capture probe. The target fusion gene is composed of fusion of at least two different genes, and the fusion gene capture probe contains a sequence capable of complementary pairing with the sequence of one of the target fusion genes;

an alignment screening module for aligning the sequencing data with human transcriptome and genome data, and screening reads that can match at least two genes at the same time; and

The fusion analysis module is used to analyze whether the reads that can match at least two genes at the same time meet the preset threshold requirements.

In one embodiment, it also includes:

The variation ratio calculation module is used to calculate the variation ratio of the fusion gene according to the following formula:

in,

The fusion supporting read pairs refers to the number of read pairs supporting the gene fusion;

Described #mappable reads refers to the number of reads of the genome in comparison;

The refgeneFPKM is the normalized expression value of the internal reference gene;

The weighted-average of Insertsize-read length refers to the weighted average length of the inserted cDNA fragments in the library;

The FPKM is defined as Reads Per Kilobase of exon model per Million mappedreads, that is, the number of reads aligned to every 1K bases of an exon in every 1 million aligned reads.

A computer device has a processor and a memory, the memory stores a computer program, and when the processor executes the computer program, the steps of the gene fusion mutation detection method described in any of the above embodiments are implemented.

A computer storage medium on which a computer program is stored, and when the computer program is executed, implements the steps of the gene fusion mutation detection method described in any one of the above embodiments.

A single driver gene can be genetically fused with multiple other genes (partner genes), and after the fusion gene is transcribed, a junction (ie, breakpoint) between the core gene exon and the partner gene exon is formed. The above-mentioned gene fusion mutation library construction method, gene fusion mutation detection method and device of the present invention are based on the DNA probe hybridization capture multi-gene RNA targeted sequencing technology, and the fusion gene capture probe hybridization captures the target fusion gene to construct a gene fusion mutation library. The library can be used for high-throughput sequencing, and after bioinformatics analysis, the core genes that constitute breakpoints and their partner genes can be identified.

The gene fusion mutation library construction method, gene fusion mutation detection method and device can be used to detect information such as known or new gene rearrangements, gene deletions, gene duplications and other gene mutations related to a variety of blood tumor hot spot fusion genes. Compared with traditional methods such as fluorescence quantitative methods, the technical concept of the present invention is more comprehensive and efficient, and has both efficiency and economy.

Further, the present invention also designs a method for quantitative analysis of fusion genes, through which the variation ratio of fusion genes can be obtained, and then the accurate expression value of fusion genes can be obtained. The method for quantitative analysis of fusion genes is pioneering and solves the problem of NGS Quantitative analysis problems for detection of fusion genes.

Description of drawings

1 is a schematic flowchart of a fusion gene mutation detection method according to an embodiment of the present invention;

FIG. 2 is a schematic structural diagram of a module of a fusion gene mutation detection device according to an embodiment of the present invention.

Detailed ways

In order to facilitate understanding of the present invention, the present invention will be described more fully hereinafter with reference to the related drawings. Preferred embodiments of the invention are shown in the accompanying drawings. However, the present invention may be embodied in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that a thorough and complete understanding of the present disclosure is provided.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terms used herein in the description of the present invention are for the purpose of describing specific embodiments only, and are not intended to limit the present invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

The fusion gene described herein refers to the gene in which genes on different gene coordinates are spliced together through chromosomal rearrangement and other mechanisms and are transcribed to form a new fusion protein, which is expressed in the form of gene A/gene B, or gene A-gene B, such as BCR-ABL1, gene A and gene B are fusion gene partners.

The selected gene is a key core fusion gene. The core gene refers to the gene with a high frequency of fusion and mutation. Studies have found that it has a variety of fusion gene partners, or refers to a key gene in the cell growth or proliferation signaling pathway. Or a driver gene.

The "reads" refer to sequence fragments obtained by high-throughput sequencing.

The sequencing quality refers to the accuracy of the bases in the read sequence.

The "human transcriptome" is the combined product of all gene expression in human cells.

The human genome is hg19.

The paralogs (Paralogs) are those proteins derived from gene duplication in a certain species, which may evolve new functions related to the original. Used to describe homologous genes that have separated due to gene duplication within the same species.

