CN106645344A - Preparation method and application of deoxynivalenol (DON) electrochemical sensor - Google Patents
Preparation method and application of deoxynivalenol (DON) electrochemical sensor Download PDFInfo
- Publication number
- CN106645344A CN106645344A CN201610980546.7A CN201610980546A CN106645344A CN 106645344 A CN106645344 A CN 106645344A CN 201610980546 A CN201610980546 A CN 201610980546A CN 106645344 A CN106645344 A CN 106645344A
- Authority
- CN
- China
- Prior art keywords
- don
- solution
- deoxynivalenol
- electrode
- gold electrode
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
- G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
- G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Electrochemistry (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a preparation method and application of a deoxynivalenol (DON) electrochemical sensor. The preparation method and the application disclosed by the invention are characterized in that an amino-carbon quantum dot-DON aptamer is adopted to carry out self-assembly modification on the surface of a gold electrode to obtain the DON electrochemical sensor; the DON electrochemical sensor is applied to detection of trace DON in samples such as beer. According to the preparation method and the application disclosed by the invention, the surface of the gold electrode is modified with one layer of amino-carbon quantum dot-DON aptamer complex by adopting a self-assembly method, so that not only does the sensor have excellent electrochemical characteristics and signal amplification characteristic of a carbon quantum dot, but also has high specificity of the aptamer. The DON electrochemical sensor disclosed by the invention has the advantages of quickness, sensitivity and high specificity; a method for detecting the content of the DON can be directly applied to determination of the content of the DON in beer and malt beverage and is simple and quick; in addition, the DON electrochemical sensor has the advantages of simplicity and convenience in preparation and low cost.
Description
Technical field
The present invention relates to electrochemical nano bio-sensing and field of biological detection, specifically, there is provided a kind of amino-carbon
Deoxynivalenol bacterium alkene of the quantum dot-deoxynivalenol nucleic acid aptamer in the self-assembled modified preparation of gold electrode surfaces
The preparation method and applications of alcohol electrochemical sensor.
Background technology
Deoxynivalenol (deoxynivalenol, DON), is that a kind of single-ended spore of Type B is mould also known as vomitoxin
Aliphatic compound, is mainly produced by Fusarium graminearum and Fusarlum roseum, is distributed in the cereal seed such as wheat, barley, corn more
In；Food is processed into by the cereal seed that DON pollutes with these, DON is also entered in cereal product therewith, causes food pollution.
DON is the most wide mould contamination toxin of distribution on global, especially in China, the U.S., South Africa, Argentina and Japan.DON is
A kind of hypertoxic or moderately toxic biotoxin, the acute poisoning symptom such as can cause to vomit, suffer from diarrhoea, have a fever, press down with anaemia, immunity
System, Keshan disease are associated；Also there are close ties with the cancer of the esophagus, cancer of the stomach.Such as China Lin County, Ci County, in flour and corn
DON recall rates are respectively 53.8% and 100%, and (scope is 384～9686ng/ to DON average contents in Lin County sample (corn)
G), the DON average contents in Ci County corn and flour are respectively 7959ng/g and 1032ng/g, and Lin County, Ci County are also China's stomach
The malignant tumour such as cancer, cancer of the esophagus district occurred frequently.As people's living standard is improved constantly, produce by main Raw material processing of barley and wheat
Beer, the consumption figure of malt beverage and crowd constantly increase, DON can be transferred to from natural contamination barley and wheat by malt
In malt beverage and beer.Therefore, the content monitoring of DON lives significant to health of people in these beverages.At present
The method of detection DON mainly has chromatography, enzyme linked immunological etc..Chromatography has high demands to operating technology, and testing cost is higher, immunity
Method needs to use the biochemical reagents such as price enzyme, antibody costly, and these biochemical reagents are easy to the deficiencies such as inactivation；It is enzyme-linked
Immunization is simple, quick, but the complicated process of preparation such as DON needed for the method efficient, special monoclonal antibody, and false positive etc. easily occurs and ask
Topic；The A of Chinese invention CN 102559686 disclose a kind of deoxynivalenol nucleic acid aptamer and are applied to the inspection of DON
Survey, the method that Chinese invention 201610132667.6 discloses detection fungi deoxynivalenol, these methods are all
Based on DON aptamer Fluorometric assay deoxynivalenols.Optical analysis are instrument and set with electrochemical methods
Standby simple, fast and effectively analysis method, but fluorescence method is easily disturbed by endogenous material fluorescence.Electrochemical method is to determine electricity
Chemical signal, therefore do not disturbed by endogenous material fluorescence, and, electrochemistry is also easy to automation, intelligent and networking
Advantage.
The content of the invention
For the deficiency that existing detection technique is present, the invention provides a kind of simple, quick, sensitive, high specific
The deoxynivalenol electrochemical sensor that can detect ultra trace deoxynivalenol preparation method and
Its application.
Carbon quantum dot has environmental friendliness, preparation process is simple, raw material sources extensively, and particularly a large amount of carbon containings are renewable to be had
Machine obsolete material, may serve to prepare carbon quantum dot, can turn waste into wealth.What is more important, carbon quantum dot has unusual
Photoelectric characteristic, high catalytic activity and excellent biocompatibility, and easily carry out the functionalization such as amino, carboxyl, sulfydryl, it is non-
Often it is adapted to prepare photochemistry, electrochemica biological compound with excellent properties, is especially suitable for structure electrochemical biosensor and grinds
Study carefully platform.Thus amino-carbon quanta point biological compound modified electrode has extensive answering in chemical analysis and bioanalysis
With.
Aptamer (Aptamer) is the new identification molecule of a class.Compared with monoclonal antibody, its molecular weight is relatively low,
Without immunogenicity and toxicity, can be good by chemical synthesis preparation, structure of modification and mark, chemical stability, can be reversible
Denaturation and renaturation, can storage and transport at normal temperatures, fit is, with SELEX technologies, chemically to be closed by repeating the process of selection
Into random oligonucleotide library in screening obtain, in theory any molecule can find that it is corresponding fit, due to nucleic acid
Fit high specific, can prepare high selectivity chemical biosensor part, realize the high selectivity inspection of target molecule/material
Survey.
Self-assembled film technology is the ordered molecular that bioactive molecule is formed by chemical bond Spontaneous adsorption on biphase interface
Assembly system, can be designed on a molecular scale by people's the set goal.Self-assembled film can pass through by being pre-designed
Accurate Chemical Control, in electrode surface the self assembly sensing membrane of specific structure and function is built, in chemistry and bio-sensing
There is significant advantage with the field such as molecular recognition and prospect is widely applied.
Amino carbon quantum dot and DON Aptamer by way of self assembly, in electrode amino carbon amounts are built by the present invention
Sub- point-DON Aptamer composite membranes；Using the excellent electrical properties of carbon quantum dot and enlarging function, the Gao Te of DON aptamers
The opposite sex prepares high selectivity, high-sensitive DON electrochemica biological sensors；In aptamer fluorescence sense, often exist interior
The background fluorescence interference of source property material；And in electrochemical sensing detection, due to collection is electric signal, then can be efficiently against
The interference of endogenous material (fluorescence signal), electrochemical aptamer bio-sensing has higher detection sensitivity and specificity.
Accordingly, it is capable to give full play to the two respective advantage, the detectability to DON is enhanced, and given full play to self-assembling technique
Advantage, has been obtained with high sensitivity and high specific DON electrochemica biological sensors.
The technical scheme is that：
A kind of preparation method of deoxynivalenol electrochemical sensor, deoxynivalenol electrochemistry
Sensor includes (commodity) gold electrode, and in the gold surface self assembly amino carbon quantum dot-DON aptamers biography of gold electrode
Sense film, its by gold electrode substrate surface modify one layer of amino carbon quantum dot-DON aptamers self assembly sense film preparation and
Into specifically including following steps：
(1) gold electrode pretreatment, first successively with grain Jing be 1.0 μm, 0.3 μm, 0.05 μm of Al2O3Powder is carried out to gold electrode
Polishing, polishing, are then sequentially placed into HNO by gold electrode3It is cleaned by ultrasonic in-HCl solution, secondary deionized water, ethanol, then
Gold electrode is placed in into the H of 0.5mol/L2SO4Electrochemical cleaning process is carried out in solution, the gold electrode of any surface finish is obtained；
(2) it is room in mercaptopropylamine-acetum that 5.0, concentration is 10mmol/L the gold electrode of pretreatment to be placed in into pH
The lower self assembly of temperature is taken out after 24 hours, is rinsed well with secondary deionized water；
(3) it is in 5% glutaraldehyde water solution, to take out after 24 hours by step (2) the electrode obtained immersion mass fraction, uses
Secondary deionized water is rinsed well；
(4) by step (3) gained gold electrode invade 10mg/mL amino-carbon quantum dot solutions in, at room temperature self assembly 3～
7 hours, take out, rinsed well repeatedly with secondary deionized water；
(5) by 1 hour in the sodium borohydride aqueous solution of step (4) gained gold electrode immersion 5mmol/L, then take out, electricity
Pole secondary deionized water is rinsed well repeatedly；
(6) it is in 5% glutaraldehyde water solution, to take out after 24 hours by step (5) gained gold electrode immersion mass fraction,
Rinsed well with redistilled water；
(7) step (6) gained gold electrode is immersed the amination deoxynivalenol nucleic acid aptamer water of 1 μm of ol/L
In solution, 12-24 hours are hatched at room temperature, taken out, rinsed well with redistilled water；
(8) by 1 hour in the sodium borohydride aqueous solution of step (7) gained gold electrode immersion 5mmol/L, take out, then with two
Secondary deionized water is rinsed well repeatedly, obtains deoxynivalenol electrochemical sensor.
Further, described amination deoxynivalenol nucleic acid aptamer is 5 '-H2N-
AAAAAGCATCACTACAGTCATTACGCATCGTAGGG GGGATCGTTA AGGA AGTGCC CGGAGGCGGT
ATCGTGTGAA GTGCT-3’。
Further, 1 μm of described ol/L amination deoxynivalenol nucleic acid aptamer solution refers to that concentration is
1 μm of ol/L amination deoxynivalenol nucleic acid aptamer -0.05mol/L, Tris-HCl solution of pH=5.0, and Jing
95 DEG C are heated in water-bath and are kept for 5 minutes, then and be rapidly cooled to the solution of room temperature.
Further, described HNO3In-HCl solution, HNO3, HCl volume ratio be 3:1.
The application of the deoxynivalenol electrochemical sensor that above-mentioned preparation method is obtained, it is characterised in that with
Deoxynivalenol electrochemical sensor is working electrode, and DON in solution is measured, and its step is as follows：
(A) 1.646 grams of potassium ferricyanides, 2.212 grams of potassium ferrocyanides and 7.45 grams of potassium chloride are placed in into 1000mL volumetric flasks
In, dissolved with disodium hydrogen phosphate-potassium dihydrogen phosphate (abbreviation PBS) that concentration is 10m mol/LpH 7.4, then, then to capacity
The PBS solution of the pH7.4 that concentration is 10m mol/L is continuously added in bottle to 800～850mL, is shaken up, then again with 10m mol/
The PBS solution of the pH7.4 of L is diluted to scale, shakes up, and obtains final product 5.0mmol/L Fe (CN)6 3-/Fe(CN)6 4-Probe solution, will
It is put, and shady place is closed to be saved backup；
(B) DON to be measured is added into pH=7.4, during concentration is for the Tris-HCl cushioning liquid of 0.05mol/L, is configured to DON
Normal concentration serial solution；
(C) deoxynivalenol electrochemical sensor is immersed respectively successively the DON standards that step (B) is prepared
In concentration series solution, after 40 minutes, take out, fully rinsed with secondary deionized water, obtain DON- aptamer sensors；
(D) the probe solution 10mL for taking step (A) preparation is placed in electrolytic cell, with step (C) gained DON- aptamers
Sensor is working electrode, and saturated calomel electrode is reference electrode, and platinum electrode is auxiliary electrode, is placed in the probe solution of electrolytic cell
In, carry out electrochemical AC impedance RetTest, and set up resistance value RetWith the concentration relationship formula of DON.
DON concentration is in the range of the μ g/L of 9ng/L～10, with measured AC impedance RetIn good linear relation,
Linear relation is Ret(K Ω)=12.21+18.06 × log (CDON/ μ g/L), detection is limited to 3ng/L.
During DON is determined in actual sample beer and malt beverage, these beverages are first taken in right amount, removed wherein with ultrasonic method
Carbon dioxide and foam, then take the beer that eliminates carbon dioxide and foam or malt beverage pH=7.4 concentration be
The Tris-HCl cushioning liquid of 0.05mol/L is diluted to scale, obtains actual sample solution；By deoxynivalenol electricity
In chemical sensor immersion 2ml actual sample solution, take out after 40 minutes, fully rinsed after sensor with secondary deionized water,
In proceeding to 10ml probe solutions, R is determinedetValue, according to DON concentration and RetThe relation of value, DON in determination sample.
The beneficial effects of the present invention is：
The present invention modifies one layer of amino carbon quantum dot-DON aptamer compound using self-assembly method in gold electrode surfaces,
Sensor is set both to have had the excellent electrochemical properties of carbon quantum dot and signal amplification characteristic, and the high specific with aptamer,
The deoxynivalenol electrochemical sensor of the present invention has the advantages that quick, sensitive, high specificity, and detection DON contains
The method of amount may be directly applied to the assay of the deoxynivalenol in beer, malt beverage, and method is simple, Jing
It is Ji, quick；And, preparing for deoxynivalenol electrochemical sensor is easy, with low cost.
Description of the drawings
Fig. 1 is the sensitive membrane structural representation of deoxynivalenol electrochemical sensor of the present invention.
Specific embodiment
The present invention is further elaborated with reference to specific embodiment.Tellable to be, in following examples list
Position M represents mol/L.
Embodiment 1
The preparation method of deoxynivalenol electrochemical sensor is：
(1). gold electrode pretreatment is carried out, first successively with the Al that grain Jing is μm, μm, μm2O3Powder polished gold electrode,
Polishing, is then sequentially placed into HNO by gold electrode3(volume ratio is 3 to-HCl:1) surpassed in solution, secondary deionized water, ethanol
Sound is cleaned, then gold electrode is placed in into the H of 1M2SO4Electrochemical cleaning process is carried out in solution, the bright and clean gold electricity of substrate surface is obtained
Pole；
(2). amination deoxynivalenol nucleic acid aptamer solution is pre-processed, and is 1 μM of amination deoxidation by concentration
Nivalenol aptamer -0.05M Tris-HCl (pH 5.0) solution, is placed in water-bath and is heated to 95 DEG C, and 95
Kept for 5 minutes at DEG C, be then immediately placed in ice-water bath and be rapidly cooled to room temperature, stand-by, follow-up 1 μM of amination used takes off
Oxygen nivalenol aptamer solution is the solution.
(3). the gold electrode of pretreatment is placed in the 10mM of pH=5.0 mercaptopropylamines-acetum, self assembly under room temperature
Take out after 24 hours, rinsed well with a large amount of redistilled waters；
(4). the electrode for preparing (3), in 5% glutaraldehyde water solution of immersion, take out after 24 hours, rushed with redistilled water
Wash clean；
(5). the gold electrode obtained by (4) is immersed in 10mg/mL amino-carbon quantum dot solutions, at room temperature self assembly 3
Hour, take out, rinsed well repeatedly with secondary deionized water；
(6). by 1 hour in the gold electrode immersion 5mM sodium borohydride aqueous solutions obtained by (5), then take out, electrode uses two
Secondary deionized water is rinsed well repeatedly；
(7). by the gold electrode obtained by (6), in 5% glutaraldehyde water solution of immersion, take out after 24 hours, with it is secondary go from
Sub- water is rinsed well；
(8). the gold electrode obtained by (7) is immersed into 1 μM of amination deoxynivalenol nucleic acid aptamer aqueous solution
In, hatch 24 hours at room temperature, take out, rinsed well with redistilled water；
(9). by 3 hours in the gold electrode 25mM ethylene glycol amine aqueous solution obtained by (8), then take out, electrode is with secondary
Deionized water is rinsed well repeatedly；
(10). by 1 hour in the gold electrode immersion 5mM sodium borohydride aqueous solutions obtained by (9), take out, then with secondary
Deionized water is rinsed well repeatedly, obtains deoxynivalenol electrochemical sensor.
Embodiment 2
(1). gold electrode pretreatment is carried out, first successively with the Al that grain Jing is μm, μm, μm2O3Powder polished gold electrode,
Polishing, is then sequentially placed into HNO by gold electrode3(volume ratio is 3 to-HCl:1) surpassed in solution, secondary deionized water, ethanol
Sound is cleaned, then gold electrode is placed in into the H of 1M2SO4Electrochemical cleaning process is carried out in solution, the bright and clean gold electricity of substrate surface is obtained
Pole；
(2). amination deoxynivalenol nucleic acid aptamer solution is pre-processed, and is 1 μM of amination deoxidation by concentration
Nivalenol aptamer -0.05M Tris-HCl (pH 5.0) solution, is placed in water-bath and is heated to 95 DEG C, and 95
Kept for 5 minutes at DEG C, be then immediately placed in ice-water bath and be rapidly cooled to room temperature, stand-by, follow-up 1 μM of amination used takes off
Oxygen nivalenol aptamer solution is the solution.
(3). the pretreated clean gold electrodes of Jing (1) are placed in into the 10mM mercaptopropylamines-acetum of pH=5.0
In, self assembly under room temperature is taken out after 24 hours, is rinsed well with redistilled water；
(4). the electrode for preparing (3), in 5% glutaraldehyde water solution of immersion, take out after 24 hours, rushed with redistilled water
Wash clean；
(5). the gold electrode obtained by (4) is immersed in 10mg/mL amino-carbon quantum dot solutions, at room temperature self assembly 5
Hour, [take out, rinsed well repeatedly with secondary deionized water；
(6). by 1 hour in the gold electrode immersion 5mM sodium borohydride aqueous solutions obtained by (5), then take out, electrode uses two
Secondary deionized water is rinsed well repeatedly；
(7). by the gold electrode obtained by (6), in 5% glutaraldehyde water solution of immersion, take out after 12 hours, with it is secondary go from
Sub- water is rinsed well；
(8). 1 μM of amination deoxynivalenol nucleic acid that the gold electrode obtained by (7) invades (2) preparation is fitted
In the body aqueous solution, hatch 12 hours at room temperature, take out, rinsed well with secondary deionized water；
(9). by 1 hour in the gold electrode immersion 5mM sodium borohydride aqueous solutions obtained by (8), then take out, electrode uses two
Secondary deionized water is rinsed well repeatedly, obtains deoxynivalenol electrochemical sensor.
Embodiment 3
(1). gold electrode pretreatment is carried out, first successively with the Al that grain Jing is μm, μm, μm2O3Powder polished gold electrode,
Polishing, is then sequentially placed into HNO by gold electrode3(volume ratio is 3 to-HCl:1) surpassed in solution, secondary deionized water, ethanol
Sound is cleaned, then gold electrode is placed in into the H of 1M2SO4Electrochemical cleaning process is carried out in solution, the bright and clean gold electricity of substrate surface is obtained
Pole；
(2). amination deoxynivalenol nucleic acid aptamer solution is pre-processed, and is 1 μM of amination deoxidation by concentration
Nivalenol aptamer -0.05M Tris-HCl (pH 5.0) solution, is placed in water-bath and is heated to 95 DEG C, and 95
Kept for 5 minutes at DEG C, be then immediately placed in ice-water bath and be rapidly cooled to room temperature, stand-by, follow-up 1 μM of amination used takes off
Oxygen nivalenol aptamer solution is the solution.
(3). the clean gold electrode that Jing (1) is pre-processed is placed in the 10mM of pH=5.0 mercaptopropylamines-acetum,
Self assembly under room temperature is taken out after 24 hours, is rinsed well with redistilled water；
(4). the electrode for preparing (3), in 5% glutaraldehyde water solution of immersion, take out after 24 hours, rushed with redistilled water
Wash clean；
(5). the gold electrode obtained by (4) is immersed in 10mg/mL amino-carbon quantum dot solutions, at room temperature self assembly 7
Hour, take out, rinsed well repeatedly with secondary deionized water；
(6). by 1 hour in the gold electrode immersion 5mM sodium borohydride aqueous solutions obtained by (5), then take out, electrode uses two
Secondary deionized water is rinsed well repeatedly；
(7). by the gold electrode obtained by (6), in 5% glutaraldehyde water solution of immersion, take out after 18 hours, use second distillation
Water is rinsed well；
(8). 1 μM of amination deoxynivalenol nucleic acid for preparing the gold electrode immersion obtained by (7) by (2)
In the fit aqueous solution, hatch 24 hours at room temperature, take out, rinsed well with secondary deionized water；
(9). by 3 hours in the gold electrode immersion 25mM ethylene glycol amine aqueous solution obtained by (8), then take out, electrode is used
Secondary deionized water is rinsed well repeatedly；
(10). by 1 hour in the gold electrode immersion 5mM sodium borohydride aqueous solutions obtained by (9), then take out, electrode is used
Secondary deionized water is rinsed well repeatedly, obtains deoxynivalenol electrochemical sensor.
Embodiment 4
(1). the preparation of probe solution puts in 1.646 grams of potassium ferricyanides, 2.212 grams of potassium ferrocyanides and 7.45 grams of potassium chloride
In 1000mL volumetric flasks, dissolved with disodium hydrogen phosphate-potassium dihydrogen phosphate (PBS) that concentration is 10m mol/LpH 7.4, so
Afterwards, add then in volumetric flask concentration for the PBS solution (about to 800mL) of the pH7.4 of 10m mol/L, shake up, then again with
The PBS solution of the pH7.4 of 10m mol/L is diluted to scale, shakes up, and obtains final product 5.0mmol/L Fe (CN)6 3-/Fe(CN)6 4-Visit
Pin solution, is put that shady place is closed to be saved backup.
