CN106636463A - Influenza virus reverse transcription loop-mediated isothermal amplification (RT-LAMP) kit and application thereof - Google Patents
Influenza virus reverse transcription loop-mediated isothermal amplification (RT-LAMP) kit and application thereof Download PDFInfo
- Publication number
- CN106636463A CN106636463A CN201611115152.1A CN201611115152A CN106636463A CN 106636463 A CN106636463 A CN 106636463A CN 201611115152 A CN201611115152 A CN 201611115152A CN 106636463 A CN106636463 A CN 106636463A
- Authority
- CN
- China
- Prior art keywords
- influenza virus
- lamp
- detection
- reverse transcription
- isothermal amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention discloses an influenza virus reverse transcription loop-mediated isothermal amplification (RT-LAMP) kit and application thereof. The kit comprises a RT-LAMP primer, 2* reaction buffer solution, enzyme mixture EM, a fluorescence visual detection reagent, ultrapure water and an influenza virus RNA template, wherein the RT-LAMP primer comprises outer primers F3 and B3, and inner primers FIP and BIP. Specificity detection, sensitivity detection and fluorescence visible detection prove that the RT-LAMP detection method can specifically detect influenza virus, can be used for monitoring reactions in real time and quantitatively detecting the number of influenza virus copies so as to quickly and correctly acquire the detection result, and brings convenience to simple, quick and reliable influenza virus detection.
Description
Technical field
The present invention relates to technical field of microbial detection, particularly relates to a kind of quick, visualization and can determine in real time
The reverse transcription loop-mediated isothermal amplification kit of amount detection influenza virus and its application.
Background technology
Influenza virus can cause many animals such as people, fowl, pig, horse, bat to infect and fall ill, and be human influenza, bird flu, pig
The cause of disease of influenza, equine influenza et al. and animal epidemic.To external world resistance is not strong for influenza virus.Animal influenza virus is not generally felt
Dye people, human influenza virus's generally not infection animal, but pig compares exception, and pig can both infect human influenza virus, it is also possible to feel
Dye avian influenza virus, but the still swine influenza virus of their main infections.Minority animal influenza virus adapts to after people, to cause
Human influenza is very popular.Swine flu is a kind of acute, infectious respiratory disease, it is characterized by disease happens suddenly, hyperpyrexia, spirit is heavy
Strongly fragrant, appetite is useless exhausted, expiratory dyspnea, paroxysmal cough.Avian influenza virus（AIV）Category influenza A virus, causes one kind of bird
From respiratory system to the infectious disease of various symptoms such as severe total septicemia.Bird flu is easily popular between birds, and the past is in the people
Between be referred to as " checken pest ", International Office of Epizootics is set to category A infectious disease.Bird flu 1994,1997,1999 and 2003
Break out on Australia, Italy, Hong-Kong, Holland and other places respectively, then mainly break out in Southeast Asia and Europe within 2005.
In recent years, with the continuous expansion of intensive culture scale, influenza constitutes larger threat to aquaculture.This
Outward, highly pathogenic bird flu plays key effect between human influenza and bird flu, with great public health meaning,
Since reported first in 1918, influenza is constantly subjected to the extensive concern of people.
At present, the detection technique of influenza virus mainly has conventional method and molecular biology method.Conventional method is virus
Separation identification, accurately and reliably, but there is complex operation in general survey method to its result, need complicated instrument and equipment, required
The shortcoming of time length, is unfavorable for the quick diagnosis of influenza.The method of molecular biology is by reverse transcriptase polymerase chain reaction
（RT-PCR）Method detects the specific gene of influenza virus, although the more conventional method of RT-PCR method quick and precisely, but needs
Expensive instrument and equipment, it is relatively costly, need in result judgement into row agarose gel electrophoresis, easily cause laboratory pollution
Cause false positive results occur.