The pseudogene can be viewed as a non-functional copy of genomic DNA in the genome that closely resembles the coding gene sequence.

The Body Map 2.0 is a set of transcriptome sequencing data of human normal tissues.

The "gene distance" refers to the distance between the gene coordinates of two genes.

The invention provides a method for constructing a gene fusion variant library, which comprises the following steps:

Extract the total RNA of the sample and remove the rRNA;

The total RNA after removing rRNA is reverse transcribed to synthesize double-stranded cDNA, and dUTP is used instead of dTTP to synthesize the second strand of double-stranded cDNA;

End repair and addition of ligation adapters to the synthesized double-stranded cDNA;

Digestion of the dUTP in the double-stranded DNA after end repair and addition of the ligation linker, resulting in gaps in the double-stranded cDNA;

Amplify the digested double-stranded DNA to construct a cDNA pre-library;

Use the fusion gene capture probe to hybridize and capture the target fusion cDNA in the cDNA pre-library. The target fusion cDNA is composed of fusion of at least two different genes. The fusion gene capture probe contains a sequence complementary pairing with one of the genes of the target fusion cDNA. the sequence of;

Amplify the captured target fusion cDNA to obtain a gene fusion variant library.

In a specific example, the total RNA of the sample is the total RNA of peripheral blood or bone marrow samples. After the total RNA of the sample is extracted, preferably, the step of determining nucleic acid concentration and A260/A280 value is also included.

In a specific example, the removal of the rRNA is by hybridizing the total RNA with a rRNA-synthesized single-stranded DNA probe, and the rRNA is removed by hybridizing the rRNA-synthesized single-stranded DNA probe with the rRNA in the total RNA.

In a specific example, end repair is the addition of a dATP to the 3' end of the synthesized double-stranded cDNA; the addition of a ligation adaptor introduces the adaptor format: P5-Real1primer-DNAINSERT-IndexReadprimer-index-P7. Specifically, the linker sequence is: 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T-DNA fragment sequence to be tested-GTTCGTCTTCTGCCGTATGCTCTA-index-CACTGACCTCAAGTCTGCACACGAGAAGGCTAG-P, wherein P5 (5'-AATGATACGGCGACCACCGA-3', SEQ ID NO: 1) and P7 ( 5'-CAAGCAGAAGACGGCATACGAGAT-3', SEQ ID NO:2) is a linker, Real1primer (GATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, SEQ ID NO:3) and IndexReadprimer (GTTCGTCTTCTGCCGTATGCTCTA, SEQ ID NO:4) are primer sequences, and DNAINSERT is the DNA fragment sequence to be tested, index is a unique sample tag of 12nt, and p is a phosphate group.

In a specific example, the design principles of the fusion gene capture probe are as follows: (1) The fusion gene capture probe is designed for the core gene in the target fusion cDNA, and the core gene refers to that there are multiple gene partners and Genes prone to fusion mutations, or key genes in cell growth or proliferation signaling pathways, or driver genes;

(2) the fusion gene capture probe is designed for the transcript sequence of the core gene;

(3) The fusion gene capture probe is designed for the core gene in the hg19 reference genome, and the coverage density is 2×tiling sequence (2×tiling);

(4) the length of the fusion gene capture probe is 120bp;

(5) The fusion gene capture probe needs to be compared to the human transcriptome sequence during design, and the number of all Blast hits (BLAST hits) is counted. If the number of Blast matches is not greater than 50, it is qualified. If the number of Blast matches If it is greater than 50, it will be redesigned by replacing the mismatched bases until the highest match to the target gene sequence is obtained and the number of Blast matches is not greater than 50.

For example, in some specific examples, 54 core genes can be selected for hematological tumors (leukemia and lymphoma), namely ABL1, CREBBP, CRLF2, MECOM, TP53, TSLP, LMO2, PRDM16, MYC, ETV6, RARA, NUP214, BCL6 , MYB, IRF4, CBFB, CEBPB, ZNF384, RUNX1, FGFR3, MALT1, ERG, NPM1, PAX5, JAK2, PICALM, FLT3, GLIS2, PDGFRB, PML, TLX1, ITK, FGFR1, IL2RB, TAL1, WT1, NTRK3, NUP98 , EPOR, RBM15, CSF1R, KMT2A, BCL2, BCR, LYN, TLX3, CCND1, TCF3, CEBPA, ABL2, ALK, PDGFRA, IGLL5, IGHA2, obtain transcript sequence numbers from Ensembl database, and design overlapping 2× Tiling (the 5' end of the probe is labeled with biotin for capture), resulting in a library of probes.