(2) .DON standard liquids are prepared, and are accurately weighed 1.0mg DON standard substances and are placed in 2ml small beakers, use a small amount of pH
=7.4, concentration is the dissolving of 0.1M Tris-HCl cushioning liquid, in the 100ml volumetric flasks being quantitatively transferred to, uses above-mentioned Tris-
HCl cushioning liquid constant volumes, shake up, and obtain the DON standard liquids that concentration is 10 μ g/ml；It is placed in dark place standby；Take 13 25ml clean
Net volumetric flask, respectively numbering is A1, A2, A3, A4, A5, A6, A7, A8, A9, A10, A11, A12, A13, configuration DON concentration according to
It is secondary for 50ng/ml, 25ng/ml, 10ng/ml, 5ng/ml, 1ng/ml, 0.50ng/ml, 0.1ng/ml, 0.05ng/ml,
The standard system of 0.01ng/ml, 0.009ng/ml, 0.005ng/mL, 0.001ng/mL and sample blank Tris-HCl cushioning liquid
Row, the DON standard serial solutions with DON standard liquids with Tris-HCl cushioning liquid dilution form.
(3). deoxynivalenol electrochemical sensor is immersed in the standard serial solution that 2ml (2) is prepared,
Take out after 40 minutes, rinsed well with a large amount of secondary deionized waters.
(4). take the probe solution 10ml prepared by (1) and be placed in electrolytic cell, with the deoxynivalenol that Jing (2) was processed
Bacterium enol electrochemical sensor is working electrode, with saturated calomel electrode as reference electrode, with platinum electrode as auxiliary electrode, by work
Make electrode, reference electrode and auxiliary electrode to be placed in electrolytic cell, determine AC impedance Rct, the concentration of DON is in 9ng/L～10 μ
G/L scopes, with RctLinear, linear equation is Ret(K Ω)=12.21+18.06 × log (CDON/ μ g/L), test limit
For 3ng/L.
Embodiment 5
Beer sample deoxynivalenol determination of recovery rates
(1) beer sample is processed：Certain brand beer sample 1 is buied from certain supermarket, and background DON values are 38.5 μ g/L, are measured
30ml beer samples are placed in 100ml beakers, are deaerated to standby without carbon dioxide bubble and foam with ultrasonic echography；Embodiment
Beer used brand beer in 4；The test solution of deoxynivalenol determination of recovery rates is matched somebody with somebody with the beer in beer
Put.
(2) test solution of deoxynivalenol determination of recovery rates is configured in beer：20 10ml volumetric flasks are taken, respectively
Numbering is A1, A2, A3, A4, A5, B1, B2, B3, B4, B5, C1, C2, C3, C4, C5, D1, D2, D3, D4 and D5；Accurate measuring claims
Take 300 5 parts of μ l beer samples, be respectively placed in numbering be A1, A2, A3, A4, A5 volumetric flask in, then again to numbering be A1,
The DON standard liquids that 1.0ml concentration is 10 μ g/L are separately added in A2, A3, A4, A5 volumetric flask；μ l beers of accurate measuring 150 again
5 parts of wine sample, to numbering is again then B1, B2, B3, B4, B5 in being respectively placed in the volumetric flask that numbering is B1, B2, B3, B4, B5
The DON standard liquids that 300 μ l concentration are 10 μ g/L are separately added in volumetric flask；Again 5 parts of the μ l beer samples of accurate measuring 30, divide
In not being placed in the volumetric flask that numbering is C1, C2, C3, C4, C5, then again to numbering be in C1, C2, C3, C4, C5 volumetric flask respectively
50 μ l concentration are added to be the DON standard liquids of 10 μ g/L；5 parts of μ l beer samples of accurate measuring 3 again, being respectively placed in numbering is
To numbering it is again then that 50 μ l are separately added in D1, D2, D3, D4 and D5 volumetric flask is dense in the volumetric flask of D1, D2, D3, D4, D5
Degree is the DON standard liquids of 1 μ g/L；Again respectively to A1, A2, A3, A4, A5, B1, B2, B3, B4, B5, C1, C2, C3, C4,
It is 7.4 that C5, D1, D2, D3, D4 and D5 add pH, and concentration is the PBS 5ml of 0.1mol/L, shakes up, then is with pH
7.4, concentration is diluted to scale for the PBS of 0.1mol/L, shakes up, that is, obtain DON rate of recovery in beer sample
The sample solution of measure, it is standby.
(3) probe solution configuration：1.646 grams of potassium ferricyanides, 2.212 grams of potassium ferrocyanides and 7.45 grams of potassium chloride are placed in
In 1000mL volumetric flasks, dissolved with disodium hydrogen phosphate-potassium dihydrogen phosphate (PBS) that concentration is 10m mol/LpH 7.4, then,
Add concentration for the PBS solution (about to 800mL) of the pH7.4 of 10m mol/L in volumetric flask again, shake up, then again with 10m
The PBS solution of the pH7.4 of mol/L is diluted to scale, shakes up, and obtains final product 5.0mmol/L Fe (CN)6 3-/Fe(CN)6 4-Probe solution,
It is In Shade standby；Separately take 10ml probe solutions to be placed in electrolytic cell, for determining AC impedance.
(4) DON determination of recovery rates in beer sample：Deoxynivalenol electrochemistry prepared by embodiment 2 is passed
Sensor is placed in the sample solution of the DON determination of recovery rates that 2ml is immersed by (2), after 40 minutes take out, sensor with it is secondary go from
Sub- water is rinsed well, then by deoxynivalenol electrochemical sensor (working electrode), saturated calomel electrode (reference
Electrode) and platinum electrode (auxiliary electrode) be placed in the probe solution of electrolytic cell and carry out AC impedance measure；It is rotten according to deoxidation snow
The content of reaping hook enol and the relation of AC impedance, obtain the amount of DON, and the rate of recovery that DON is measured accordingly respectively is
97.5%th, 95.8%, 96.7%, 103.6%, 94.5%；95.6%th, 98.6%；109.3%th, 97.6%, 104.8%；
98.4th, 99.2%, 102.7%, 107.3%, 104.4%；101.5%th, 98.4%, 96.3%, 93.2% and 95.7%；More than
As shown by data, the rate of recovery is held at higher level, and this explanation is detected with the method for the present invention to DON contents, accurately
Rate is high.
Embodiment 6
Deoxynivalenol is determined in beer.
(1) beer sample is processed：From certain supermarket buy six kinds of different brands beer, respectively by these beer be designated as A,
B, C, D, E and F；The beer sample 10ml of A, B, C, D, E and F is taken respectively, in being placed in 50ml beakers, with ultrasonic echography to without two
Carbonoxide bubble and foam are stand-by.
(2) prepared by beer test solution：18 10ml volumetric flasks are taken, respectively numbering is A1, A2, A3；B1、B2、B3；C1、C2、
C3；D1、D2、D3；E1、E2、E3；F1, F2 and F3；3 parts of the μ l A beer samples of accurate measuring 100, be respectively placed in numbering be A1,
In the volumetric flask of A2, A3,3 parts of the μ l B beer samples of accurate measuring 100, in being respectively placed in the volumetric flask that numbering is B1, B2, B3,
3 parts of the μ l C beer samples of accurate measuring 100, in being respectively placed in the volumetric flask that numbering is C1, C2, C3, the μ l D beers of accurate measuring 100
3 parts of wine sample, in being respectively placed in the volumetric flask that numbering is D1, D2, D3, then 3 parts of the μ l F beer samples of accurate measuring 100, respectively
Be placed in numbering be F1, F2 and F3 volumetric flask in, then to numbering be A1, A2, A3, B1, B2, B3, C1, C2, C3, D1, D2,
D3、E1、E2、E3；PH=4.7 is separately added in F1, F2 and F3 volumetric flask, concentration is 0.1mol/L PBS 5ml
Shake up, then pH=4.7 is added to each volumetric flask, concentration is 0.1mol/L PBSs to scale, is shaken up, that is, beer is obtained
Wine sample solution, it is stand-by.
(3) probe solution configuration：1.646 grams of potassium ferricyanides, 2.212 grams of potassium ferrocyanides and 7.45 grams of potassium chloride are placed in
In 1000mL volumetric flasks, dissolved with disodium hydrogen phosphate-potassium dihydrogen phosphate (PBS) that concentration is 10m mol/LpH 7.4, then,
Add concentration for the PBS solution (about to 800mL) of the pH7.4 of 10m mol/L in volumetric flask again, shake up, then again with 10m
The PBS solution of the pH7.4 of mol/L is diluted to scale, shakes up, and obtains final product 5.0mmol/L Fe (CN)6 3-/Fe(CN)6 4-Probe solution,
It is In Shade standby；Separately take 10ml probe solutions to be placed in electrolytic cell, for determining AC impedance.
(4) in beer DON measure：Deoxynivalenol electrochemical sensor prepared by embodiment 2 is placed in
In beer sample solutions of the 2ml by (2) immersion, take out after 40 minutes, sensor is rinsed well with secondary deionized water, then will
Deoxynivalenol electrochemical sensor (working electrode), saturated calomel electrode (reference electrode) and platinum electrode (auxiliary
Electrode) it is placed in the probe solution of electrolytic cell and carries out AC impedance measure；Content and friendship according to deoxynivalenol enol
The relation of flow impedance, obtains the amount of DON, and the content of DON in A, B, C, D, E and F different brands beer is measured accordingly respectively with order
For 2.65 μ g/L, 2.74 μ g/L, 2.86 μ g/L；36.8μg/L、37.5μg/L、36.2μg/L；1.16μg/L、1.28μg/L、
1.31μg/L；35.5ng/L、40.6ng/L、38.2ng/L；11.5ng/L、11.8ng/L、12.1ng/L；19.6ng/L、
20.9ng/L and 21.1ng/L.
SEQUENCE LISTING
<110>University Of Science and Technology Of Hunan
<120>A kind of preparation method and applications of deoxynivalenol electrochemical sensor
<130> 20161108
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 81
<212> DNA
<213>Artificial sequence
<400> 1
maaaaagcat cactacagtc attacgcatc gtagggggga tcgttaagga agtgcccgga 60
ggcggtatcg tgtgaagtgc t 81
Claims (6)
1. a kind of preparation method of deoxynivalenol electrochemical sensor, it is characterised in that deoxynivalenol bacterium
Enol electrochemical sensor includes gold electrode, and suitable in the gold surface self assembly amino carbon quantum dot-DON nucleic acid of gold electrode
Body sensing membrane, it in gold electrode substrate surface by modifying one layer of amino carbon quantum dot-DON aptamer self assembly sensing membrane system
It is standby to form, specifically include following steps：
(1) gold electrode pretreatment, first successively with grain Jing be 1.0 μm, 0.3 μm, 0.05 μm of Al2O3Powder polished gold electrode,
Polishing, is then sequentially placed into HNO by gold electrode3It is cleaned by ultrasonic in-HCl solution, secondary deionized water, ethanol, then by gold
Electrode is placed in the H of 0.5mol/L2SO4Electrochemical cleaning process is carried out in solution, the gold electrode of any surface finish is obtained；
(2) it is in mercaptopropylamine-acetum that 5.0, concentration is 10mmol/L, under room temperature the gold electrode of pretreatment to be placed in into pH
Self assembly is taken out after 24 hours, is rinsed well with secondary deionized water；
(3) it is to take out after 24 hours in 5% glutaraldehyde water solution by step (2) the electrode obtained immersion mass fraction, with secondary
Deionized water rinsing is clean；
(4) step (3) gained gold electrode is invaded in 10mg/mL amino-carbon quantum dot solutions, at room temperature self assembly 3～7 is little
When, take out, rinsed well repeatedly with secondary deionized water；
(5) by 1 hour in the sodium borohydride aqueous solution of step (4) gained gold electrode immersion 5mmol/L, then take out, electrode is used
Secondary deionized water is rinsed well repeatedly；
(6) it is in 5% glutaraldehyde water solution, to take out after 24 hours by step (5) gained gold electrode immersion mass fraction, uses two
Secondary distilled water flushing is clean；
(7) step (6) gained gold electrode is immersed the amination deoxynivalenol nucleic acid aptamer aqueous solution of 1 μm of ol/L
In, 12-24 hours are hatched at room temperature, take out, rinsed well with redistilled water；
(8) by 1 hour in the sodium borohydride aqueous solution of step (7) gained gold electrode immersion 5mmol/L, take out, then gone with secondary
Ionized water is rinsed well repeatedly, obtains deoxynivalenol electrochemical sensor.
2. the preparation method of deoxynivalenol electrochemical sensor according to claim 1, it is characterised in that
Described amination deoxynivalenol nucleic acid aptamer is 5 '-H2N-AAAAAGCATCACTACAGTCATTACGCATCG
TAGGG GGGATCGTTA AGGAAGTGCC CGGAGGCGGT ATCGTGTGAA GTGCT-3’。
3. the preparation method of deoxynivalenol electrochemical sensor according to claim 1, it is characterised in that
1 μm of described ol/L amination deoxynivalenol nucleic acid aptamer solution refers to that concentration is 1 μm of ol/L amination deoxidation
The Tris-HCl solution of nivalenol aptamer -0.05mol/L, pH=5.0, and 95 DEG C are heated in Jing water-baths simultaneously
Kept for 5 minutes, then and be rapidly cooled to the solution of room temperature.
4. the preparation method of deoxynivalenol electrochemical sensor according to claim 1, it is characterised in that
Described HNO3In-HCl solution, HNO3, HCl volume ratio be 3:1.
5. the deoxynivalenol electrochemical sensor that the preparation method described in any one of Claims 1-4 is obtained
Using, it is characterised in that with deoxynivalenol electrochemical sensor as working electrode, DON in solution is surveyed
Fixed, its step is as follows：
(A) 1.646 grams of potassium ferricyanides, 2.212 grams of potassium ferrocyanides and 7.45 grams of potassium chloride are placed in 1000mL volumetric flasks, are used
Concentration is PBS dissolvings for the disodium hydrogen phosphate-potassium dihydrogen phosphate of 10m mol/LpH 7.4, then is continuously added in volumetric flask dense
The PBS solution of pH7.4 for 10m mol/L is spent to 800～850mL, shake up, then again with the PBS of the pH7.4 of 10m mol/L
Solution is diluted to scale, shakes up, and obtains final product 5.0mmol/L Fe (CN)6 3-/Fe(CN)6 4-Probe solution, is put shady place closed
Save backup；
(B) testing sample containing DON is added into pH=7.4, during concentration is for the Tris-HCl cushioning liquid of 0.05mol/L, is prepared
Into the sample solution of series concentration；
(C) deoxynivalenol electrochemical sensor is immersed respectively successively the series concentration that step (B) is prepared
In sample solution, after 40 minutes, take out, fully rinsed with secondary deionized water, obtain DON- aptamer sensors；
(D) the probe solution 10mL for taking step (A) preparation is placed in electrolytic cell, with step (C) gained DON- aptamer sensings
Device is working electrode, and saturated calomel electrode is reference electrode, and platinum electrode is auxiliary electrode, in being placed in the probe solution of electrolytic cell,
Carry out electrochemical AC impedance RetTest, and set up resistance value RetWith the concentration relationship formula of DON, the DON for obtaining testing sample is dense
Degree.
6. the application of deoxynivalenol electrochemical sensor according to claim 5, it is characterised in that described
Sample solution deoxynivalenol concentration be 3ng/L～15 μ g/L, pH value of solution=7.4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610980546.7A CN106645344B (en) | 2016-11-08 | 2016-11-08 | A kind of preparation method and applications of deoxynivalenol electrochemical sensor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610980546.7A CN106645344B (en) | 2016-11-08 | 2016-11-08 | A kind of preparation method and applications of deoxynivalenol electrochemical sensor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106645344A true CN106645344A (en) | 2017-05-10 |
| CN106645344B CN106645344B (en) | 2018-07-17 |
Family
ID=58806121
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610980546.7A Active CN106645344B (en) | 2016-11-08 | 2016-11-08 | A kind of preparation method and applications of deoxynivalenol electrochemical sensor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106645344B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107807034A (en) * | 2017-10-31 | 2018-03-16 | 北京农业质量标准与检测技术研究中心 | A kind of vomitoxin aptamer affinity column and preparation method and application |
| CN110923238A (en) * | 2019-11-26 | 2020-03-27 | 昆明理工大学 | Aptamer specifically bound with vomitoxin, preparation method and application |
| CN111487300A (en) * | 2020-04-01 | 2020-08-04 | 江南大学 | Cell electrochemical sensor based on 3D printing technology and application thereof |
| CN114935589A (en) * | 2022-03-29 | 2022-08-23 | 扬州大学 | Electrochemical immunosensor based on mimic enzyme and preparation method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102559686A (en) * | 2011-11-25 | 2012-07-11 | 国家纳米技术与工程研究院 | Deoxynivalenol nucleic acid aptamer and application thereof |
| CN104258596A (en) * | 2014-09-25 | 2015-01-07 | 上海市农业科学院 | Solid-phase extraction column for enriching and purifying deoxidized nivalenol |
| CN105695473A (en) * | 2016-03-09 | 2016-06-22 | 湖南科技大学 | Detection method of fungaltoxin DON (deoxynivalenol) and detection kit |
| CN105911123A (en) * | 2016-06-30 | 2016-08-31 | 重庆医科大学 | Electrochemical detection method for vomitoxin |
-
2016
- 2016-11-08 CN CN201610980546.7A patent/CN106645344B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102559686A (en) * | 2011-11-25 | 2012-07-11 | 国家纳米技术与工程研究院 | Deoxynivalenol nucleic acid aptamer and application thereof |
| CN104258596A (en) * | 2014-09-25 | 2015-01-07 | 上海市农业科学院 | Solid-phase extraction column for enriching and purifying deoxidized nivalenol |
| CN105695473A (en) * | 2016-03-09 | 2016-06-22 | 湖南科技大学 | Detection method of fungaltoxin DON (deoxynivalenol) and detection kit |
| CN105911123A (en) * | 2016-06-30 | 2016-08-31 | 重庆医科大学 | Electrochemical detection method for vomitoxin |
Non-Patent Citations (1)
| Title |
|---|
| WEI ZHILEI ET AL.: "Highly sensitive deoxynivalenol immunosensor based on a glassy carbon electrode modified with a fullerene/ferrocene/ionic liquid composite", 《MICROCHIM ACTA》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107807034A (en) * | 2017-10-31 | 2018-03-16 | 北京农业质量标准与检测技术研究中心 | A kind of vomitoxin aptamer affinity column and preparation method and application |
| CN110923238A (en) * | 2019-11-26 | 2020-03-27 | 昆明理工大学 | Aptamer specifically bound with vomitoxin, preparation method and application |
| CN111487300A (en) * | 2020-04-01 | 2020-08-04 | 江南大学 | Cell electrochemical sensor based on 3D printing technology and application thereof |
| CN111487300B (en) * | 2020-04-01 | 2021-06-25 | 江南大学 | Cell electrochemical sensor based on 3D printing technology and application thereof |
| US11279079B2 (en) | 2020-04-01 | 2022-03-22 | Jiangnan University | Cell electrochemical sensor based on 3D printing technology and application thereof |
| CN114935589A (en) * | 2022-03-29 | 2022-08-23 | 扬州大学 | Electrochemical immunosensor based on mimic enzyme and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106645344B (en) | 2018-07-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Habimana et al. | Minireview: trends in optical-based biosensors for point-of-care bacterial pathogen detection for food safety and clinical diagnostics | |
| Daly et al. | Development of surface plasmon resonance-based immunoassay for aflatoxin B1 | |
| Zamfir et al. | Highly sensitive label-free immunosensor for ochratoxin A based on functionalized magnetic nanoparticles and EIS/SPR detection | |
| CN106645344B (en) | A kind of preparation method and applications of deoxynivalenol electrochemical sensor | |
| Ocaña et al. | A novel electrochemical aptamer–antibody sandwich assay for lysozyme detection | |
| Akter et al. | Femtomolar detection of cardiac troponin I using a novel label-free and reagent-free dendrimer enhanced impedimetric immunosensor | |
| Ocaña et al. | Label free aptasensor for Lysozyme detection: A comparison of the analytical performance of two aptamers | |
| Li et al. | Electrochemical aptasensor for the determination of cocaine incorporating gold nanoparticles modification | |
| Tian et al. | Piezoelectric aptasensor with gold nanoparticle amplification for the label-free detection of okadaic acid | |
| Wang et al. | Surface plasmon resonance detection of small molecule using split aptamer fragments | |
| CN102288656B (en) | Sandwich-type electrochemical sensor for detecting ovarian SKOV-3 cancer cell | |
| Liang et al. | Electrochemiluminescence resonance energy transfer between graphene quantum dots and graphene oxide for sensitive protein kinase activity and inhibitor sensing | |
| CN113588752B (en) | Preparation method and application of electrochemiluminescence aptamer sensor | |
| Zhang et al. | Label-free electrochemical detection of tetracycline by an aptamer nano-biosensor | |
| De Rycke et al. | Recent advances in electrochemical monitoring of zearalenone in diverse matrices | |
| Foubert et al. | Antibody immobilization strategy for the development of a capacitive immunosensor detecting zearalenone | |
| Hedström et al. | Bioimprinting as a tool for the detection of aflatoxin B1 using a capacitive biosensor | |
| Ahmed et al. | Food biosensors | |
| Mao et al. | Accelerated and signal amplified nanozyme-based lateral flow assay of acetamiprid based on bivalent triple helix aptamer | |
| Dong et al. | A theophylline quartz crystal microbalance biosensor based on recognition of RNA aptamer and amplification of signal | |
| Casulli et al. | Electrochemical Assay for Extremely Selective Recognition of Fructose Based on 4‐Ferrocene‐Phenylboronic Acid Probe and β‐Cyclodextrins Supramolecular Complex | |
| Tran et al. | Simple Label‐Free Electrochemical Immunosensor in a Microchamber for Detecting Newcastle Disease Virus | |
| Lyu et al. | Microgravimetric lectin biosensor based on signal amplification using carbohydrate-stabilized gold nanoparticles | |
| Castillo et al. | Electrochemical and photometric detection of plasmin by specific peptide substrate | |
| Chaocharoen et al. | Electrochemical detection of the disease marker human chitinase-3-like protein 1 by matching antibody-modified gold electrodes as label-free immunosensors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |