CN106636153A - Upland cotton non-specific phospholipase C gene GhNPC3a and application thereof - Google Patents
Upland cotton non-specific phospholipase C gene GhNPC3a and application thereof Download PDFInfo
- Publication number
- CN106636153A CN106636153A CN201611204602.4A CN201611204602A CN106636153A CN 106636153 A CN106636153 A CN 106636153A CN 201611204602 A CN201611204602 A CN 201611204602A CN 106636153 A CN106636153 A CN 106636153A
- Authority
- CN
- China
- Prior art keywords
- ghnpc3a
- gene
- cotton
- stress
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/04—Phosphoric diester hydrolases (3.1.4)
- C12Y301/04003—Phospholipase C (3.1.4.3)
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an upland cotton non-specific phospholipaseC gene GhNPC3a. A cDNA nucleotide sequence of the gene is shown as SEQ ID No.1, and an amino acid sequence coded by the gene is shown as SEQ ID No.2. The invention further discloses application of the gene and a plant expression vector pCAMBIA1300-GhNPC3a-EPSP thereof in improving cotton stress resistance. Experiments verify that expression of the gene is subject to low phosphorus, drought and ABA stress induction, transgenic cotton experiments show that stress resistance of transgenic cotton can be improved remarkably. It is predicted that the GhNPC3a gene has great potential in being applied in cultivating stress-resistant transgenic crops.
Description
Technical field
The present invention relates to a kind of upland cotton non-specificity phospholipase C gene GhNPC3a and its improve cotton resistance in
Application.Belong to plant genetic engineering field.
Background technology
Cotton is most important natural fiber in the world, and the abiotic stress such as arid, low-phosphorous affects the growth of cotton, finally
Output of cotton is caused to reduce.In the case where cultivated area only subtracts and do not increase, some places occur in that grain and cotton strives the phenomenon on ground.In people
The long korneforos of class development of civilization, wears the clothes and has a meal and be of equal importance.It is that cultivation resistance is stronger that solution grain and cotton strives the best approach on ground
Elite cotton kind, and Efficient Development utilize arid biogeographic zone, salt-soda soil or soil leanness soil.
Non-specific phospholipase C, mainly with phosphatid ylcholine as substrate, generates diacylglycerol and phosphocholine.Arabidopsis
In, there are 6 members (Nakamura et al.2005) in non-specific phospholipase C gene family.So far, there is text in succession within 2005
Offer the signal transduction and degeneration-resistant process (Nakamura et of report plant non-specificity phospholipase C involved in plant hormone
al.2005；Peters et al.2010；Wimalasekera et al.2010；Kocourkova et al.2011；
Pokotylo et al.2013；Nakamura 2014；Peters et al.2014；et al.2015；Pejchar
et al.2015；Hong et al.2016).However, research object is mostly model organism arabidopsis, non-spy in other species
The functional study of different in nature phospholipase C is very few.In order to be best understood from the function of plant non-specificity phospholipase C, to the non-spy of cotton
Different in nature phospholipase C gene family carries out research and is very important, but retrieves discovery so far, non-specific without any cotton
Property phospholipase C related report.
The content of the invention
For the deficiencies in the prior art, it is an object of the invention to provide a kind of upland cotton non-specificity phospholipase C gene
GhNPC3a and its application in cotton resistance is improved.
Upland cotton non-specificity phospholipase C gene of the present invention, it is characterised in that：The unnamed gene is that upland cotton is non-
Specific phospholipase C gene GhNPC3a, the cDNA nucleotide sequences of the gene as shown in SEQ ID No.1, its coding amino
Acid sequence is as shown in SEQ ID No.2.