Further, the 5' end of the fusion gene capture probe is labeled with a linker for capturing, for example, a linker labeled with biotin or streptavidin for immobilizing on the substrate.

In a specific example, amplifying the digested double-stranded DNA and amplifying the captured target fusion cDNA is performed using primers paired with the sequences of linkers P5 and P7.

As shown in Figure 1, the present invention also provides a gene fusion mutation detection method, which comprises the following steps:

Step S110: Obtain the sequencing data of the gene fusion variant library. The gene fusion variant library is an amplified library of the target fusion gene obtained by hybridizing and capturing the transcription sequence of the sample to be tested by using the fusion gene capture probe. The target fusion gene is composed of at least two The fusion gene capture probe contains a sequence that can be complementary to the sequence of one of the target fusion genes;

Step S120: Compare the sequencing data with the human transcriptome and genome data, and screen reads that can match at least two genes at the same time;

Step S130: Analyze whether the reads that can match at least two genes at the same time meet the preset threshold requirements, and if so, it means that multiple genes included in the reads have undergone gene fusion.

In a specific example, a Novaseq 6000 high-throughput sequencer can be used to perform high-throughput sequencing on the gene fusion variant library, and the sequencing depth can be, but not limited to, 5000X.

In a specific example, before the step of comparing the sequencing data with the human transcriptome and genome data, and screening reads that can match at least two genes at the same time, the step further includes:

The quality of the sequencing data is evaluated, and low-quality reads are eliminated to obtain clean sequencing data.

Specifically, raw data can be converted to raw fastq files by using but not limited to bcl2fastq software, and the quality of raw fastq data can be assessed by fastQC software, and low-quality reads can be eliminated by using but not limited to Trimmomatic software to obtain the clean sequencing data.

Further, in a specific example, the culling of low-quality reads includes:

Remove reads containing linker sequences;

Remove reads with low-quality bases with a quality value below 15 accounting for ≧50%;

Reads containing more than 1% of N were removed.

In a specific example, the gene fusion variant detection method further includes the step of eliminating false positive events in the clean sequencing data according to preset control standards after comparing the sequencing data with the human transcriptome and genome data;

Specifically, annotate the gene fusion mutation events obtained by screening, remove the false and preserve the true, and eliminate the gene fusion mutation events that meet the following criteria:

The different genes of the fusion gene are paralogous to each other;

The different genes of the fusion gene are pseudogenes;

The gene fusion variant has been detected in normal healthy people (for example, Body Map 2.0 is a transcriptome data set of normal human tissue, and the gene fusion variant detected by analyzing the data is judged as false positive.).

Specifically, software such as, but not limited to, BOWTIE, STAR, SPOTLIGHT, etc., can be used to align all reads with the human transcriptome and genome, and screen reads that match the transcripts of the two genes at the same time. False positive events were then eliminated by a series of criteria, such as paralog, pseudogene, Body Map 2.0, gene distance, etc. If the reads matching two genes at the same time exceed the preset threshold, it is determined that the two genes have undergone gene fusion.

More specifically, the preset threshold requirement refers to: if the fusion gene mutation has clinical significance, then the unique spanning reads that match the two genes at the same time exceed 3 (spanning read refers to the alignment to the gene fusion junction (junction). ) reads); if the fusion gene variation is of unknown clinical significance, the unique spanning reads matched to the two genes at the same time exceed 10.

Further, the gene fusion mutation detection method provided by the present invention also includes calculating the mutation ratio of the fusion gene according to the following formula:

in,

The fusion supporting read pairs refers to the number of read pairs supporting the gene fusion;

Described #mappable reads refers to the number of reads of the genome in comparison;

The weighted-average of Insertsize-read length refers to the weighted average length of the inserted cDNA fragments in the library;

The refgeneFPKM is the normalized expression value of the internal reference gene;

The FPKM is defined as Reads Per Kilobase of exon model per Million mappedreads, that is, the number of reads aligned to every 1K bases of an exon in every 1 million (10 ⁹ ) aligned reads.

This is a quantitative model of gene transcripts, calculated according to stringtie software, mainly for pair-end sequencing expression. The difference between FPKM and RPKM is that one is fragment and the other is read. For single-end sequencing data, since Cufflinks calculates a read as a fragment, FPKM is equivalent to RPKM (RPKM=total exon reads/ (mapped reads(Millions)*exon length(KB))). For paired-end sequencing, if a pair of paired-reads are aligned, then this paired-read pair is called a fragment, and if only one paired-read pair is aligned, the other is not. In comparison, the read in this comparison is called a fragment.

Based on the same idea as the above detection method, as shown in FIG. 2 , the present invention also provides a gene fusion mutation detection device 200, which includes:

The sequencing data acquisition module 210 is used for acquiring the sequencing data of the gene fusion variant library. The gene fusion variant library is an amplification library of the target fusion gene obtained by hybridizing and capturing the transcription sequence of the sample to be tested by using the fusion gene capture probe. The target fusion The gene is composed of fusion of at least two different genes, and the fusion gene capture probe contains a sequence that can be complementary to the sequence of one of the target fusion genes;

an alignment screening module 220 for aligning the sequencing data with the human transcriptome and genome data, and screening reads that can match at least two genes simultaneously; and

The fusion analysis module 230 is configured to analyze whether the reads that can match at least two genes at the same time meet the preset threshold requirements, and if so, it means that the multiple genes included in the reads have undergone gene fusion.

Optionally, the gene fusion mutation detection device 200 also includes:

The variation ratio calculation module 240 is used to calculate the variation ratio of the fusion gene according to the following formula:

in,

The fusion supporting read pairs refers to the number of read pairs supporting the gene fusion;

Described #mappable reads refers to the number of reads of the genome in comparison;

The weighted-average of Insertsize-read length refers to the weighted average length of the inserted cDNA fragments in the library;

The refgeneFPKM is the normalized expression value of the internal reference gene;

The FPKM is defined as Reads Per Kilobase of exon model per Million mappedreads, that is, the number of reads aligned to every 1K bases of an exon in every 1 million (10 ⁹ ) aligned reads.

Based on the above embodiments, the present invention also provides a computer device that can be used for gene fusion mutation detection, which has a processor and a memory, and the memory stores a computer program. When the processor executes the computer program, any of the above implementations is implemented. Example of the steps of the gene fusion variant detection method.

Those of ordinary skill in the art can understand that all or part of the process in the above method can be implemented by instructing the relevant hardware through a computer program, and the program can be stored in a non-volatile computer-readable storage medium. In this embodiment of the present invention, the program may be stored in a storage medium of a computer system, and executed by at least one processor in the computer system, so as to implement the processes including the foregoing method embodiments. The storage medium may be a magnetic disk, an optical disk, a read-only memory (Read-Only Memory, ROM), or a random access memory (Random Access Memory, RAM) or the like.

Accordingly, the present invention also provides a computer storage medium that can be used for gene fusion mutation detection, which stores a computer program, and when the computer program is executed, implements the steps of the gene fusion mutation detection method in any of the above embodiments.

A single driver gene can be genetically fused with multiple other genes (partner genes), and after the fusion gene is transcribed, a junction (ie, breakpoint) between the core gene exon and the partner gene exon is formed. The above-mentioned gene fusion mutation library construction method, gene fusion mutation detection method and device of the present invention are based on the DNA probe hybridization capture multi-gene RNA targeted sequencing technology, and the fusion gene capture probe hybridization captures the target fusion gene to construct a gene fusion mutation library. The library can be used for high-throughput sequencing, and after bioinformatics analysis, the core genes that constitute breakpoints and their partner genes can be identified.

The gene fusion mutation library construction method, gene fusion mutation detection method and device can be used to detect information such as known or new gene rearrangements, gene deletions, gene duplications and other gene mutations related to a variety of blood tumor hot spot fusion genes. Compared with traditional methods such as fluorescence quantitative methods, the technical concept of the present invention is more comprehensive and efficient, and has both efficiency and economy.

Further, the present invention also designs a method for quantitative analysis of fusion genes, through which the variation ratio of fusion genes can be obtained, and then the accurate expression value of fusion genes can be obtained. The method for quantitative analysis of fusion genes is pioneering and solves the problem of NGS Quantitative analysis problems for detection of fusion genes.

The construction method and detection method of the gene fusion variant library of the present invention will be further described in detail below with reference to the case of the specific library construction and detection method.

1) DNA probe design based on mRNA sequence

In this case, the transcription sequence of the fusion gene was captured by DNA probe hybridization, and high-throughput sequencing was performed. After bioinformatics analysis, the hotspots involved in the fusion gene or the new fusion form could be obtained.

For hematological tumors (leukemia and lymphoma), 54 core genes were selected, namely ABL1, CREBBP, CRLF2, MECOM, TP53, TSLP, LMO2, PRDM16, MYC, ETV6, RARA, NUP214, BCL6, MYB, IRF4, CBFB, CEBPB , ZNF384, RUNX1, FGFR3, MALT1, ERG, NPM1, PAX5, JAK2, PICALM, FLT3, GLIS2, PDGFRB, PML, TLX1, ITK, FGFR1, IL2RB, TAL1, WT1, NTRK3, NUP98, EPOR, RBM15, CSF1R, KMT2A , BCL2, BCR, LYN, TLX3, CCND1, TCF3, CEBPA, ABL2, ALK, PDGFRA, IGLL5, IGHA2. The transcript sequence number was obtained from the Ensembl database, and an overlapping 2× tiling sequence was designed according to its sequence (the 5' end of the probe was labeled with biotin for capture) to obtain a probe library.

2) Extraction of total RNA from samples

Total RNA was extracted from peripheral blood or bone marrow samples of patients with leukemia and lymphoma using the QIAsymphony RNA Kit (Cat#931636) from QIAGEN. Please refer to the manufacturer's manual for specific operation steps.

Use (1) NanoDrop spectrophotometer to measure nucleic acid concentration and A260/A280 value (expected value is between 1.9-2.1); (2) use Qubit ^TM RNA HS Assay Kit (Cat.#Q32855) to measure nucleic acid concentration.

3) Eliminate ribosomal rRNA

XP beads纯化消除rRNA后的RNA样本。Hybridize 500 ng of the total RNA extracted in step 2) with the rRNA synthetic single-stranded DNA probe, and digest the rRNA with RNaseH. For the specific operation steps, please refer to the instruction manual of the NEBNext rRNA Depletion Kit. use

RNA samples after purification of rRNA with XP beads.

4) Synthesize cDNA by reverse transcription

Incubate at 94°C for 6 minutes in a PCR machine to fragment the RNA. The fragmented RNA was reverse transcribed into single-stranded c'DNA using Reversetranscriptase.

5) Synthesize the second strand of cDNA

Single-stranded c'DNA was synthesized into double-stranded cDNA using DNA Polymerase I, Large (Klenow) Fragment. dUTP is used here instead of dTTP. Thus the second strand cDNA is embedded in dUTP. Double-stranded cDNA was purified using AMPure XP Beads.

6) End Repair

Double-stranded cDNA was treated with NEBNext Ultra II End Prep Enzyme Mix and a dATP was added to the 3' end.

7) Connect the connector

The ligase Ligase, the Index adapter containing the 12nt unique sequence and the end repair cDNA were mixed, and incubated in a PCR machine at 16°C for 60 minutes to obtain a cDNA library ligated with the adapter.

Adapter format: P5-Read1primer-DNA INSERT-IndexReadprimer-index-P7.

8) Enzymatic cleavage to create a gap in the second strand of cDNA

The uracil DNA glycosylase (UDG) and Endonuclease VIII mix were added to the above system, and the two synergistically digested the dUTP in the cDNA library fragment to make a gap.

9) Library amplification

Using KAPA HiFi HotStart ReadyMix, primers paired with linker P5, P7 sequences (P5: 5'-AATGATACGGCGACCACCGA-3', SEQ ID NO: 1; P7: 5'-CAAGCAGAAGACGGCATACGAGAT-3', SEQ ID NO: 2) The library is amplified in a PCR machine. cDNA pre-libraries were purified using AMPure XP Beads.

10) Probe capture hybridization

Universal Blockers-TS Mix、Human Cot-1DNA混合，使用真空抽滤系统(60℃)干燥成干粉。然后加入杂交缓冲液、融合基因探针库混合，在PCR仪中95℃孵育30秒，65℃杂交16-18小时。100ng of the prepared cDNA library was mixed with

Universal Blockers-TS Mix and Human Cot-1 DNA were mixed and dried to dry powder using a vacuum filtration system (60°C). Then add hybridization buffer, mix the fusion gene probe library, incubate at 95°C for 30 seconds in a PCR machine, and hybridize at 65°C for 16-18 hours.

M-270Streptavidin beads混合，在PCR仪上进行65℃孵育45min，期间每间隔15min进行重新混匀。筛选所有含融合基因的转录序列片段。Combine the above system with streptavidin magnetic beads

Mix M-270 Streptavidin beads and incubate at 65°C for 45min on a PCR machine, and remix at 15min intervals. Screen all transcribed sequence fragments containing the fusion gene.

The above was hybridized using KAPA HiFi HotStart ReadyMix, primers paired with the sequences of linkers P5, P7 (P5: 5'-AATGATACGGCGACCACCGA-3', SEQ ID NO: 1; P7: 5'-CAAGCAGAAGACGGCATACGAGAT-3', SEQ ID NO: 2) The captured cDNA library was amplified in a PCR machine. The target cDNA library was purified by AMPure XP Beads to obtain the library to be sequenced.

11) Illumina platform sequencing

Libraries to be sequenced were sequenced using a Novaseq 6000 high-throughput sequencer with an average sequencing depth of 5000x. See the manufacturer's instructions for sequencing procedures.

12) Sequencing data analysis

A. Sequencing data preprocessing

Use bcl2fastq software to convert raw data to obtain raw fastq files, and use fastqc software to evaluate the quality of rawfastq data, and use Trimmomatic software to eliminate low-quality reads to obtain clean fastq files.

B. Identification of fusion genes

All reads were aligned with the human transcriptome and genome using BOWTIE, STAR, and SPOTLIGHT software, and reads matching transcripts of both genes were screened. False positive events were then eliminated by a series of criteria, such as paralog, pseudogene, Body Map 2.0, gene distance, etc. If the reads matching two genes at the same time exceed the set threshold, it is considered that the two genes have undergone gene fusion.

C. Examples of Fusion Gene Detection Data Analysis Results

Using the present invention, we detected 3 leukemia samples and obtained the following results:

The three samples all have fusion genes involved in MLL (KMT2A), and only the probe targeting the transcript sequence of the MLL gene can capture the breakpoint sequences of the MLL gene and its partner gene at the same time, so as to identify them through alignment analysis. The specific fusion form was calculated, and fusionFPKM was calculated as an indicator of its expression.

The results are shown in Table 1 below.

Table 1

The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity, all possible combinations of the technical features in the above-described embodiments are not described. However, as long as there is no contradiction between the combinations of these technical features, All should be regarded as the scope described in this specification.

The above-mentioned embodiments only represent several embodiments of the present invention, and the descriptions thereof are specific and detailed, but should not be construed as a limitation on the scope of the invention patent. It should be pointed out that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can also be made, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention should be subject to the appended claims.

sequence listing

<110> Guangzhou Jinyu Medical Laboratory Group Co., Ltd.

<120> Gene fusion variant library construction method, detection method, apparatus, equipment and storage medium

<140> 2019114192739

<141> 2019-12-31

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 1

aatgatacgg cgaccaccga 20

<210> 2

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 2

caagcagaag acggcatacg agat 24

<210> 3

<211> 38

<212> DNA

<213> Artificial Sequence

<400> 3

gatctacact ctttccctac acgacgctct tccgatct 38

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 4

gttcgtcttc tgccgtatgc tcta 24

<210> 5

<211> 86

<212> DNA

<213> Artificial Sequence

<400> 5

tccccgccca agtatccctg taaaacaaaa accaaaagaa aagtctgaac aacccagtcc 60

tgccagctcc agctccagct ccagct 86

<210> 6

<211> 86

<212> DNA

<213> Artificial Sequence

<400> 6

tccccgccca agtatccctg taaaacaaaa accaaaagaa aaggaaatga cccattcatg 60

gccgcctcct ttgacagcaa tacata 86

<210> 7

<211> 86

<212> DNA

<213> Artificial Sequence

<400> 7

aattccagca gatggagtcc acaggatcag agtggacttt aaggattctg tttcactgag 60

gccatctatc cgatttcaag gaagcc 86

Claims (16)

1. a gene fusion variation library construction method, is characterized in that, comprises the steps: Extract the total RNA of the sample and remove the rRNA; Reverse transcription of the total RNA after removing the rRNA to synthesize double-stranded cDNA, and use dUTP instead of dTTP to synthesize the second strand of the double-stranded cDNA; performing end repair on the synthesized double-stranded cDNA and adding a ligation linker; Enzymatic digestion and digestion of the dUTP in the double-stranded DNA after end repair and addition of the ligation linker, so that the double-stranded cDNA is nicked; Amplify the double-stranded DNA after digestion and digestion to construct a cDNA pre-library; Use a fusion gene capture probe to hybridize and capture the target fusion cDNA in the cDNA pre-library, the target fusion cDNA is composed of fusion of at least two different genes, and the fusion gene capture probe contains a cDNA capable of being fused with the target The sequence of the complementary pairing of the sequences of one of the genes; Amplify the captured target fusion cDNA to obtain the gene fusion variant library. 2. gene fusion variation library construction method as claimed in claim 1, is characterized in that, the design principle of described fusion gene capture probe is as follows: (1) The fusion gene capture probe is designed for the core gene in the target fusion cDNA, and the core gene refers to a gene that has multiple gene partners and is prone to fusion mutation, or is in the cell growth or proliferation signaling pathway. key genes, or driver genes; (2) the fusion gene capture probe is designed for the transcript sequence of the core gene; (3) The fusion gene capture probe is designed for the core gene in the hg19 reference genome, and the coverage density is 2 × tiling sequences; (4) the length of the fusion gene capture probe is 120bp; (5) The fusion gene capture probe needs to be compared to the human transcriptome sequence during design, and the number of all Blast matches is counted. If the number of Blast matches is not greater than 50, it is qualified. If the number of Blast matches is greater than 50, then Redesign by replacing mismatched bases until the highest match to the target gene sequence is obtained and the number of Blast matches is not more than 50. 3. the gene fusion variation library construction method as claimed in claim 1 or 2, is characterized in that, the 5 ' end of described fusion gene capture probe is marked with the linker that is used for capturing; Optionally, the linker is biotin or streptavidin. 4. The method for constructing a gene fusion variant library according to claim 1 or 2, wherein the total RNA of the sample is the total RNA of peripheral blood or bone marrow samples. 5. The gene fusion variant library construction method of claim 1 or 2, wherein the end repair is to add a dATP at the 3' end of the synthesized double-stranded cDNA; The linker format introduced by the added linker is P5-Real1primer-DNAINSERT-IndexReadprimer-index-P7, specifically: 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T-DNA fragment sequence to be tested-GTTCGTCTTCTGCCGTATGCTCTA-index-CACTGACCTCAAGTCTGCACACGAGAAGGCTAG-P, wherein P5 and P7 is the linker, Real1primer and IndexReadprimer are the primer sequences, DNAINSERT is the sequence of the DNA fragment to be tested, index is the unique sample tag of 12nt, and p is the phosphate group. 6. The method for constructing a gene fusion variant library according to claim 5, wherein the double-stranded DNA after the digestion and digestion of the amplifying enzyme and the target fusion cDNA captured are amplified using the same method as a linker. Amplification was performed with primers paired with P5 and P7 sequences. 7. a gene fusion mutation detection method, is characterized in that, comprises the steps: Obtain the sequencing data of the gene fusion variant library, the gene fusion variant library is an amplification library of the target fusion gene obtained by hybridizing and capturing the transcription sequence of the sample to be tested by the fusion gene capture probe, and the target fusion gene is composed of at least one. Composed of two different genes fused, the fusion gene capture probe contains a sequence capable of complementary pairing with the sequence of one of the target fusion genes; Comparing the sequencing data with human transcriptome and genome data, and screening reads that can match at least two genes at the same time; It is analyzed whether the reads that can match at least two genes at the same time meet the preset threshold requirements, and if so, it means that a plurality of genes included in the reads have undergone gene fusion. 8. gene fusion mutation detection method as claimed in claim 7, is characterized in that, in described by described sequencing data and human transcriptome and genome data are compared, screening can be matched to the reads of at least two genes at the same time. The steps also include: The quality of the sequencing data is evaluated, and low-quality reads are eliminated to obtain clean sequencing data. 9. gene fusion mutation detection method as claimed in claim 8, is characterized in that, described eliminating low-quality reads comprises: Remove reads containing linker sequences; Remove reads with low-quality bases with a quality value below 15 accounting for ≧50%; Reads containing more than 1% of N were removed. 10. The method for detecting gene fusion variation according to claim 9, further comprising: after comparing the sequencing data with human transcriptome and genome data, rejecting the clean sequencing data according to a preset control standard steps in false positive events; Specifically, annotate the gene fusion mutation events obtained by screening, remove the false and preserve the true, and eliminate the gene fusion mutation events that meet the following criteria: The different genes of the fusion gene are paralogous to each other; The different genes of the fusion gene are pseudogenes; The gene fusion variant has been detected in normal healthy people. 11. gene fusion mutation detection method as claimed in claim 10, is characterized in that, described preset threshold requirement refers to: if this fusion gene mutation has clinical significance, then matches to the unique spanning reads of these two genes simultaneously More than 3; if the fusion gene variant is of unknown clinical significance, the unique spanning reads that match the two genes at the same time exceed 10. 12. The gene fusion mutation detection method according to any one of claims 7 to 11, characterized in that, further comprising: Calculate the mutation ratio of the fusion gene according to the following formula:

in,

The fusion supporting read pairs refers to the number of read pairs supporting the gene fusion; Described #mappable reads refers to the number of reads of the genome in comparison; The weighted-average of Insertsize-read length refers to the weighted average length of the cDNA fragments inserted into the library; The refgeneFPKM is the normalized expression value of the internal reference gene; The FPKM is defined as Reads Per Kilobase of exon model per Million mapped reads, that is, the number of reads aligned to every 1K bases of an exon in every 1 million aligned reads. 13. A gene fusion mutation detection device, characterized in that, comprising: The sequencing data acquisition module is used to obtain the sequencing data of the gene fusion variant library. The gene fusion variant library is an amplification library of the target fusion gene obtained by hybridizing and capturing the transcription sequence of the sample to be tested by using the fusion gene capture probe. The target fusion gene is composed of fusion of at least two different genes, and the fusion gene capture probe contains a sequence capable of complementary pairing with the sequence of one of the target fusion genes; an alignment screening module for aligning the sequencing data with human transcriptome and genome data, and screening reads that can match at least two genes at the same time; and The fusion analysis module is used to analyze whether the reads that can match at least two genes at the same time meet the preset threshold requirements. 14. The gene fusion mutation detection device of claim 13, further comprising: The variation ratio calculation module is used to calculate the variation ratio of the fusion gene according to the following formula:

in,

The fusion supporting read pairs refers to the number of read pairs supporting the gene fusion; Described #mappable reads refers to the number of reads of the genome in comparison; The weighted-average of Insertsize-read length refers to the weighted average length of the inserted cDNA fragments in the library; The refgeneFPKM is the normalized expression value of the internal reference gene; The FPKM is defined as Reads Per Kilobase of exon model per Million mapped reads, that is, the number of reads aligned to every 1K bases of an exon in every 1 million aligned reads. 15. A computer device, comprising a processor and a memory, wherein the memory stores a computer program, and the processor implements the gene according to any one of claims 7 to 12 when the processor executes the computer program Steps of a fusion variant detection method. 16. A computer storage medium on which a computer program is stored, characterized in that, when the computer program is executed, the steps of the gene fusion mutation detection method according to any one of claims 7 to 12 are implemented.

Images