CN106645344B - A kind of preparation method and applications of deoxynivalenol electrochemical sensor - Google Patents
A kind of preparation method and applications of deoxynivalenol electrochemical sensor Download PDFInfo
- Publication number
- CN106645344B CN106645344B CN201610980546.7A CN201610980546A CN106645344B CN 106645344 B CN106645344 B CN 106645344B CN 201610980546 A CN201610980546 A CN 201610980546A CN 106645344 B CN106645344 B CN 106645344B
- Authority
- CN
- China
- Prior art keywords
- deoxynivalenol
- solution
- don
- electrode
- gold electrode
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
- G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
- G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Electrochemistry (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of preparation method and applications of deoxynivalenol electrochemical sensor.The present invention prepares deoxynivalenol electrochemical sensor gold electrode surfaces are self-assembled modified using amino carbon quantum dot deoxynivalenol nucleic acid aptamer, and trace deoxynivalenol in the samples such as application sensor detection beer.The present invention modifies one layer of amino carbon quantum dot DON aptamer compound using self-assembly method in gold electrode surfaces, sensor is set both to have had the excellent electrochemical properties of carbon quantum dot and signal amplification characteristic, high specific with aptamer again, the deoxynivalenol electrochemical sensor of the present invention has the advantages that quick, sensitive, high specificity, the method of detection DON contents may be directly applied to the assay of the deoxynivalenol in beer, malt beverage, simple and quick；And the preparation of deoxynivalenol electrochemical sensor is easy, of low cost.
Description
Technical field
The present invention relates to electrochemical nano bio-sensing and field of biological detection, specifically, providing a kind of amino-carbon
Deoxynivalenol bacterium alkene of the quantum dot-deoxynivalenol nucleic acid aptamer in the self-assembled modified preparation of gold electrode surfaces
The preparation method and applications of alcohol electrochemical sensor.
Background technology
Deoxynivalenol (deoxynivalenol, DON), also known as vomitoxin are that a kind of single-ended spore of Type B is mould
Aliphatic compound is mainly generated by Fusarium graminearum and Fusarlum roseum, is distributed in the cereal seed such as wheat, barley, corn more
In；Food is processed by the cereal seed of DON pollutions with these, DON also enters in cereal product therewith, causes food pollution.
DON is the most wide mould contamination toxin of distribution on global, especially in China, the U.S., South Africa, Argentina and Japan.DON is
A kind of severe toxicity or moderately toxic biotoxin, can cause the acute poisonings symptom such as vomiting, diarrhea, fever, with anaemia, immune suppression
System, Keshan disease are associated；Also there are close ties with the cancer of the esophagus, gastric cancer.Such as China Lin County, Ci County, in flour and corn
DON recall rates are respectively 53.8% and 100%, and (range is 384~9686ng/ to DON average contents in Lin County sample (corn)
G), the DON average contents in Ci County corn and flour are respectively 7959ng/g and 1032ng/g, and Lin County, Ci County are also China's stomach
The malignant tumours such as cancer, cancer of the esophagus district occurred frequently.As people's living standard is continuously improved, produced for main Raw material processing with barley and wheat
Beer, malt beverage consumption figure and crowd constantly increase, DON can be transferred to from natural contamination barley and wheat by malt
In malt beverage and beer.Therefore, the content monitoring of DON is of great significance to health of people life in these beverages.At present
The method of detection DON mainly has chromatography, enzyme linked immunological etc..Chromatography requires height to operating technology, and testing cost is higher, is immunized
The deficiencies of method is needed using biochemical reagents such as enzyme, the antibody of price costly, and these biochemical reagents are easy to inactivation；It is enzyme-linked
Immunization is simple, quickly, but the preparation processes such as DON needed for the method is efficient, special monoclonal antibody are complicated, and easily false positive etc. occurs and ask
Topic；102559686 A of Chinese invention CN disclose a kind of deoxynivalenol nucleic acid aptamer and the inspection applied to DON
It surveys, the method that Chinese invention 201610132667.6 discloses detection fungi deoxynivalenol, these methods are all
Based on DON aptamer Fluorometric assay deoxynivalenols.Optical analysis is that instrument is set with electrochemical methods
Standby simple, quickly and effectively analysis method, but fluorescence method is easily interfered by endogenous material fluorescence.Electrochemical method is to measure electricity
Chemical signal, therefore do not interfered by endogenous material fluorescence, moreover, electrochemistry, which also has, is easy to automation, intelligent and networking
The advantages of.
Invention content
For deficiency existing for existing detection technique, the present invention provides a kind of simple, quick, sensitive, high specifics
The deoxynivalenol electrochemical sensor that can detect ultra trace deoxynivalenol preparation method and
It is applied.
Carbon quantum dot has that environmental-friendly, preparation process is simple, raw material sources are extensive, especially a large amount of carbon containing renewable to have
Machine obsolete material may serve to prepare carbon quantum dot, can turn waste into wealth.What is more important, carbon quantum dot have unusual
Photoelectric characteristic, high catalytic activity and excellent biocompatibility, and easily carry out amino, carboxyl, the functionalization such as sulfydryl, it is non-
Often it is suitble to prepare the photochemistry with excellent properties, electrochemica biological compound, is very suitable for structure electrochemical biosensor and grinds
Study carefully platform.Thus amino-carbon quanta point biological compound modified electrode has in chemical analysis and bioanalysis and widely answers
With.