The content of the invention
It is an object of the invention to provide a kind of method for quick accurate and real-time detection influenza virus, there is provided a kind of
Quickly, visualization and can Real_time quantitative detection influenza virus reverse transcription loop-mediated isothermal amplification kit.To realize this
The technical scheme for being used of improving eyesight is：
A kind of influenza virus reverse transcription loop-mediated isothermal amplification kit, the kit includes that RT-LAMP primers, 2 × reaction are slow
Rush liquid, enzymatic mixture EM, fluorescence visual detection reagent, ultra-pure water and Influenza Virus RNA template, described RT-LAMP primer bags
Include outer primer F3 and B3, inner primer FIP and BIP；
The sequence of wherein primer is respectively：
F3 TCTGGAGGGGTGAAAATGGA
B3 GTGCAACTGATCCCCTCAG
FIP GCCCTCTGGGCAGCTGTTTGCGAAGGACAAGGGTTGCTTA
BIP AAGTCGAAACCCAGGAAACGCTAATGAGTGCTGACCGTGC；
2 described × reaction buffer includes Tris-HCL, KCL, MgSO4、(NH4)2SO4, Tween20, Betaine and
dNTPs。
Above-described Influenza Virus RNA template is the influenza for using virus genom DNA/RNA extracts kits to extract
Viral RNA.
Above-described fluorescence visual detection reagent adopts calcein fluorometric reagent, fluorometric reagent to add before the reaction.
Above-described 2 × reaction buffer includes Tris-HCL 35-50mM, KCL 15-35mM, MgSO4 15-
20mM、(NH4)2SO4 15-25mM, Tween20 0.4-0.8 ℅, Betaine 1.5-3.0M and dNTPs 2.5-4 mM, its
Above-mentioned solvent is well mixed acquisition by compound method under the conditions of pH is for 8.7.
A kind of application of influenza virus reverse transcription loop-mediated isothermal amplification kit, for detecting influenza virus and doubtful
Influenza pathological tissues whether influenza virus infection, concrete detecting step includes：
（1）The design of RT-LAMP primers and synthesis
（2）The extraction of Influenza Virus RNA template
（3）RT-LAMP reaction systems are set up
（4）RT-LAMP detection methods.
Above-described RT-LAMP reaction systems are set up in terms of 25 μ l,
The μ L of 2 × reaction buffer 12.5
EM 1 μL
FIP 40 pmol
BIP 40 pmol
F3 5 pmol
B3 5 pmol
The μ L of Influenza Virus RNA 5
Ultra-pure water supplies 25 μ L.
Above-described RT-LAMP detection methods are using the detection of specific detection, sensitivity Detection and fluorescent visual
Method.
Above-described RT-LAMP detection methods carry out closed whole prison using the real-time transmissometers of Loopamp LA-320C
Control, reaction temperature is 63 DEG C, reaction appearance amplification between 20-25 minutes.
The substantive distinguishing features of the present invention and significant progress are：
1）High specificity
The RT-LAMP detection method specific detections of the present invention go out influenza virus, and the negative control virus, negative right for being detected
No positive result is compareed according to mycoplasma and water out, it is consistent with RT-PCR testing results.And easy to operate, quick detected
As a result, without the need for instrument costly, conventional RT-PCR method need to first carry out reverse transcription（RT）, then entered as template with RT products again
Performing PCR reacts, and has used two response procedures, and RT-LAMP methods can complete two reaction intervals simultaneously in a reaction tube
Sequence a, hour can complete amplification.
2）Sensitivity is high
The Influenza Virus RNA original concentration of extraction is 6.8 ng/ μ L, and the test limit of conventional RT-PCR detection kit is about 6.8
×10-2 Ng/ μ L, and detection method is used, test limit is about 6.8 × 10-3 Ng/ μ L, sensitiveness is conventional RT-PCR
10 times of method.
3）It is rapid to obtain result
Common RT-PCR whole process just can obtain a result at 24 hours or so, at present most RT-LAMP reaction sides for setting up
Method after the completion of reaction, must be imaged come result of determination using agarose gel electrophoresis ultraviolet analysis, from virus genom DNA/
RNA extracts acquisition result of the test, needs 5-6 hours or so.The RT-LAMP detection methods that the present invention is provided were reacted at 20 minutes
There is amplification in left and right, and amplification can be completed in 60 minutes, and result interpretation mode is easy：According to the change feelings of reaction tube turbidity value
Sentence read result by condition, amplified reaction obtains result of the test by terminating, it is not necessary to enter row agarose gel electrophoresis ultraviolet again
Imaging Analysis or reaction add fluorescent dye to carry out sentence read result after terminating, and acquisition is extracted most from virus genom DNA/RNA
Fruit can complete termination in 2-3 hours.