The present invention clones first upland cotton non-specificity phospholipase C gene GhNPC3a, and experimental analysis confirms：GhNPC3a
On A13 chromosomes, the number of amino acid is 508, containing 4 extrons, 3 intrones for the assignment of genes gene mapping.MEME analyses find,
GhNPC3a has 16 motif.Motif to obtaining further is analyzed in ExPASy, and it is phosphoric acid that discovery has 6 motif annotations
Ester structure domain.With the conserved domain of NCBI Conserved Domain search and SMART on-line analysis GhNPC3a, send out
Existing GhNPC3a contains phosphate ester structure domain.Promoter cis-acting elements analysis is carried out to GhNPC3a, opening for GhNPC3a is found
Containing the cis-acting elements that very many or hormones related to stress are related in mover.Such as HSE (heat stress is related), MBS is (dry
Drought stress is related), LTR (low temperature stress is related), TC-rich repeats (defence is related to stress), ARE (anaerobic induction phases
Close), Box-W1 (fungal induction related), ABRE (abscisic acid is related), TGACG-motif and CGTCA-motif (jasmonic acid first
Ester is related), GARE-motif (gibberellin is related), AuxRR-core and TGA-element (auxin is related) and ERE (ethene
It is related).
The expression pattern analysis of Different Organs are carried out to GhNPC3a, real-time fluorescence quantitative PCR result shows that GhNPC3a is main
Express in root.Four leaf stage cotton is carried out respectively low-phosphorous (5 μM), salt (200mM NaCl), arid (20%PEG6000) and
The Stress treatment of ABA (200 μM), is drawn materials respectively when processing 0,1,2,3,6,9 and 12h, draws materials position for root.Extract
RNA is simultaneously reversed to cDNA, and real-time fluorescence quantitative PCR result shows, during low-phosphorus stress 1h, GhNPC3a expressions are raised, but
Process expression after 1h to lower；Under salt stress, GhNPC3a expressions are lowered；Drought stress expresses water when processing 1h and 2h
Divide equally not Shang Tiao 5.7 and 2.9 times, therewith expression show the phenomenon of slight downward.During ABA Stress treatment 1h, GhNPC3a
Expression raise 3.6 times, during 2h and 3h on modulation declined, expression difference compared with 0h is not notable after 6h.
Low-phosphorous, arid and ABA stress-inducing is received in the expression of GhNPC3a genes.
Present invention also offers a kind of plant expression containing above-mentioned upland cotton non-specificity phospholipase C gene GhNPC3a
Carrier pCAMBIA1300-GhNPC3a-EPSP.
Applications of the upland cotton non-specificity phospholipase C gene GhNPC3a of the present invention in cotton resistance is improved.
Plant expression vector pCAMBIA1300-GhNPC3a-EPSP of the present invention answering in cotton resistance is improved
With.
Wherein：The resistance refers to drought resisting and/or Tolerant to low P.The cotton variety is spring cotton, summer cotton, normal conon or miscellaneous
Hand over cotton.
When GhNPC3a overexpression structures are built, the cDNA nucleotide sequences of GhNPC3a are inserted into into plant expression vector
In pCAMBIA1300-EPSP, plasmid pCAMBIA1300-GhNPC3a-EPSP is obtained.After digestion identification is correct, plasmid is imported
In agrobacterium tumefaciens AGL1 or LBA4404, for Genetic Transformation in Higher Plants.
By agriculture bacillus mediated transgenic method, target gene is turned by acceptor of the shoot apical meristem cell of cotton
In entering cotton cells, that is, obtain transfer-gen plant.Determined by Molecular Detection and plant resistance and select the stable table of genes of interest
Up to and the transfer-gen plant that significantly improves of plant resistance.By pot experiment and land for growing field crops resistance determination test, you can filter out
The transgenic breeding material that resistance is significantly improved.The elite clone of acquisition is expected to be used for cotton breeding or production practices.
The invention has the beneficial effects as follows：
The present invention clones first non-specific phospholipase C gene GhNPC3a from upland cotton.The expression of the gene is by low
Phosphorus, arid and ABA stress-inducings.Simultaneously the present invention successfully constructs the expression of pCAMBIA1300-GhNPC3a-EPSP plants and carries
Body, the plant expression vector is transformed in cotton and is confirmed, gene of the present invention can significantly improve the anti-of transgene cotton
Inverse characteristic.Indication, GhNPC3a genes are applied to cultivation resistant transgenic crops and have great potentiality.