Aptamer (Aptamer) is a kind of novel identification molecule.Compared with monoclonal antibody, molecular weight is relatively low,
There is no immunogenicity and toxicity, can be by chemical synthesis preparation, structure of modification and label, chemical stability is good, can be reversible
Denaturation and renaturation can storage and transport, aptamer be at normal temperatures with SELEX technologies, and the process by repeating selection is chemically closed
At random oligonucleotide library in screening obtain, theoretically any molecule can find its corresponding aptamer, due to nucleic acid
The high specific of aptamer can prepare highly selective chemical biosensor part, realize the highly selective inspection of target molecule/substance
It surveys.
Self-assembled film technology is the ordered molecular that bioactive molecule is formed by chemical bond Spontaneous adsorption by biphase interface
Assembly system can be designed by people's the set goal on a molecular scale.Self-assembled film can pass through by being pre-designed
Accurate Chemical Control builds the self assembly sensing membrane of specific structure and function in electrode surface, in chemistry and bio-sensing
Have the advantages that notable with fields such as molecular recognitions and is widely applied foreground.
Amino carbon quantum dot and DON Aptamer by way of self assembly, amino carbon amounts are built in electrode by the present invention
Sub- point-DON Aptamer composite membranes；Using the electrical properties and enlarging function that carbon quantum dot is excellent, the Gao Te of DON aptamers
The opposite sex prepares highly selective, highly sensitive DON electrochemica biological sensors；In aptamer fluorescence sense, often exist interior
The background fluorescence of source property substance interferes；And in electrochemical sensing detection, what it is due to acquisition is electric signal, then can be efficiently against
The interference of endogenous material (fluorescence signal), electrochemical aptamer bio-sensing have higher detection sensitivity and specificity.
Therefore, the respective advantage of the two can have been given full play to, has enhanced the detectability to DON, and given full play to self-assembling technique
Advantage has been made with highly sensitive and high specific DON electrochemica biological sensors.
The technical scheme is that：
A kind of preparation method of deoxynivalenol electrochemical sensor, deoxynivalenol electrochemistry
Sensor includes (commodity) gold electrode, and is passed in the gold surface self assembly amino carbon quantum dot-DON aptamers of gold electrode
Film is felt, by modifying one layer of amino carbon quantum dot-DON aptamer self assemblies sensing film preparation in gold electrode substrate surface
At specifically comprising the following steps：
(1) gold electrode pre-processes, and is first passed through successively as 1.0 μm, 0.3 μm, 0.05 μm of Al with grain2O3Powder carries out gold electrode
Polishing, polishing, are then sequentially placed into HNO by gold electrode3It is cleaned by ultrasonic in HCl solution, secondary deionized water, ethyl alcohol, then
Gold electrode is placed in the H of 0.5mol/L2SO4Electrochemical cleaning processing is carried out in solution, obtains the gold electrode of any surface finish；
(2) pretreated gold electrode is placed in mercaptopropylamine-acetum that pH is 5.0, a concentration of 10mmol/L, room
The lower self assembly of temperature is taken out after 24 hours, is rinsed well with secondary deionized water；
(3) step (2) the electrode obtained is immersed in the glutaraldehyde water solution that mass fraction is 5%, is taken out after 24 hours, used
Secondary deionized water is rinsed well；
(4) by gold electrode intrusion 10mg/mL amino-carbon quantum dot solutions obtained by step (3), at room temperature self assembly 3~
It 7 hours, takes out, is rinsed well repeatedly with secondary deionized water；
(5) gold electrode obtained by step (4) is immersed in the sodium borohydride aqueous solution of 5mmol/L 1 hour, is then taken out, electricity
It is rinsed well repeatedly with secondary deionized water pole；
(6) gold electrode obtained by step (5) is immersed in the glutaraldehyde water solution that mass fraction is 5%, is taken out after 24 hours,
It is rinsed well with redistilled water；
(7) gold electrode obtained by step (6) is immersed to the amination deoxynivalenol nucleic acid aptamer water of 1 μm of ol/L
In solution, hatch 12-24 hours at room temperature, takes out, rinsed well with redistilled water；
(8) gold electrode obtained by step (7) is immersed in the sodium borohydride aqueous solution of 5mmol/L 1 hour, is taken out, then with two
Secondary deionized water is rinsed well repeatedly, obtains deoxynivalenol electrochemical sensor.
Further, the amination deoxynivalenol nucleic acid aptamer is 5 '-H2N-
AAAAAGCATCACTACAGTCATTACGCATCGTAGGG GGGATCGTTA AGGA AGTGCC CGGAGGCGGT
ATCGTGTGAA GTGCT-3’。
Further, 1 μm of ol/L amination deoxynivalenol nucleic acid aptamer solution refers to, a concentration of
The Tris-HCl solution of 1 μm of ol/L amination deoxynivalenol nucleic acid aptamers -0.05mol/L, pH=5.0, and pass through
It is heated to 95 DEG C in water-bath and is kept for 5 minutes, then and is rapidly cooled to the solution of room temperature.
Further, the HNO3In HCl solution, HNO3, HCl volume ratio be 3:1.