4）Do not pollute
At present RT-LAMP methods are used for the fluorescent dye of directly observation for addition after reaction, and the fluorescent dye of the present invention be
The calcein commercial dyes added before reaction（Non- syber-green）, detection process need not uncap, and can be prevented effectively from gas molten
Glue stain experimental situation.Additionally, the RT-LAMP detection methods of the present invention are in result judgement, it is directly anti-by transmissometer detection
Should the turbidity value of pipe carry out result of determination, fluorescent dye determination testing result can not be carried out or enter row agarose gel electrophoresis detection knot
Really, it is not necessary to uncap, pollution can be prevented effectively from.
5）Can real-time quantitative
The present invention analyzes in real time RT-LAMP courses of reaction using Tubidimeter real-time LA-320C transmissometers,
The calibration curve that the time of the corresponding turbidity value of concentration of different standard samples is depicted as, substitutes into calibration curve equation, you can
The influenza virus copy number of each time is obtained, the purpose of quantitative determination product is reached.
Description of the drawings
Fig. 1 is RT-LAMP methods specific detection result of the present invention；Wherein testing virus has swine influenza virus（SIV）With
Avian influenza virus（AIV）；Control strain has：CSFV (CSFV), pig breeding dysfunction and breath syndrome virus (PRRSV),
Circovurus type 2 (PCV2), Pasteurella (Pm), haemophilus parasuis (HPS), porcine mycoplasmal（MH）, sterilize ultra-pure water conduct
Negative control（Negative）.As a result show, only the ascending curve of turbidity, 6 control reactions occurs in influenza virus reaction tube
Pipe and negative control reaction tube are without amplification.
Fig. 2 is the influenza virus sensitivity Detection result carried out using RT-LAMP methods of the present invention, and Fig. 3 is common RT-
The influenza virus sensitivity Detection result that PCR detection method is carried out；Wherein 1：6.8ng/μL； 2：6.8×10-1 ng/μL；3：
6.8×10-2 ng/μL；4：6.8×10-3 ng/μL；5：6.8×10-4 ng/μL；6：6.8×10-5 ng/μL；7：6.8×10-6
ng/μL；8：6.8×10-7 ng/μL.The initial concentration of the original RNA of influenza virus be 6.8ng/ μ L, 10 times of multiple proportions serial dilutions of Jing
Afterwards, RT-LAMP and RT-PCR amplifications are carried out, the RT-LAMP method test limits for as a result showing the present invention are about 6.8 × 10-3Ng/ μ L,
And RT-PCR test limits are about 6.8 × 10-2 ng/μL。
Fig. 4 is to add visual results after fluorescent dye：Reactions of the Zuo Guanwei with influenza virus gene group RNA as template
Situation, is positive findings, and right pipe is the response situation of negative control, is negative findings.
Fig. 5 is the calibration curve of quantitative determination influenza virus of the present invention：Concentration using different standard samples is corresponding
The calibration curve that turbidity value is depicted as to the time, substitutes into calibration curve equation, you can carry out quantitative.
Specific embodiment
1st, the preparation of material
Swine influenza virus（SIV）, avian influenza virus（AIV）Presented by animal science and technology institute of Guangxi University, compare strain bag
CSFV, pig breeding dysfunction and breath syndrome virus, porcine circovirus 2 type are included, comparison bacterium includes Pasteurella, secondary pig
Haemophilus, porcine mycoplasmal, are commercial available vaccines strain, or separate identification for Guangxi veterinary institute and preserve.LAMP methods RNA expand
Increase kit and be purchased from Beijing Lanpu Biological Technology Co., Ltd., article No. SLP246, virus genom DNA/RNA extracts kits purchase
It is century bio tech ltd, article No. CW0548 from health.
2nd, the design of RT-LAMP primers and synthesis
Influenza virus in GenBank encodes the gene order of non-structural protein NP1, is aided in using RT-LAMP methods primer
The a set of RT-LAMP primers of design software PrimerExplorer V4 Software for Design, wherein F3, B3 be outer primer, FIP, BIP
For inner primer, wherein
F3 TCTGGAGGGGTGAAAATGGA
B3 GTGCAACTGATCCCCTCAG
FIP GCCCTCTGGGCAGCTGTTTGCGAAGGACAAGGGTTGCTTA
BIP AAGTCGAAACCCAGGAAACGCTAATGAGTGCTGACCGTGC；
3rd, viral DNA/RNA is extracted or bacterial genomes DNA are extracted
Using virus genom DNA/RNA extracts kits, the viral gene of Influenza Virus RNA and comparison virus strain is extracted
Group DNA/RNA, or the RNA of doubtful influenza pathological tissues, using bacterial genomes extracts kit（Beijing health be reagent, goods
Number CW0552）Extract the genomic DNA of control strain.
4th, RT-LAMP reaction systems are set up
According to kit specification, by 25 μ l system configurations：
The μ L of 2 × reaction buffer 12.5
EM 1 μL
FIP 40 pmol
BIP 40 pmol
F3 5 pmol
B3 5 pmol
The μ L of Influenza Virus RNA 5
Ultra-pure water supplies 25 μ L.
RT-LAMP is reacted in the shape that closed complete monitoring is carried out with real-time transmissometer (LA-320C, Japanese Rong Yan companies)
Formula monitors the detection situation of this method, and transmissometer monitor in real time amplification situation can draw calibration curve, by obtaining unknown sample
Reach the corresponding time value of 0.1 turbidity value, you can the starting copy number of the sample is calculated from calibration curve, reaction temperature is
63℃。
5th, RT-LAMP detection methods
1）Specific detection
Influenza virus, pig breeding dysfunction and respiration syndrome disease is extracted respectively using virus genom DNA/RNA extracts kits
Poison, the genomic DNA/RNA of circovurus type 2.It is thermophilic Pasteurella, secondary pig to be extracted using bacterial genomes DNA extraction kit
Blood bacillus, the genomic DNA of porcine mycoplasmal, as the template of RT-LAMP reactions, while carrying out the RT- of each strain and bacterial strain
LAMP is expanded, while using water as negative control, the specificity of checking R T-LAMP method.
2）Sensitivity Detection
The initial concentration of Influenza Virus RNA is determined, with the continuous 10 times of doubling dilutions of RNA-Free Water into 8 dilution factors, with
Each RNA dilution factors, while carrying out RT-LAMP amplifications and RT-PCR amplifications, contrast the sensitiveness of two kinds of detection methods as template.
3）Fluorescent visual is detected
The condition of optimization is monitored according to transmissometer, calcein commercial dyes are added before the reaction, after reacting 60 minutes at 63 DEG C,
Observe under uviol lamp, do not adopt agarose gel electrophoresis ultraviolet analysis to image, it is to avoid uncap and run the gas that electrophoresis observation is caused
Colloidal sol pollutes laboratory.
The specific outcome of the RT-LAMP detection methods of embodiment 1
As a result it is positive findings as shown in figure 1, influenza virus reaction tube occurred the ascending curve of turbidity at 20 minutes or so, 6
Strain control strain reaction tube and negative control reaction tube curve occur without amplification situation, are negative findings.
The susceptibility results of the RT-LAMP detection methods of embodiment 2
The initial concentration of the original RNA of influenza virus is 6.8ng/ μ L, Jing after 10 times of multiple proportions serial dilutions, carries out RT-LAMP and RT-
PCR is expanded, and as a result as shown in Figures 2 and 3, the RT-LAMP method test limits for as a result showing the present invention are about 6.8 × 10-3Ng/ μ L,
And the detection of conventional RT-PCR method is limited to 6.8 × 10-2ng/μL。
The fluorescent visual testing result of the RT-LAMP detection methods of embodiment 3
According to the condition of transmissometer monitoring optimization, add fluorescent dye, after 63 DEG C are reacted 60 minutes, see under uviol lamp before reaction
Examine, Fig. 4 is observation result, and response situations of the Zuo Guanwei with influenza virus as template, is positive findings, right pipe is negative control,
For negative findings.Result of the test shows that the RT-LAMP methods that the present invention sets up facilitate basic unit to use, and only need to be matched somebody with somebody using kit
The RT-LAMP primers of this method design are closed, after adding sample, 63 DEG C is kept with cheap water-bath 60 minutes, you can be quick
Observation result, and need not uncap, it is to avoid pollution.
The RT-LAMP of embodiment 4 detects the drafting of influenza virus quantitation curves
With Influenza Virus RNA as template, continuous 10 times of doubling dilutions, each dilution factor solution conduct are carried out with RNA-Free Water
Standard sample, carries out RT-LAMP amplifications.
Control is set：Concentration is 0.68 × 101 ng/μL、0.68×100 ng/μL、0.68×10-1 ng/μL、0.68×
10-2 Ng/ μ L standard samples are each one, because the negative logarithm of standard sample concentration expands the time value that turbidity value is 0.1 with it
It is linear, the value that transmissometer can be captured and time（Such as table 1）Calibration curve is made, calibration curve equation, y is obtained
=0.3014x-8.1342, as shown in Figure 5.The coefficient R from from the point of view of calibration curve equation2For 0.9945, in good linear pass
System.With the time as X values, negative number formulary of the i.e. concentration of Y value can be obtained, then concentration is 10-y, then radix 0.68 is multiplied by, as 0.68
×10-yng/μL.When the time that such as certain test specimen reaches that turbidity value is 0.1 is 30 minutes, set up calibration curve is brought into
Equation, obtains Y equal to 0.9078, then concentration is 10-0.9078, then radix 0.68 is multiplied by, as the concentration 0.68 × 10 of the sample-0.9078Ng/ μ L, so as to reach quantitative effect.
Table 1
| Time（min） | 23.9 | 26.9 | 29.9 | 33.9 |
| Standard value（-LOG） | -1 | 0 | 1 | 2 |
<110>Veterinary Institute of Guangxi Zhuang Autonomous Region
<120>A kind of influenza virus reverse transcription loop-mediated isothermal amplification kit and its application
<160>4
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<400> 1
TCTGGAGGGGTGAAAATGGA
<210>2
<211>19
<212> DNA
<213>Artificial sequence
<400>2
GTGCAACTGATCCCCTCAG
<210> 3
<211> 40
<212> DNA
<213>Artificial sequence
<400> 3
GCCCTCTGGGCAGCTGTTTGCGAAGGACAAGGGTTGCTTA
<210>4
<211>40
<212> DNA
<213>Artificial sequence
<400> 4
AAGTCGAAACCCAGGAAACGCTAATGAGTGCTGACCGTGC
Claims (8)
1. a kind of influenza virus reverse transcription loop-mediated isothermal amplification kit, it is characterised in that the kit draws including RT-LAMP
Thing, 2 × reaction buffer, enzymatic mixture EM, fluorescence visual detection reagent, ultra-pure water and Influenza Virus RNA template, it is described
RT-LAMP primers include outer primer F3 and B3, inner primer FIP and BIP；
The sequence of wherein primer is respectively：
F3 TCTGGAGGGGTGAAAATGGA
B3 GTGCAACTGATCCCCTCAG
FIP GCCCTCTGGGCAGCTGTTTGCGAAGGACAAGGGTTGCTTA
BIP AAGTCGAAACCCAGGAAACGCTAATGAGTGCTGACCGTGC
2 described × reaction buffer includes Tris-HCL, KCL, MgSO4、(NH4)2SO4, Tween20, Betaine and dNTPs.
2. influenza virus reverse transcription loop-mediated isothermal amplification kit according to claim 1, it is characterised in that described
Influenza Virus RNA template takes from virus genom DNA/RNA extracts kits.
3. influenza virus reverse transcription loop-mediated isothermal amplification kit according to claim 1, it is characterised in that described
Fluorescence visual detection reagent adopts calcein fluorometric reagent, fluorometric reagent to add before the reaction.
4. influenza virus reverse transcription loop-mediated isothermal amplification kit according to claim 1, it is characterised in that described
2 × reaction buffer includes Tris-HCL 35-50mM, KCL 15-35mM, MgSO4 15-20mM、(NH4)2SO4 15-25mM、
Tween20 0.4-0.8 ℅, Betaine 1.5-3.0M and dNTPs 2.5-4 mM.
5. a kind of application of influenza virus reverse transcription loop-mediated isothermal amplification kit, it is characterised in that concrete operation step bag
Include：
（1）The design of RT-LAMP primers and synthesis
（2）The extraction of Influenza Virus RNA template
（3）RT-LAMP reaction systems are set up
（4）RT-LAMP detection methods.
6. the application of influenza virus reverse transcription loop-mediated isothermal amplification kit according to claim 5, it is characterised in that
Described RT-LAMP reaction systems are set up in terms of 25 μ l,
The μ L of 2 × reaction buffer 12.5
EM 1 μL
FIP 40 pmol
BIP 40 pmol
F3 5 pmol
B3 5 pmol
The μ L of Influenza Virus RNA 5
Ultra-pure water supplies 25 μ L.
7. the application of influenza virus reverse transcription loop-mediated isothermal amplification kit according to claim 5, it is characterised in that
Described RT-LAMP detection methods are the methods using the detection of specific detection, sensitivity Detection and fluorescent visual.
8. the application of influenza virus reverse transcription loop-mediated isothermal amplification kit according to claim 5, it is characterised in that
Described RT-LAMP detection methods carry out closed complete monitoring using real-time transmissometer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611115152.1A CN106636463A (en) | 2016-12-07 | 2016-12-07 | Influenza virus reverse transcription loop-mediated isothermal amplification (RT-LAMP) kit and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611115152.1A CN106636463A (en) | 2016-12-07 | 2016-12-07 | Influenza virus reverse transcription loop-mediated isothermal amplification (RT-LAMP) kit and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106636463A true CN106636463A (en) | 2017-05-10 |
Family
ID=58819605
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611115152.1A Pending CN106636463A (en) | 2016-12-07 | 2016-12-07 | Influenza virus reverse transcription loop-mediated isothermal amplification (RT-LAMP) kit and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636463A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113073152A (en) * | 2021-05-12 | 2021-07-06 | 广州普世利华科技有限公司 | LAMP primer, probe and kit for detecting influenza B virus |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101575649A (en) * | 2008-06-02 | 2009-11-11 | 中国农业科学院兰州兽医研究所 | Quick detection technology for H9 type avian influenza virus |
| CN102140539A (en) * | 2011-01-28 | 2011-08-03 | 中国科学院北京基因组研究所 | Kit for detecting influenza A H1N1 viruses and detection method |
| CN102534052A (en) * | 2012-03-16 | 2012-07-04 | 天津市畜牧兽医研究所 | Nucleic-acid sequence-based amplification (NASBA) method for detecting swine influenza virus (SIV) |
| CN103820576A (en) * | 2014-02-26 | 2014-05-28 | 广西壮族自治区兽医研究所 | H11 subtype avian influenza virus RT-LAMP visual detection kit |
| CN105400902A (en) * | 2015-12-03 | 2016-03-16 | 广西壮族自治区兽医研究所 | Reverse transcription loop-mediated isothermal amplification kit for detecting pestedes petits ruminants viruses |
| JP2016131498A (en) * | 2015-01-15 | 2016-07-25 | 東ソー株式会社 | Primer for amplifying influenza virus rna, and influenza virus detection method using the same |
-
2016
- 2016-12-07 CN CN201611115152.1A patent/CN106636463A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101575649A (en) * | 2008-06-02 | 2009-11-11 | 中国农业科学院兰州兽医研究所 | Quick detection technology for H9 type avian influenza virus |
| CN102140539A (en) * | 2011-01-28 | 2011-08-03 | 中国科学院北京基因组研究所 | Kit for detecting influenza A H1N1 viruses and detection method |
| CN102534052A (en) * | 2012-03-16 | 2012-07-04 | 天津市畜牧兽医研究所 | Nucleic-acid sequence-based amplification (NASBA) method for detecting swine influenza virus (SIV) |
| CN103820576A (en) * | 2014-02-26 | 2014-05-28 | 广西壮族自治区兽医研究所 | H11 subtype avian influenza virus RT-LAMP visual detection kit |