Description of the drawings
Fig. 1：The structural representation of plasmid pCAMBIA1300-GhNPC3a-EPSP.
Fig. 2：The specificity analysis of GhNPC3a gene organizations
Wherein：TR, main root；LR, lateral root；SM, stem；CL, cotyledon；SL, ageing leaves；EL, young leaflet tablet；ST, stem apex；
BR, bract；PE, petal；OV, ovule.
Fig. 3：Expression pattern analysis of the GhNPC3a genes under abiotic stress.
Specific embodiment
Embodiments of the invention described below.It should be noted that, embodiments of the invention only play illustration to the present invention
Without restriction effect.If no special instructions, it is conventional method.Test material used in following embodiments, such as without special
Illustrate, be routine biochemistry reagent.Quantitative test in following examples, is respectively provided with three repetitions and tests, results averaged.
The high-fidelity PCR amplification GhNPC3a genes of interest of embodiment 1.
The tender blade of 9807 four leaf stages children and root in upland cotton are taken, with reference to plant total RNA extraction reagent box (TIANGEN, north
Capital) specification, extracts plant total serum IgE, with PrimeScript RT Reagent Kit (TaKaRa, Dalian) reverse transcription reagent box
Reverse transcription obtains cDNA.High-fidelity PCR amplification is carried out with special primer.Specific primer sequences are as follows：
GhNPC3a-F：GGGGTACCATGGCAGTTGAAACAAGCT
GhNPC3a-R：CGAGCTCTCAACGATCACAAACCAAA
PCR reaction cumulative volumes are 25 μ L, and reaction system is：5 μ L 5 × PS Buffer, 2 μ L dNTP, 0.5 μ L forward directions are drawn
Thing, 0.5 μ L reverse primers, 0.25 μ L Prime STARase, 1 μ L dilute ten times of cDNA templates, ddH2O polishings to 25 μ L.
PCR amplification conditions, 95 DEG C of 3min of denaturation, 35 circulations：98 DEG C, 10sec；56 DEG C, 5sec；72 DEG C, 90sec,
Last 72 DEG C of extensions 6min.
PCR primer Jing Ago-Gel DNA QIAquick Gel Extraction Kits recovery (TIANGEN, Beijing) after purification, are connected to
On pEASY-Blunt Cloning vector (TRANSGEN, Beijing).Then convert Escherichia coli TransT1 (TRANSGEN,
Beijing), carry out sequencing analysis.By above-mentioned steps, the cDNA of upland cotton non-specificity phospholipase C gene GhNPC3a is obtained
Nucleotide sequence.
The grand result of GhNPC3a gene cDNA nucleotide sequence lek is as follows：
The cDNA nucleotides sequences for obtaining GhNPC3a genes by high-fidelity enzymatic amplification are classified as 1527bp, encode 508 amino
Acid, as shown in SEQ ID No.1, the amino acid sequence of the GhNPC3a albumen of its coding is such as the cDNA nucleotide sequences of GhNPC3a
Shown in SEQ ID No.2.
Embodiment 2.GhNPC3a gene biological bioinformatics analysis
Using information such as ExPASy proteomics server database estimation GhNPC3a molecular weight, isoelectric points；
GhNPC3a gene structures are analyzed using Gene Structure Display Server 2.0；GhNPC3a is analyzed using MEME
Conservative motif, and with the ScanProsite instruments in ExPASy to obtain motif annotate；Using NCBI
The conserved domain of Conserved Domain search and SMART on-line analysis GhNPC3a, is analyzed using Plant CARE
The promoter of GhNPC3a.
Through bioinformatic analysis, GhNPC3a genes are found, be positioned on A13 chromosomes, the number of amino acid is
508, GhNPC3a theoretical molecular is 56.96kD, and theoretical isoelectric point is 5.18.Containing 4 extrons, 3 intrones.