The application for the deoxynivalenol electrochemical sensor that above-mentioned preparation method obtains, which is characterized in that with
Deoxynivalenol electrochemical sensor is working electrode, is measured to DON in solution, its step are as follows：
(A) 1.646 grams of potassium ferricyanides, 2.212 grams of potassium ferrocyanides and 7.45 grams of potassium chloride are placed in 1000mL volumetric flasks
In, it is dissolved with the disodium hydrogen phosphate of a concentration of 10m mol/LpH 7.4-potassium dihydrogen phosphate (abbreviation PBS), then, then to capacity
The PBS solution of the pH7.4 of a concentration of 10m mol/L is continuously added in bottle to 800~850mL, is shaken up, then again with 10m mol/
The PBS solution of the pH7.4 of L is diluted to scale, shakes up to get 5.0mmol/L Fe (CN)6 3-/Fe(CN)6 4-Probe solution, will
It sets that shady place is closed to be saved backup；
(B) pH=7.4 is added in DON to be measured, in the Tris-HCl buffer solutions of a concentration of 0.05mol/L, is configured to DON
Normal concentration serial solution；
(C) deoxynivalenol electrochemical sensor is immersed to step (B) prepared DON standards respectively successively
In concentration series solution, after forty minutes, takes out, fully rinsed with secondary deionized water, obtain DON- aptamer sensors；
(D) probe solution 10mL prepared by step (A) is taken to be placed in electrolytic cell, with DON- aptamers obtained by step (C)
Sensor is working electrode, and saturated calomel electrode is reference electrode, and platinum electrode is auxiliary electrode, is placed in the probe solution of electrolytic cell
In, carry out electrochemical AC impedance RetTest, and establish impedance value RetWith the concentration relationship formula of DON.
In the range of the DON μ of a concentration of 9ng/L~10 g/L, with measured AC impedance RetIn good linear relationship,
Linear relation is Ret(K Ω)=12.21+18.06 × log (CDON/ μ g/L), detection is limited to 3ng/L.
It during DON is measured in actual sample beer and malt beverage, first takes these beverages appropriate, is removed wherein with ultrasonic method
Carbon dioxide and foam, then take the beer for eliminating carbon dioxide and foam or malt beverage pH=7.4 a concentration of
The Tris-HCl buffer solutions of 0.05mol/L are diluted to scale, obtain actual sample solution；By deoxynivalenol electricity
Chemical sensor immerses in 2ml actual sample solution, takes out after forty minutes, after fully rinsing sensor with secondary deionized water,
It is transferred in 10ml probe solutions, measures RetValue, according to DON concentration and RetThe relationship of value, DON in determination sample.
The beneficial effects of the present invention are：
The present invention modifies one layer of amino carbon quantum dot-DON aptamer compound using self-assembly method in gold electrode surfaces,
Sensor is set not only to have had the excellent electrochemical properties of carbon quantum dot and signal amplification characteristic, but also the high specific with aptamer,
The deoxynivalenol electrochemical sensor of the present invention has the advantages that quick, sensitive, high specificity, detection DON contain
The method of amount may be directly applied to the assay of the deoxynivalenol in beer, malt beverage, and method is simple, passes through
It helps, quickly；Moreover, the preparation of deoxynivalenol electrochemical sensor is easy, of low cost.
Description of the drawings
Fig. 1 is the sensitive membrane structure diagram of deoxynivalenol electrochemical sensor of the present invention.
Specific implementation mode
The present invention is further elaborated with reference to specific embodiment.It is tellable to be, the list in following embodiment
Position M indicates mol/L.
Embodiment 1
The preparation method of deoxynivalenol electrochemical sensor is：
(1) carries out gold electrode pretreatment, first passes through the Al for μm, μm, μm with grain successively2O3Powder polishes to gold electrode,
Polishing, is then sequentially placed into HNO by gold electrode3- HCl (volume ratios 3:1) surpassed in solution, secondary deionized water, ethyl alcohol
Sound cleans, then gold electrode is placed in the H of 1M2SO4Electrochemical cleaning processing is carried out in solution, obtains the bright and clean gold electricity of substrate surface
Pole；
(2) aminations deoxynivalenol nucleic acid aptamer solution pre-processes, by a concentration of 1 μM of amination deoxidation
Nivalenol aptamer -0.05M Tris-HCl (pH 5.0) solution, is placed in water-bath and is heated to 95 DEG C, and 95
It is kept for 5 minutes at DEG C, is then immediately placed in ice-water bath and is rapidly cooled to room temperature, for use, follow-up 1 μM of amination used is de-
Oxygen nivalenol aptamer solution is the solution.
(3) pretreated gold electrode is placed in 10mM mercaptopropylamines-acetum of pH=5.0 by, self assembly at room temperature
It takes out after 24 hours, is rinsed well with a large amount of redistilled waters；
(4) electrode for preparing (3) immerses in 5% glutaraldehyde water solution, takes out after 24 hours, rushed with redistilled water
Wash clean；
(5) immerses (4) obtained gold electrode in 10mg/mL amino-carbon quantum dot solutions, at room temperature self assembly 3
Hour, it takes out, is rinsed well repeatedly with secondary deionized water；
(6) immerses (5) obtained gold electrode in 5mM sodium borohydride aqueous solutions 1 hour, then takes out, and electrode is with two
Secondary deionized water is rinsed well repeatedly；
(7) (6) obtained gold electrode is immersed in 5% glutaraldehyde water solution, is taken out after 24 hours by, with it is secondary go from
Sub- water is rinsed well；
(8) (7) obtained gold electrode is immersed 1 μM of amination deoxynivalenol nucleic acid aptamer aqueous solution by
In, hatch 24 hours at room temperature, takes out, rinsed well with redistilled water；
(9) then takes out 3 hours in (8) obtained gold electrode 25mM ethylene glycol amine aqueous solutions, and electrode is with secondary
Deionized water is rinsed well repeatedly；
(10) immerses (9) obtained gold electrode in 5mM sodium borohydride aqueous solutions 1 hour, takes out, then with secondary
Deionized water is rinsed well repeatedly, obtains deoxynivalenol electrochemical sensor.