| JP2016131498A (en) * | 2015-01-15 | 2016-07-25 | 東ソー株式会社 | Primer for amplifying influenza virus rna, and influenza virus detection method using the same |
| CN105400902A (en) * | 2015-12-03 | 2016-03-16 | 广西壮族自治区兽医研究所 | Reverse transcription loop-mediated isothermal amplification kit for detecting pestedes petits ruminants viruses |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113073152A (en) * | 2021-05-12 | 2021-07-06 | 广州普世利华科技有限公司 | LAMP primer, probe and kit for detecting influenza B virus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110551846B (en) | Cpf1 kit for quickly detecting African swine fever virus nucleic acid and detection method thereof | |
| CN104846125B (en) | A kind of fluorescence RT PCR primers, probe and kit and detection method for being used to detect MERS | |
| CN107988325A (en) | Shrimp liver sausage born of the same parents worm（EHP）RAA constant temperature fluorescence detection method and reagent | |
| CN112831598B (en) | Real-time fluorescent PCR amplification primer pair and probe primer for African swine fever virus identification and detection and prepared kit | |
| CN110004240B (en) | Real-time fluorescence detection kit and test strip detection kit for mycoplasma gallisepticum based on RPA and application of kit and test strip detection kit | |
| CN104726567A (en) | Streptococcus agalactiae loop-mediated isothermal amplification kit and application thereof | |
| Borm et al. | A universal avian endogenous real-time reverse transcriptase–polymerase chain reaction control and its application to avian influenza diagnosis and quantification | |
| CN107385111A (en) | The real-time fluorescence quantitative PCR detection primer and its kit of a kind of goose astrovirus | |
| CN104651535A (en) | Reverse transcription loop-mediated isothermal amplification test kit of hog cholera virus and application thereof | |
| CN105349707A (en) | RT-LAMP (reverse transcriptase loop-mediated isothermal amplification) kit for porcine epidemic diarrhea viruses and applications thereof | |
| CN104651534A (en) | Porcine circovivus loop-mediated isothermal amplification kit and application thereof | |
| WO2022179494A1 (en) | Salmonella typhi detection kit, preparation method therefor and application thereof | |
| CN111876502B (en) | Method for identifying Brucella S2 vaccine strain by dual real-time fluorescent quantitative PCR and kit used by same | |
| CN101575640B (en) | Primer group for bovine tuberculosis mycobacterium detection, rapid detection method and detection kit | |
| CN105349702A (en) | PPV (porcine parvovirus) LAMP (loop-mediated isothermal amplification) kit and application thereof | |
| CN107988426A (en) | Prawn Taura syndrome（TSV）RAA constant temperature fluorescence detection method and reagent | |
| CN107460255A (en) | A kind of RT LAMP primers group, kit and application for detecting pig fourth type coronavirus | |
| Steyer et al. | A diagnostic method based on MGB probes for rapid detection and simultaneous differentiation between virulent and vaccine strains of avian paramyxovirus type 1 | |
| ITVT20110002A1 (en) | METHOD OF DETERMINING THE ORIGIN OF FLUIDS OR BIOLOGICAL TRACKS AND REAGENT KITS FOR THEIR IDENTIFICATION IN A SAMPLE. | |
| CN108048600A (en) | A kind of fluorescent quantitative PCR detection method of infectious bovine rhinotrachetis virus | |
| CN105349672A (en) | Mycoplasma hyopneumoniae loop-mediated isothermal amplification kit and application thereof | |
| CN108531660A (en) | A kind of 3 type real-time quantitative LAMP primer of detection pig circular ring virus, kit and application | |
| CN108411014A (en) | Differentiate the primer and probe and detection method of A types and the dual real-time fluorescence quantitative PCR of Type B ox pasteurella multocida | |
| CN111926110B (en) | African swine fever virus real-time fluorescent PCR amplification primer pair, probe primer and prepared kit | |
| CN106636463A (en) | Influenza virus reverse transcription loop-mediated isothermal amplification (RT-LAMP) kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170510 |
|
| RJ01 | Rejection of invention patent application after publication |