MEME analyses find that GhNPC3a has 16 motif.Motif to obtaining further goes in ExPASy to analyze, and discovery has 6
Motif annotations are phosphate ester structure domain.With NCBI Conserved Domain search and SMART on-line analysis GhNPC3a
Conserved domain, find GhNPC3a contain phosphate ester structure domain.Promoter cis-acting elements analysis is carried out to GhNPC3a,
It was found that cis-acting elements number related to stress in GhNPC3a promoters is very more.Including HSE (heat stress is related), MBS
(drought stress is related), LTR (low temperature stress is related), TC-rich repeats (defence is related to stress), ARE (anaerobic inductions
It is related), Box-W1 (fungal induction is related), ABRE (abscisic acid is related), TGACG-motif and CGTCA-motif (jasmonic acids
Methyl esters is related), GARE-motif (gibberellin is related), AuxRR-core and TGA-element (auxin is related) and ERE (second
Alkene is related).
Embodiment 3.GhNPC3a tissue specificity is analyzed
Upland cotton (kind be in 9807) is planted in greenhouse after seed is sterilized, and growth conditions is：30 DEG C/25 DEG C, phase
It is 60-70%, illumination 14h, dark 10h to humidity, photon flux density is 800 μm of ol m-2s-1.When growing to four leaf stage, take
In liquid nitrogen, -80 DEG C preserve for main root, lateral root, stem, stem apex, cotyledon, ageing leaves and young leaflet tablet；Florescence is grown to, is taken away
In liquid nitrogen, -80 DEG C preserve bract, petal and ovule when spending first day.Plant total serum IgE is extracted respectively, and reverse transcription is obtained
CDNA, 10 times of dilution is afterwards for real-time fluorescence quantitative PCR analysis.Upland cotton Histone genes (GenBank accession
Number NC_006639) it is internal standard.Quantitative fluorescent PCR reaction kit is tried for the SYBR Premix Ex Taq II of TAKARA
Agent box, reactsCarry out in 96 System fluorescent quantitation instruments, carry out the repetition of 3 secondary pollutants, experimental result is used
Relative quantification 2ΔCtMethod calculates the expression (Schmittgen and Livak 2008) of GhNPC3a genes.Primer sequence is：
QGhNPC3a-F:GCAGTTGAAACAAGCTCTGCAACT
QGhNPC3a-R:GAGTTGTACGTTCAGCATTTTGTAC
As a result：GhNPC3a mainly expresses (Fig. 1) in root.
Expression pattern analysis of the embodiment 4.GhNPC3a gene under abiotic stress
Upland cotton (kind be in 9807) is planted in greenhouse after seed is sterilized, and growth conditions is：30 DEG C/25 DEG C, phase
It is 60-70%, illumination 14h, dark 10h to humidity, photon flux density is 800 μm of ol m-2s-1.When growing to four leaf stage, point
Low-phosphorous (5 μM), salt (200mM NaCl), the Stress treatment of arid (20%PEG6000) are not carried out, respectively in process 0,1,2,3,
Drawn materials when 6,9 and 12h, drawn materials position for root.Extract total serum IgE and be reversed to cDNA, 10 times of dilution is used for afterwards glimmering in real time
Fluorescent Quantitative PCR is analyzed.Upland cotton Histone genes (GenBank accession number NC_006639) are internal standard.It is glimmering
Fluorescent Quantitative PCR reaction kit is the kits of SYBR Premix Ex Taq II of TAKARA, reacts96
Carry out in System fluorescent quantitation instruments, carry out the repetition of 3 secondary pollutants, experimental result relative quantification 2-ΔΔCtMethod calculates GhNPC3a
The expression (Schmittgen and Livak 2008) of gene.Primer sequence is：
QGhNPC3a-F:GCAGTTGAAACAAGCTCTGCAACT
QGhNPC3a-R:GAGTTGTACGTTCAGCATTTTGTAC
As a result show, during low-phosphorus stress 1h, GhNPC3a expressions are raised, but process expression after 1h and lower；Salt
Under stress, GhNPC3a expressions are lowered；Expression raises respectively 5.7 and 2.9 times when drought stress processes 1h and 2h, with
Expression show the phenomenon of slight downward.During ABA Stress treatment 1h, GhNPC3a expressions raise 3.6 times, 2h and
Modulation on during 3h has declined, and expression difference compared with 0h is not notable after 6h.The expression of GhNPC3a genes is by low
The stress-inducing of phosphorus, arid and ABA.
5. turns of GhNPC3a genes of embodiment create Resistance Strain of Cotton against material
One：The structure of pCAMBIA1300-GhNPC3a-EPSP plant expression vectors
When GhNPC3a overexpression structures are built, the cDNA nucleotide sequences of GhNPC3a are inserted into into plant expression vector
In pCAMBIA1300-EPSP, plasmid pCAMBIA1300-GhNPC3a-EPSP is obtained.After digestion identification is correct, plasmid is imported
In agrobacterium tumefaciens AGL1 or LBA4404, for Genetic Transformation in Higher Plants.Wherein plant expression vector pCAMBIA1300-EPSP is
Complete artificial synthesized EPSP genes (two ends add respectively BamH I, KpnI restriction enzyme sites) are linked to the MCS of pCAMBIA1300
Upper acquisition.PCAMBIA1300 carriers in plant expression vector pCAMBIA1300-EPSP are CAMBIA Products,
GenBank number of registration AF134296；EPSP genes number of registration is AY573186.1
Two：The acquisition of transgenic cotton plant
Cotton seeds soak 1min, 0.1% mercuric chloride immersion 15min, then with nothing Jing after sulfuric acid lint with 70% ethanol
Bacterium water washing 5 times.Seed is put into and is covered with the aseptic bottle of three metafiltration paper after sterilization, appropriate amounts of sterilized water is added, in 28 DEG C of incubators
Sprout.Germination seed is inserted in MS solid mediums and continues to cultivate by hypocotyl length to 1～2cm after 2～3 days, and plant height 7～
It is used to convert during 10cm.
Will (plasmid pCAMBIA1300-GhNPC3a-EPSP be with herbicide resistance gene EPSP and purpose base with carrier
Because of GhNPC3a) agrobacterium tumefaciens (AGL1 or LBA4404) 28 DEG C in the YEP culture mediums of additional antibiotic at concussion and cultivate,
Concussion speed is 110r/min, makes bacterium be in exponential phase.Then it is centrifuged 10 minutes under 3000r/min, abandons supernatant.
Thalline is washed with 1/2MS improvement fluid nutrient mediums, is collected by centrifugation.Again by the thalline 1/2MS for adding 100mg/L acetosyringones
Improvement fluid nutrient medium suspends, and 5～20 times of dilution is used to convert.In conversion test, 1% surfactant Silwet is added
L-77 (Lehle Seeds, USA) or Tween80.
When kind of a skin comes off or comes off soon, remove kind of skin and a piece of cotyledon, expose seedling stem apex.If the existing leaflet of shoot apex
Occur, then peelled off with tweezers.Gently scratch after apical meristem, the cotton balls of Agrobacterium bacterium solution will be moistened with (by sterilized non-fat cotton
Prepare) seedling top is put into, continue to remove cotton-wool after 24h, suck the residual bacterium solution of infection site with aseptic filter paper.Seedling is contaminated
When be placed in vacuum desiccator, be aided with 0.5 × 105The Negative pressure of Pa.The seedling contaminated in 21 DEG C or so light cultures 3 days,
Then it is transplanted into flowerpot after cultivating 2～3 days under light.Flowerpot bottom is soil, and top is the thick vermiculites of 6～8cm, is poured every other day
1/2MS improves inorganic salt solution.
Three：Transformed plant is screened and field planting
Plant to be transformed is grown after 3 true leaves, sprays 1.6～1.8 ‰ herbicide glyphosate (transgenosis selectable marker genes
For EPSP) aqueous solution, with unconverted plant as control.Fountain height falls drop and is advisable with plant.Unconverted plant 3 days after spraying
Stop growing, start within 7～10 days or so dead.Plant after conversion processing, the change of some individualities is similar to adjoining tree, separately
Some individualities then continued propagation, without significant change.Plant grew to for 4～5 leaf phases, was colonized to field.
Four：The identification and utilization of transfer-gen plant
The selfing of transfer-gen plant Post flowering or sisters' knot reality.Seed is sowed in land for growing field crops or greenhouse, in plant four leaf stage
Take blade and extract DNA, using round pcr detection progeny plant whether foreign gene-carrying GhNPC3a, and count foreign gene and exist
Segregation ratio in filial generation.
As a result show, organize by transgene receptor of aseptic seedling shoot apical meristem, can effectively obtain transfer-gen plant.And
And, in partial transgenic strain offspring, foreign gene mode of inheritance meets Mendelism, and stablizes in passing on.Turn base
Because of homozygous line Jing field character determinations and resistant determination, select and keep acceptor kind fundamental characteristics and resistance is significantly improved
Transgenic line, and for cotton variety improvement.
The preferred embodiment of the present invention described in detail above.It should be appreciated that the ordinary skill of this area is without the need for wound
The property made work just can make many modifications and variations with design of the invention.Therefore, all technical staff in the art
Pass through the available technology of logical analysis, reasoning, or a limited experiment on the basis of existing technology under this invention's idea
Scheme, all should be in the protection domain being defined in the patent claims.
Sequence table
<110>Shandong University
<120>A kind of upland cotton non-specificity phospholipase C gene GhNPC3a and its application
<141>2016-12-7
<160>2
<210>1
<211>1527
<212>cDNA
<213>Cotton（Gossypiumspp）
<221>The cDNA nucleotide sequences of upland cotton non-specificity phospholipase C gene GhNPC3a
<222>（1）…（1527）
<400>1
atggcagttg aaacaagctc tgcaactcca tctccagtca aaacagtggt tgttttggtt 60
caagagaacc gttcctttga ccacatgtta ggctggttca aaactataaa cccagaaatc 120
gacggtgtca caggctccga atccaacccc atttccacct ccgaccccaa ctccacccaa 180
atcaccttca aggacaccgc cggctacgtt gatcccgacc ccgaccactc tttccaagcc 240
atatacgaac aggtatccgg caaaacgtgg gataccagca acccggatcc gaacccgggg 300
ataaaaatga acggttttgt acaaaatgct gaacgtacaa ctccggggct gtcggagacc 360
gtaatgaatg ggtttaaacc ggaggctgtg ccggtgttta agcagctagt gacggagttc 420
gcagtgtgtg atcggtggtt tgcgtcgttg ccggcgtcga cgcagcctaa caggctttac 480
gtacactcag cgacatcgca tggtgccatg agcaacaaca cacaacagct tatcgaagga 540
tttcctcaaa aaactatatt tgaatcattg gaagagaatg gatatagctt tgggatttat 600
tatcaatctt ttccatctac gcttttttac aggaagctta ggcacttgaa atatgtggac 660
aatttccatc aatacgatct aagcttcaag cgtcactgta aggatgggaa gctaccaaat 720
tatgtggtga ttgagcccag atattttgac attttaacag ctgctgcaaa cgacgaccac 780
ccttcccatg acgtctcaga gggccagaag cttgtgaagg aaatctatga agcgctcaga 840
tcaagtcctc aatggaatga aatcttgttc ctggtcatat atgatgaaca tggtggtttc 900
tatgaccatg ttccgacacc aaccggagtc cctagccccg atgatattgt cggtcctgag 960
ccttataact tcaagtttga tcgtcttggt tgcagggttc ctgccattat ggtttcccct 1020
tggattgagc ctggaacagt gttgcatagg ccatcagggc cagatcctac atcagagttc 1080
gagcattcct ccattgcagc aacacttaag aagattttca atctcaaaga atttctaaca 1140
aagcgtgatg cgtgggctgg ttcctttgat attgttgtca atcgaagcac cccaagaaca 1200
gactgtccag aaaaactggc agagccagtg aaaatgagag acagtgatgc aaaagaaaca 1260
gcaaaactaa gcgattttca agaagagcta gtgcaagcag cagcagcatt gaaaggagat 1320
ccattcaatc ttgtcgaaaa catgacagtt tcatctggtc tcaagtacgt tgaagatgcc 1380
ttcaaaaaat tctatgatga cggccagaaa gctaaggaaa tcaatgaagt tgaagatact 1440
gtttcagctg atgcatcaac taggaggaca acagcttcca aaactttcat gcagaaagtt 1500
ttctcctgtt tggtttgtga tcgttga 1527
<210>2
<211>508
<212>PRT
<213>Artificial sequence
<221>The amino acid sequence of upland cotton non-specificity phospholipase C gene GhNPC3a codings
<222>（1）…（508）
<400>2
MAVETSSATP SPVKTVVVLV QENRSFDHML GWFKTINPEI DGVTGSESNP ISTSDPNSTQ 60
ITFKDTAGYV DPDPDHSFQA IYEQVSGKTW DTSNPDPNPG IKMNGFVQNA ERTTPGLSET 120
VMNGFKPEAV PVFKQLVTEF AVCDRWFASL PASTQPNRLY VHSATSHGAM SNNTQQLIEG 180
FPQKTIFESL EENGYSFGIY YQSFPSTLFY RKLRHLKYVD NFHQYDLSFK RHCKDGKLPN 240
YVVIEPRYFD ILTAAANDDH PSHDVSEGQK LVKEIYEALR SSPQWNEILF LVIYDEHGGF 300
YDHVPTPTGV PSPDDIVGPE PYNFKFDRLG CRVPAIMVSP WIEPGTVLHR PSGPDPTSEF 360
EHSSIAATLK KIFNLKEFLT KRDAWAGSFD IVVNRSTPRT DCPEKLAEPV KMRDSDAKET 420
AKLSDFQEEL VQAAAALKGD PFNLVENMTV SSGLKYVEDA FKKFYDDGQK AKEINEVEDT 480
VSADASTRRT TASKTFMQKV FSCLVCDR 508
Claims (6)
1. a kind of upland cotton non-specificity phospholipase C gene, it is characterised in that：The unnamed gene is upland cotton non-specificity phosphorus
Lipase C gene GhNPC3a, as shown in SEQ ID No.1, the amino acid sequence of its coding is such as the cDNA nucleotide sequences of the gene
Shown in SEQ ID No.2.
2. a kind of plant expression vector containing upland cotton non-specificity phospholipase C gene GhNPC3a described in claim 1
pCAMBIA1300-GhNPC3a-EPSP。
3. applications of the upland cotton non-specificity phospholipase C gene GhNPC3a described in claim 1 in cotton resistance is improved.
4. plant expression vector pCAMBIA1300-GhNPC3a-EPSP described in claim 2 improve cotton resistance in should
With.
5. the application as described in claim 3 or 4, it is characterised in that：The resistance refers to drought resisting and/or Tolerant to low P.
6. the application as described in claim 3 or 4, it is characterised in that：The cotton variety is spring cotton, summer cotton, normal conon or miscellaneous
Hand over cotton.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611204602.4A CN106636153A (en) | 2016-12-23 | 2016-12-23 | Upland cotton non-specific phospholipase C gene GhNPC3a and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611204602.4A CN106636153A (en) | 2016-12-23 | 2016-12-23 | Upland cotton non-specific phospholipase C gene GhNPC3a and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106636153A true CN106636153A (en) | 2017-05-10 |
Family
ID=58828142
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611204602.4A Pending CN106636153A (en) | 2016-12-23 | 2016-12-23 | Upland cotton non-specific phospholipase C gene GhNPC3a and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636153A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103361362A (en) * | 2012-03-31 | 2013-10-23 | 中国科学技术大学 | Method for culturing drought-resistant salt-tolerant transgenic cotton by using AtEDT1 gene |
| CN105018501A (en) * | 2015-07-16 | 2015-11-04 | 河南大学 | Application of arabidopsis AtACS2 gene in cotton drought resisting and early maturing |
-
2016
- 2016-12-23 CN CN201611204602.4A patent/CN106636153A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103361362A (en) * | 2012-03-31 | 2013-10-23 | 中国科学技术大学 | Method for culturing drought-resistant salt-tolerant transgenic cotton by using AtEDT1 gene |
| CN105018501A (en) * | 2015-07-16 | 2015-11-04 | 河南大学 | Application of arabidopsis AtACS2 gene in cotton drought resisting and early maturing |
Non-Patent Citations (4)
| Title |
|---|
| CARLOTTA ANTONETTA PETERS: "Functional Characterization of Putative Non-Specific Phospholipase C (NPC) in Arabidopsis thaliana", 《DISSERTATIONS》 * |
| GENBANK DATABASE: "PREDICTED: Gossypium hirsutum non-specific phospholipase C3-like (LOC107920295), mRNA", 《NCBI》 * |
| 梁卓等: "棉花磷脂酶Ｃ基因的克隆及参与油脂代谢的功能分析", 《西北植物学报》 * |
| 沈桂芳: "《现代生物技术与21世纪农业》", 31 December 2000, 浙江科学技术出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107435047A (en) | In a kind of plant phosphorus signal network Tolerant to low P key gene GmPHR25 and its with application | |
| CN104450740B (en) | A kind of alfalfa MsWRKY33 transcription factor and encoding proteins, preparation method and application | |
| CN104357456A (en) | Specific grape powdery mildew resistant gene VpR8H-1 cDNA (complementary deoxyribonucleic acid) sequence and application of cDNA sequence | |
| CN108118040A (en) | Soybean GDPD protein coding genes GmGDPD1 and its application | |
| CN103451192A (en) | Populus deltoidesx populus nigra PdMYB2 gene and application thereof | |
| CN105838726B (en) | A kind of Salt Tolerance Gene in Alfalfa gene M sCDPK and its coding albumen and application | |
| CN110229818A (en) | Wax plum CpSNAC1 gene promoter and its application | |
| CN103951740B (en) | Bermuda grass CCAAT transcription factor CdtNF-YC1 as well as coding gene and application thereof | |
| CN106520799A (en) | Non-specific phospholipase C gene GhNPC1b of upland cotton and applications of non-specific phospholipase C gene GhNPC1b | |
| CN110628782B (en) | Application of gene TaPT13 in improving resistance of plants to Helminthosporium graminearum | |
| CN104388433A (en) | Plant osmotic stress inducible promoter and application thereof | |
| CN106479994B (en) | A kind of upland cotton non-specificity phospholipase C gene GhNPC6d and its application | |
| CN106755008A (en) | A kind of upland cotton non-specificity phospholipase C gene GhNPC6b and its application | |
| CN106755009B (en) | A kind of upland cotton non-specificity phospholipase C gene GhNPC3b and its application | |
| CN106479995B (en) | A kind of upland cotton non-specificity phospholipase C gene GhNPC6c and its application | |
| CN106636153A (en) | Upland cotton non-specific phospholipase C gene GhNPC3a and application thereof | |
| CN107619831A (en) | Application of the barley HvSTT1 genes in terms of plant salt endurance is improved | |
| CN106755007A (en) | A kind of upland cotton non-specificity phospholipase C gene GhNPC1a and its application | |
| CN106755010A (en) | A kind of upland cotton non-specificity phospholipase C gene GhNPC4 and its application | |
| CN106520725A (en) | Upland cotton non-specific phospholipase C gene GhNPC6a and application thereof | |
| CN105753955A (en) | Soybean bHLH transcription factor and encoding gene and application thereof | |
| CN104099355A (en) | Method for cultivating StP5CS salt-tolerance transgenic soybeans | |
| CN109439674A (en) | One kind improving Soybean Resistance herbicide dicamba and the photosensitive method of plant by turning DMO gene | |
| CN110295174A (en) | The transgenic arabidopsis strain and its construction method of FIPV gene overexpression | |
| CN103205404A (en) | EPSP (5-enolpyruvyl shikimate-3-phosphate) synthase multisite mutant from Malus domestica, and coding gene and application of mutant |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170510 |