Embodiment 2
(1) carries out gold electrode pretreatment, first passes through the Al for μm, μm, μm with grain successively2O3Powder polishes to gold electrode,
Polishing, is then sequentially placed into HNO by gold electrode3- HCl (volume ratios 3:1) surpassed in solution, secondary deionized water, ethyl alcohol
Sound cleans, then gold electrode is placed in the H of 1M2SO4Electrochemical cleaning processing is carried out in solution, obtains the bright and clean gold electricity of substrate surface
Pole；
(2) aminations deoxynivalenol nucleic acid aptamer solution pre-processes, by a concentration of 1 μM of amination deoxidation
Nivalenol aptamer -0.05M Tris-HCl (pH 5.0) solution, is placed in water-bath and is heated to 95 DEG C, and 95
It is kept for 5 minutes at DEG C, is then immediately placed in ice-water bath and is rapidly cooled to room temperature, for use, follow-up 1 μM of amination used is de-
Oxygen nivalenol aptamer solution is the solution.
(3) will be placed in 10mM mercaptopropylamines-acetum of pH=5.0 through (1) pretreated clean gold electrode
In, self assembly at room temperature is taken out after 24 hours, is rinsed well with redistilled water；
(4) electrode for preparing (3) immerses in 5% glutaraldehyde water solution, takes out after 24 hours, rushed with redistilled water
Wash clean；
(5) immerses (4) obtained gold electrode in 10mg/mL amino-carbon quantum dot solutions, at room temperature self assembly 5
Hour, it [takes out, is rinsed well repeatedly with secondary deionized water；
(6) immerses (5) obtained gold electrode in 5mM sodium borohydride aqueous solutions 1 hour, then takes out, and electrode is with two
Secondary deionized water is rinsed well repeatedly；
(7) (6) obtained gold electrode is immersed in 5% glutaraldehyde water solution, is taken out after 12 hours by, with it is secondary go from
Sub- water is rinsed well；
(8) 1 μM of amination deoxynivalenol nucleic acid for preparing (7) obtained gold electrode intrusion (2) is suitable
In body aqueous solution, hatch 12 hours at room temperature, takes out, rinsed well with secondary deionized water；
(9) immerses (8) obtained gold electrode in 5mM sodium borohydride aqueous solutions 1 hour, then takes out, and electrode is with two
Secondary deionized water is rinsed well repeatedly, obtains deoxynivalenol electrochemical sensor.
Embodiment 3
(1) carries out gold electrode pretreatment, first passes through the Al for μm, μm, μm with grain successively2O3Powder polishes to gold electrode,
Polishing, is then sequentially placed into HNO by gold electrode3- HCl (volume ratios 3:1) surpassed in solution, secondary deionized water, ethyl alcohol
Sound cleans, then gold electrode is placed in the H of 1M2SO4Electrochemical cleaning processing is carried out in solution, obtains the bright and clean gold electricity of substrate surface
Pole；
(2) aminations deoxynivalenol nucleic acid aptamer solution pre-processes, by a concentration of 1 μM of amination deoxidation
Nivalenol aptamer -0.05M Tris-HCl (pH 5.0) solution, is placed in water-bath and is heated to 95 DEG C, and 95
It is kept for 5 minutes at DEG C, is then immediately placed in ice-water bath and is rapidly cooled to room temperature, for use, follow-up 1 μM of amination used is de-
Oxygen nivalenol aptamer solution is the solution.
(3) gold electrode through (1) pretreated cleaning is placed in 10mM mercaptopropylamines-acetum of pH=5.0 by,
Self assembly is taken out after 24 hours at room temperature, is rinsed well with redistilled water；
(4) electrode for preparing (3) immerses in 5% glutaraldehyde water solution, takes out after 24 hours, rushed with redistilled water
Wash clean；
(5) immerses (4) obtained gold electrode in 10mg/mL amino-carbon quantum dot solutions, at room temperature self assembly 7
Hour, it takes out, is rinsed well repeatedly with secondary deionized water；
(6) immerses (5) obtained gold electrode in 5mM sodium borohydride aqueous solutions 1 hour, then takes out, and electrode is with two
Secondary deionized water is rinsed well repeatedly；
(7) (6) obtained gold electrode is immersed in 5% glutaraldehyde water solution, is taken out after 18 hours, use second distillation by
Water is rinsed well；
(8) (7) obtained gold electrode is immersed the 1 μM of amination deoxynivalenol nucleic acid prepared by (2) by
In aptamer aqueous solution, hatch 24 hours at room temperature, takes out, rinsed well with secondary deionized water；
(9) immerses (8) obtained gold electrode in 25mM ethylene glycol amine aqueous solutions 3 hours, then takes out, and electrode is used
Secondary deionized water is rinsed well repeatedly；
(10) immerses (9) obtained gold electrode in 5mM sodium borohydride aqueous solutions 1 hour, then takes out, and electrode is used
Secondary deionized water is rinsed well repeatedly, obtains deoxynivalenol electrochemical sensor.
Embodiment 4
(1) 1.646 grams of potassium ferricyanides, 2.212 grams of potassium ferrocyanides and 7.45 grams of potassium chloride are set in the preparation of probe solutions
In 1000mL volumetric flasks, dissolved with disodium hydrogen phosphate-potassium dihydrogen phosphate (PBS) of a concentration of 10m mol/LpH 7.4, so
Afterwards, then into volumetric flask the PBS solution (about to 800mL) of the pH7.4 of a concentration of 10m mol/L is added, shakes up, then again with
The PBS solution of the pH7.4 of 10m mol/L is diluted to scale, shakes up to get 5.0mmol/L Fe (CN)6 3-/Fe(CN)6 4-Probe
Solution, is set that shady place is closed to be saved backup.
(2) .DON standard solution is prepared, and is accurately weighed 1.0mg DON standard substances and is placed in 2ml small beakers, with a small amount of pH
=7.4, a concentration of 0.1M Tris-HCl buffer solutions dissolve, in the 100ml volumetric flasks being quantitatively transferred to, with above-mentioned Tris-
HCl buffer solution constant volumes, shake up, and obtain the DON standard solution of a concentration of 10 μ g/ml；It is spare to be placed in dark place；Take 13 25ml clean
Net volumetric flask, number is A1, A2, A3, A4, A5, A6, A7, A8, A9, A10, A11, A12, A13 respectively, configuration DON concentration according to
It is secondary for 50ng/ml, 25ng/ml, 10ng/ml, 5ng/ml, 1ng/ml, 0.50ng/ml, 0.1ng/ml, 0.05ng/ml,
The standard system of 0.01ng/ml, 0.009ng/ml, 0.005ng/mL, 0.001ng/mL and sample blank Tris-HCl buffer solutions
Row, the DON standard serial solutions are diluted with DON standard solution with Tris-HCl buffer solutions.
(3) immerses deoxynivalenol electrochemical sensor in 2ml (2) prepared standard serial solution,
It takes out, is rinsed well with a large amount of secondary deionized waters after forty minutes.
(4) takes the probe solution 10ml prepared by (1) to be placed in electrolytic cell, to pass through (2) processed deoxynivalenol
Bacterium enol electrochemical sensor is working electrode, using saturated calomel electrode as reference electrode, using platinum electrode as auxiliary electrode, by work
Make electrode, reference electrode and auxiliary electrode to be placed in electrolytic cell, measures AC impedance Rct, the concentration of DON is in the μ of 9ng/L~10
G/L ranges, with RctIt is linear, linear equation Ret(K Ω)=12.21+18.06 × log (CDON/ μ g/L), detection limit
For 3ng/L.
Embodiment 5
Beer sample deoxynivalenol determination of recovery rates
(1) beer sample is handled：Certain brand beer sample 1 is bought from certain supermarket, and background DON values are 38.5 μ g/L, are measured
30ml beer samples are placed in 100ml beakers, are deaerated with ultrasonic echography spare to no carbon dioxide bubble and foam；Embodiment
Beer used brand beer in 4；The test solution of deoxynivalenol determination of recovery rates is matched with the beer in beer
It sets.
(2) test solution of deoxynivalenol determination of recovery rates configures in beer：20 10ml volumetric flasks are taken, respectively
Number is A1, A2, A3, A4, A5, B1, B2, B3, B4, B5, C1, C2, C3, C4, C5, D1, D2, D3, D4 and D5；Accurate measuring claims
Take 300 5 parts of μ l beer samples, be respectively placed in number be A1, A2, A3, A4, A5 volumetric flask in, then again to number be A1,
The DON standard solution that 1.0ml concentration is 10 μ g/L is separately added into A2, A3, A4, A5 volumetric flask；150 μ l beers of accurate measuring again
5 parts of wine sample is respectively placed in the volumetric flask that number is B1, B2, B3, B4, B5, to number is again then B1, B2, B3, B4, B5
The DON standard solution that 300 μ l concentration are 10 μ g/L is separately added into volumetric flask；30 5 parts of μ l beer samples of accurate measuring again, point
Be not placed in number be C1, C2, C3, C4, C5 volumetric flask in, then again to number be in C1, C2, C3, C4, C5 volumetric flask respectively
The DON standard solution that 50 μ l concentration are 10 μ g/L is added；35 parts of μ l beer samples of accurate measuring again, being respectively placed in number is
To number it is again then that 50 μ l are separately added into D1, D2, D3, D4 and D5 volumetric flask is dense in the volumetric flask of D1, D2, D3, D4, D5
Degree is the DON standard solution of 1 μ g/L；Again respectively to A1, A2, A3, A4, A5, B1, B2, B3, B4, B5, C1, C2, C3, C4,
It is 7.4 that pH, which is added, in C5, D1, D2, D3, D4 and D5, and the phosphate buffer solution 5ml of a concentration of 0.1mol/L shakes up, then be with pH
7.4, the phosphate buffer solution of a concentration of 0.1mol/L is diluted to scale, shake up to get to DON in beer sample the rate of recovery
The sample solution of measurement, it is spare.
(3) probe solution configures：1.646 grams of potassium ferricyanides, 2.212 grams of potassium ferrocyanides and 7.45 grams of potassium chloride are placed in
In 1000mL volumetric flasks, dissolved with disodium hydrogen phosphate-potassium dihydrogen phosphate (PBS) of a concentration of 10m mol/LpH 7.4, then,
The PBS solution (about to 800mL) of the pH7.4 of a concentration of 10m mol/L is added into volumetric flask again, shakes up, then again with 10m
The PBS solution of the pH7.4 of mol/L is diluted to scale, shakes up to get 5.0mmol/L Fe (CN)6 3-/Fe(CN)6 4-Probe solution,
It is In Shade spare；Separately 10ml probe solutions is taken to be placed in electrolytic cell, for measuring AC impedance.
(4) DON determination of recovery rates in beer sample：Deoxynivalenol electrochemistry prepared by embodiment 2 passes
Sensor is placed in the sample solution for the DON determination of recovery rates that 2ml is immersed by (2), is taken out after forty minutes, sensor with it is secondary go from
Sub- water is rinsed well, then by deoxynivalenol electrochemical sensor (working electrode), saturated calomel electrode (reference
Electrode) and platinum electrode (auxiliary electrode) be placed in the probe solution of electrolytic cell progress AC impedance measurement；It is rotten according to deoxidation snow
The content of reaping hook enol and the relationship of AC impedance, find out the amount of DON, and the rate of recovery for measuring DON accordingly respectively is
97.5%, 95.8%, 96.7%, 103.6%, 94.5%；95.6%, 98.6%；109.3%, 97.6%, 104.8%；
98.4,99.2%, 102.7%, 107.3%, 104.4%；101.5%, 98.4%, 96.3%, 93.2% and 95.7%；More than
Statistics indicate that the rate of recovery is held at higher level, the method for this explanation present invention is detected DON contents, accurately
Rate is high.
Embodiment 6
Deoxynivalenol measures in beer.
(1) beer sample is handled：From certain supermarket buy six kinds of different brands beer, respectively by these beer be denoted as A,
B, C, D, E and F；The beer sample 10ml for taking A, B, C, D, E and F respectively, is placed in 50ml beakers, with ultrasonic echography to without two
Carbonoxide bubble and foam are for use.
(2) prepared by beer test solution：18 10ml volumetric flasks are taken, number is A1, A2, A3 respectively；B1、B2、B3；C1、C2、
C3；D1、D2、D3；E1、E2、E3；F1, F2 and F3；100 3 parts of μ l A beer samples of accurate measuring, be respectively placed in number be A1,
In the volumetric flask of A2, A3,100 3 parts of μ l B beer samples of accurate measuring are respectively placed in the volumetric flask that number is B1, B2, B3,
100 3 parts of μ l C beer samples of accurate measuring are respectively placed in the volumetric flask that number is C1, C2, C3,100 μ l D beers of accurate measuring
3 parts of wine sample is respectively placed in the volumetric flask that number is D1, D2, D3, then 100 3 parts of μ l F beer samples of accurate measuring, respectively
Be placed in number be F1, F2 and F3 volumetric flask in, then to number be A1, A2, A3, B1, B2, B3, C1, C2, C3, D1, D2,
D3、E1、E2、E3；PH=4.7, a concentration of 0.1mol/L phosphate buffer solutions 5ml are separately added into F1, F2 and F3 volumetric flask
It shakes up, then pH=4.7 is added to each volumetric flask, a concentration of 0.1mol/L phosphate buffer solutions shake up to scale, obtain beer
Wine sample solution, for use.
(3) probe solution configures：1.646 grams of potassium ferricyanides, 2.212 grams of potassium ferrocyanides and 7.45 grams of potassium chloride are placed in
In 1000mL volumetric flasks, dissolved with disodium hydrogen phosphate-potassium dihydrogen phosphate (PBS) of a concentration of 10m mol/LpH 7.4, then,
The PBS solution (about to 800mL) of the pH7.4 of a concentration of 10m mol/L is added into volumetric flask again, shakes up, then again with 10m
The PBS solution of the pH7.4 of mol/L is diluted to scale, shakes up to get 5.0mmol/L Fe (CN)6 3-/Fe(CN)6 4-Probe solution,
It is In Shade spare；Separately 10ml probe solutions is taken to be placed in electrolytic cell, for measuring AC impedance.
(4) in beer DON measurement：Deoxynivalenol electrochemical sensor prepared by embodiment 2 is placed in
It in beer sample solutions of the 2ml by (2) immersion, takes out after forty minutes, sensor is rinsed well with secondary deionized water, then will
Deoxynivalenol electrochemical sensor (working electrode), saturated calomel electrode (reference electrode) and platinum electrode (auxiliary
Electrode) it is placed in progress AC impedance measurement in the probe solution of electrolytic cell；Content according to deoxynivalenol enol and friendship
The relationship of flow impedance, finds out the amount of DON, measures the content of DON in A, B, C, D, E and F different brands beer accordingly respectively with order
For 2.65 μ g/L, 2.74 μ g/L, 2.86 μ g/L；36.8μg/L、37.5μg/L、36.2μg/L；1.16μg/L、1.28μg/L、
1.31μg/L；35.5ng/L、40.6ng/L、38.2ng/L；11.5ng/L、11.8ng/L、12.1ng/L；19.6ng/L、
20.9ng/L and 21.1ng/L.
SEQUENCE LISTING
<110>University Of Science and Technology Of Hunan
<120>A kind of preparation method and applications of deoxynivalenol electrochemical sensor
<130> 20161108
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 81
<212> DNA
<213>Artificial sequence
<400> 1
maaaaagcat cactacagtc attacgcatc gtagggggga tcgttaagga agtgcccgga 60
ggcggtatcg tgtgaagtgc t 81
Claims (6)
1. a kind of preparation method of deoxynivalenol electrochemical sensor, which is characterized in that deoxynivalenol bacterium
Enol electrochemical sensor includes gold electrode, and suitable in the gold surface self assembly amino carbon quantum dot-DON nucleic acid of gold electrode
Body sensing membrane, by modifying one layer of amino carbon quantum dot-DON aptamer self assembly sensing membrane system in gold electrode substrate surface
It is standby to form, specifically comprise the following steps：
(1) gold electrode pre-processes, and is first passed through successively as 1.0 μm, 0.3 μm, 0.05 μm of Al with grain2O3Powder polishes to gold electrode,
Polishing, is then sequentially placed into HNO by gold electrode3It is cleaned by ultrasonic in HCl solution, secondary deionized water, ethyl alcohol, then will be golden
Electrode is placed in the H of 0.5mol/L2SO4Electrochemical cleaning processing is carried out in solution, obtains the gold electrode of any surface finish；
(2) pretreated gold electrode is placed in mercaptopropylamine-acetum that pH is 5.0, a concentration of 10mmol/L, at room temperature
Self assembly is taken out after 24 hours, is rinsed well with secondary deionized water；
(3) step (2) the electrode obtained is immersed in the glutaraldehyde water solution that mass fraction is 5%, is taken out after 24 hours, use is secondary
Deionized water is rinsed well；
(4) gold electrode obtained by step (3) is immersed in 10mg/mL amino-carbon quantum dot solutions, self assembly 3~7 is small at room temperature
When, it takes out, is rinsed well repeatedly with secondary deionized water；
(5) gold electrode obtained by step (4) is immersed in the sodium borohydride aqueous solution of 5mmol/L 1 hour, is then taken out, electrode is used
Secondary deionized water is rinsed well repeatedly；
(6) gold electrode obtained by step (5) is immersed in the glutaraldehyde water solution that mass fraction is 5%, is taken out after 24 hours, with two
Secondary distilled water flushing is clean；
(7) gold electrode obtained by step (6) is immersed to the amination deoxynivalenol nucleic acid aptamer aqueous solution of 1 μm of ol/L
In, hatch 12-24 hours at room temperature, takes out, rinsed well with redistilled water；
(8) gold electrode obtained by step (7) is immersed in the sodium borohydride aqueous solution of 5mmol/L 1 hour, is taken out, then gone with secondary
Ionized water is rinsed well repeatedly, obtains deoxynivalenol electrochemical sensor.
2. the preparation method of deoxynivalenol electrochemical sensor according to claim 1, which is characterized in that
The amination deoxynivalenol nucleic acid aptamer is 5 '-H2N-
AAAAAGCATCACTACAGTCATTACGCATCGTAGGG GGGATCGTTA AGGAAGTGCC CGGAGGCGGT
ATCGTGTGAA GTGCT-3’。
3. the preparation method of deoxynivalenol electrochemical sensor according to claim 1, which is characterized in that
1 μm of ol/L amination deoxynivalenol nucleic acid aptamer solution refers to a concentration of 1 μm of ol/L amination deoxidations
The Tris-HCl solution of nivalenol aptamer -0.05mol/L, pH=5.0, and through being heated to 95 DEG C in water-bath simultaneously
It is kept for 5 minutes, then and is rapidly cooled to the solution of room temperature.
4. the preparation method of deoxynivalenol electrochemical sensor according to claim 1, which is characterized in that
The HNO3In HCl solution, HNO3, HCl volume ratio be 3:1.
5. the deoxynivalenol electrochemical sensor that Claims 1-4 any one of them preparation method obtains
Using, which is characterized in that using deoxynivalenol electrochemical sensor as working electrode, DON in solution is surveyed
Fixed, its step are as follows：
(A) 1.646 grams of potassium ferricyanides, 2.212 grams of potassium ferrocyanides and 7.45 grams of potassium chloride are placed in 1000mL volumetric flasks, are used
The dissolving of disodium hydrogen phosphate-potassium dihydrogen phosphate of a concentration of 10m mol/LpH 7.4, that is, PBS, then continuously add into volumetric flask dense
The PBS solution for the pH7.4 for being 10m mol/L is spent to 800~850mL, is shaken up, then again with the PBS of the pH7.4 of 10m mol/L
Solution is diluted to scale, shakes up to get 5.0mmol/L Fe (CN)6 3-/Fe(CN)6 4-It is closed to be set shady place for probe solution
It saves backup；
(B) pH=7.4 is added in the sample to be tested containing DON, in the Tris-HCl buffer solutions of a concentration of 0.05mol/L, prepared
At the sample solution of series concentration；
(C) deoxynivalenol electrochemical sensor is immersed to step (B) prepared series concentration respectively successively
In sample solution, after forty minutes, takes out, fully rinsed with secondary deionized water, obtain DON- aptamer sensors；
(D) it takes probe solution 10mL prepared by step (A) to be placed in electrolytic cell, is sensed with DON- aptamers obtained by step (C)
Device is working electrode, and saturated calomel electrode is reference electrode, and platinum electrode is auxiliary electrode, is placed in the probe solution of electrolytic cell,
Carry out electrochemical AC impedance RetTest, and establish impedance value RetWith the concentration relationship formula of DON, the DON for obtaining sample to be tested is dense
Degree.
6. the application of deoxynivalenol electrochemical sensor according to claim 5, which is characterized in that described
Sample solution the deoxynivalenol μ g/L of a concentration of 3ng/L~15, pH value of solution=7.4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610980546.7A CN106645344B (en) | 2016-11-08 | 2016-11-08 | A kind of preparation method and applications of deoxynivalenol electrochemical sensor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610980546.7A CN106645344B (en) | 2016-11-08 | 2016-11-08 | A kind of preparation method and applications of deoxynivalenol electrochemical sensor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106645344A CN106645344A (en) | 2017-05-10 |
| CN106645344B true CN106645344B (en) | 2018-07-17 |
Family
ID=58806121
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610980546.7A Active CN106645344B (en) | 2016-11-08 | 2016-11-08 | A kind of preparation method and applications of deoxynivalenol electrochemical sensor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106645344B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107807034A (en) * | 2017-10-31 | 2018-03-16 | 北京农业质量标准与检测技术研究中心 | A kind of vomitoxin aptamer affinity column and preparation method and application |
| CN110923238A (en) * | 2019-11-26 | 2020-03-27 | 昆明理工大学 | Aptamer specifically bound with vomitoxin, preparation method and application |
| CN111487300B (en) | 2020-04-01 | 2021-06-25 | 江南大学 | Cell electrochemical sensor based on 3D printing technology and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102559686A (en) * | 2011-11-25 | 2012-07-11 | 国家纳米技术与工程研究院 | Deoxynivalenol nucleic acid aptamer and application thereof |
| CN104258596A (en) * | 2014-09-25 | 2015-01-07 | 上海市农业科学院 | Solid-phase extraction column for enriching and purifying deoxidized nivalenol |
| CN105695473A (en) * | 2016-03-09 | 2016-06-22 | 湖南科技大学 | Detection method of fungaltoxin DON (deoxynivalenol) and detection kit |
| CN105911123A (en) * | 2016-06-30 | 2016-08-31 | 重庆医科大学 | Electrochemical detection method for vomitoxin |
-
2016
- 2016-11-08 CN CN201610980546.7A patent/CN106645344B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102559686A (en) * | 2011-11-25 | 2012-07-11 | 国家纳米技术与工程研究院 | Deoxynivalenol nucleic acid aptamer and application thereof |
| CN104258596A (en) * | 2014-09-25 | 2015-01-07 | 上海市农业科学院 | Solid-phase extraction column for enriching and purifying deoxidized nivalenol |
| CN105695473A (en) * | 2016-03-09 | 2016-06-22 | 湖南科技大学 | Detection method of fungaltoxin DON (deoxynivalenol) and detection kit |
| CN105911123A (en) * | 2016-06-30 | 2016-08-31 | 重庆医科大学 | Electrochemical detection method for vomitoxin |
Non-Patent Citations (1)
| Title |
|---|
| Highly sensitive deoxynivalenol immunosensor based on a glassy carbon electrode modified with a fullerene/ferrocene/ionic liquid composite;Wei Zhilei et al.;《Microchim Acta》;20101123;第172卷;第365-371页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106645344A (en) | 2017-05-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bagheryan et al. | Diazonium-based impedimetric aptasensor for the rapid label-free detection of Salmonella typhimurium in food sample | |
| Daly et al. | Development of surface plasmon resonance-based immunoassay for aflatoxin B1 | |
| Zamfir et al. | Highly sensitive label-free immunosensor for ochratoxin A based on functionalized magnetic nanoparticles and EIS/SPR detection | |
| Ocaña et al. | A novel electrochemical aptamer–antibody sandwich assay for lysozyme detection | |
| Niazi et al. | A novel bioassay based on aptamer-functionalized magnetic nanoparticle for the detection of zearalenone using time resolved-fluorescence NaYF4: Ce/Tb nanoparticles as signal probe | |
| CN108169303B (en) | Aptamer electrochemical sensor based on metal-organic framework material as signal probe | |
| Tolba et al. | A bacteriophage endolysin-based electrochemical impedance biosensor for the rapid detection of Listeria cells | |
| Zheng et al. | Simultaneous and ultrasensitive detection of foodborne bacteria by gold nanoparticles-amplified microcantilever array biosensor | |
| Tsai et al. | Development of a piezoelectric immunosensor for the detection of alpha-fetoprotein | |
| Li et al. | Electrochemical aptasensor for the determination of cocaine incorporating gold nanoparticles modification | |
| CN106645344B (en) | A kind of preparation method and applications of deoxynivalenol electrochemical sensor | |
| Subjakova et al. | Advances in electrochemical aptasensors and immunosensors for detection of bacterial pathogens in food | |
| Yan et al. | A label-free immunosensor for detecting common acute lymphoblastic leukemia antigen (CD10) based on gold nanoparticles by quartz crystal microbalance | |
| Khan et al. | Advanced biosensors for health care applications | |
| Liang et al. | Electrochemiluminescence resonance energy transfer between graphene quantum dots and graphene oxide for sensitive protein kinase activity and inhibitor sensing | |
| Crowley et al. | Increasing the sensitivity of Listeria monocytogenes assays: evaluation using ELISA and amperometric detection | |
| Tian et al. | Piezoelectric aptasensor with gold nanoparticle amplification for the label-free detection of okadaic acid | |
| Dou et al. | Voltammetric immunoassay for the detection of protein biomarkers | |
| CN112595764A (en) | Aptamer sensor based on pyramid-shaped nanostructure and detection method thereof | |
| Klass et al. | Covalent capture and electrochemical quantification of pathogenic E. coli | |
| CN110006971B (en) | Preparation method and application of aptamer sensor for detecting food-borne pathogenic bacteria through dual-channel output | |
| Cao et al. | An ultrasensitive biosensor for virulence ompA gene of Cronobacter sakazakii based on boron doped carbon quantum dots-AuNPs nanozyme and exonuclease III-assisted target-recycling strategy | |
| Tran et al. | Simple Label‐Free Electrochemical Immunosensor in a Microchamber for Detecting Newcastle Disease Virus | |
| Nodoushan et al. | Detection of Staphylococcal Enterotoxin A (SEA) using a sensitive nanomaterial-based electrochemical aptasensor | |
| CN111307907B (en) | Reproducible electrochemical sensor and method for detecting aflatoxin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |