CN106636115B - A kind of fish Hepcidin expression promotor and its application - Google Patents
A kind of fish Hepcidin expression promotor and its application Download PDFInfo
- Publication number
- CN106636115B CN106636115B CN201610978521.3A CN201610978521A CN106636115B CN 106636115 B CN106636115 B CN 106636115B CN 201610978521 A CN201610978521 A CN 201610978521A CN 106636115 B CN106636115 B CN 106636115B
- Authority
- CN
- China
- Prior art keywords
- cpg
- odn
- hepcidin
- fish
- promotor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/117—Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/17—Immunomodulatory nucleic acids
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Veterinary Medicine (AREA)
- Plant Pathology (AREA)
- Public Health (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Farming Of Fish And Shellfish (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a kind of fish Hepcidin expression promotor and its application, the promotor is one of following: CpG-ODN-C4:TCGTCGTCGAGCGAGGCAGTCGTT and CpG-ODN-C5:GTCGTTTCGACGGGTGCAGTCGTT.Promotor of the present invention can efficiently induce antibacterial peptide Hepcidin to express, and then greatly improve survival rate when fish directed toward bacteria sexuality dye.Meanwhile promotor provided by the present invention is a kind of free of contamination short nucleotide sequence, can be decomposed in the natural environment.Relative to traditional antibiotic, disulfonamide, the antibacterial immunity preparation of promotor preparation provided by the present invention is a kind of typically with the environmentally friendly preparation of high-efficiency antimicrobial function.
Description
(1) technical field
The present invention relates to one kind fish can be induced containing specific immunity activation functional domain and efficiently to generate Hepcidin
Artificial synthesized CpG-ODN preparation and its application in fish congenital immunity antibacterial.
(2) background technique
With the fast development of China's culture fishery, fish diseases take place frequently and are on the rise, and cause huge economic losses.
Simultaneously because a large amount of uses of antibiotic and insecticide, the problems such as causing environmental pollution, cause of disease drug resistance and food safety, seriously
Affect culture fishery sustainable development and the health of people.As country has put into effect a series of stringent food safeties
Standard, large quantities of antibiotic have been prohibited to be applied to aquaculture of aquatic animal, and culture fishery is faced with the difficult office that no medicine can be applied
Face.It would therefore be highly desirable to develop and develop safe, the nuisanceless and environmentally friendly disease-resistant technology of novel, efficient fish and disease-resistant
Preparation.Wherein immune defense technology represents important developing direction.
Hepcidin is a kind of mainly by the bioactie agent of liver expression, and there is antibacterial peptide and iron ion transhipment to adjust
The double biological function of element.It can reduce serum iron by direct bactericidal effect and indirectly and inhibit bacterial growth
Effect, realize effective immune disease-resistance, therefore be the important factor that attracts attention the most in the application of immune disease-resistance formulation development
One of.Development and application currently for Hepcidin are mainly seen in the clone of its gene and exogenous recombinant expression, and for
Realize that the technology of immune disease-resistance is still rare by regulation endogenous Hepcidin expression.Exogenous recombinant expression
Though Hepcidin preparation can effectively inhibit infecting for pathogen, there are be easy to lose in high production cost, storage and use process
It lives, be unfavorable for the disadvantages of large-scale application, especially because the Hepcidin preparation of exogenous recombinant expression is unfavorable for applying
Fairly large aquaculture field.Therefore, it is realized by the exploitation efficient inducing expression technology of endogenous Hepcidin immune
Disease-resistant is an important substitution sexual approach.
Few DNA (CpG-ODN) preparation of the motif of guanine containing cytimidine be a kind of important immunological regulation because
Son.CpG-ODN have preparation cost is low, product is stable, belongs to nucleic acid preparation has no toxic side effect, be easy to degrade in the environment without
Enrichment, safe and efficient and advantages of environment protection, therefore be the immune disease-resistance preparation for being rich in application value.But CpG-ODN has
The specificity of species specificity, histocyte specificity and specific gene regulation.Immunology effect is generated in different plant species
Sequence, composition and the structure of CpG-ODN is not quite similar, CpG-ODN needed for different Cell and gene-activations in same species
Type be also not quite similar.Therefore, for different species and different cell and gene, need targetedly to carry out setting
Meter, transformation and screening.CpG-ODN also has stimulable type and the two different types of suppressive, the former has activating immune system
Function, and the latter have the function of inhibit immune system, this expands the application range of CpG-ODN preparation, but also increases simultaneously
The difficulty for designing and screening in its development and application is added.The immunostimulation of CpG-ODN and function is inhibited to be determined by many factors,
Composition, the structure of CpG core space both wings sequence and the modification of pivotal nucleotide of length, nucleotide including oligonucleotide chain
State etc., these parameters need binding function evaluation to be screened and optimized.We pass through to the special of candidate CpG-ODN sequence
Design so that the sequence fragment filtered out have suitable oligonucleotides chain length, the island CG quantity, phosphorothioate backbone site and
The higher structure of efficient specific bond host CpG receptor Toll-like receptor 9 (TLR9), the CpG-ODN sequence through screening
Column have the function of that fish antibacterial peptide Hepcidin is efficiently induced to express.
The present invention is directed to aquatic livestock fish species, to stimulate in liver organization for the purpose of Hepcidin gene expression, is
System has carried out the research such as design, synthesis, modification, screening and functional evaluation of stimulable type CpG-ODN.Utilize model experiment animal spot
Horse fish research model, from 19 candidate CpG-ODN of pre-designed synthesis, zebra fish liver table can efficiently be induced by screening two
Up to the CpG-ODN sequence of Hepcidin.Functional study shows that this two CpG-ODN can be expressed in significant induced liver
While Hepcidin, the iron concentration in serum is reduced, to inhibit bacterial growth.In addition, CpG-ODN also inhibits bacterium
Express OmpA memebrane protein, lethality of the enhancing complement to bacterium.Immune disease-resistance test result shows present invention CpG- obtained
Infection of the significant Protection fish of ODN energy from Aeromonas hydrophila, death rate of the onset significant decrease.
(3) summary of the invention
Object of the present invention is to artificial synthesized fish kind and tissue specificity CpG-ODN, are used for induced liver tissue expression
Hepcidin.Using zebra fish experimental model, by importing CpG-ODN in vivo, and Hepcidin expression analysis, antibody is combined to hinder
Disconnected test, iron ion content measurement, bacterial growth inhibit the functional evaluation such as measurement test, contain different structure from pre-designed 19
In the CpG-ODN sequence of type, two kinds of CpG-ODN for meeting c-type structure feature are filtered out.It was found that it can specificity raising liver
The expression of middle Hepcidin reduces Iron in Serum ion concentration, inhibits bacterial growth, significantly improves experiment fish to thermophilic aqueous vapor unit cell
The immune protective efficiency of the pathogenic bacterial infections such as bacterium.Establish it is a kind of using inducing endogenous Hepcidin high efficient expression to realizing fish
The disease-resistant new technology of para-immunity.
The technical solution adopted by the present invention is that:
The present invention provides a kind of fish Hepcidin expression promotor, and the promotor is one of following: CpG-ODN-C4:
TCGTCGTCGAGCGAGGCAGTCGTT and
CpG-ODN-C5:GTCGTTTCGACGGGTGCAGTCGTT.
The present invention also provides a kind of fish Hepcidin expression promotors to prepare the application in immune formulation.
Further, the immune formulation is the inhibition of Aeromonas hydrophila (Aeromonas hydrophila) infection immunity
Agent.
Further, the immune formulation is vibrio alginolyticus (Vibrio alginolyticus) infection immunity inhibitor.
The present invention uses bioinformatics structural modeing technique, designs 19 kinds of CpG-ODN sequences of various neck ring structure features
Column, are synthesized by Shanghai Jierui Biology Engineering Co., Ltd.19 kinds of CpG-ODN are injected into zebra fish one by one respectively, use fluorescent quantitation
The change level of Hepcidin transcription product (mRNA), carries out dose-dependant in the liver organization of RT-PCR technology measurement stimulation front and back
Property statistical analysis.It is dense that stimulation front and back experiment fish serum iron ion is measured using icp ms (ICP-MS)
Degree, using plate bacteriostatic test measure bacterial growth ability, then statistically analyze liver Hepcidin inducing expression, serum levels of iron from
Correlation between sub- concentration decline and bacterial growth inhibition.Using Aeromonas Hydrophila Septicemia infection model, pass through death
The statistical analysis of rate and survival rate measures the immunity protection function of CpG-ODN.
Compared with prior art, beneficial effect of the present invention is mainly reflected in: promotor of the present invention can efficiently induce anti-
Bacterium peptide Hepcidin expression then greatly improves survival rate when fish directed toward bacteria sexuality dye.Meanwhile it is provided by the present invention
Promotor is a kind of free of contamination short nucleotide sequence, can be decomposed in the natural environment.Relative to traditional antibiotic, sulfamido
Antimicrobial, the antibacterial immunity preparation of promotor preparation provided by the present invention are a kind of typically with the ring of high-efficiency antimicrobial function
Border friendly preparation.
(4) Detailed description of the invention
Fig. 1 is various CpG-ODN and Aeromonas hydrophila genomic DNA designed by the present invention (A.h DNA) to spot
The fluorescence quantitative RT-RCR testing result of horse fish antibacterial peptide Hepcidin inducing action；
Fig. 2 is the fluorescent quantitation of CpG-ODN-C4 and CpG-ODN-C5 to the stimulation of zebra fish antibacterial peptide Hepcidin
The testing result of PCR, ELISA and Western Blot；A is the change of CpG-ODN-C4 induced liver tissue Hepcidin transcriptional level
Change, B is the variation of CpG-ODN-C5 induced liver tissue Hepcidin transcriptional level, and C is during CpG-ODN-C4 is blood serum induced
The variation of Hepcidin protein concentration, D are the blood serum induced middle Hepcidin protein concentration variation of CpG-ODN-C5, E CpG-ODN-
Hepcidin expression concentration variation in Western Blot detection serum after C4 and CpG-ODN-C5 stimulation.
Fig. 3 is the testing result that zebra fish serum bacteriostasis changes after the processing of Hepcidin antibody；A is CpG-ODN-
The antibacterial kinetic curve measurement of zebra fish serum after C4 stimulation, B are the antibacterial dynamics of zebra fish serum after CpG-ODN-C5 stimulation
Curve determination.
Fig. 4 is the detection knot of serum ferrous ions concentration variation after CpG-ODN-C4 and CpG-ODN-C5 injection zebra fish
Fruit；A is zebra fish serum iron concentration variation after CpG-ODN-C4 stimulation, and B is zebra fish serum after CpG-ODN-C5 stimulation
Iron concentration variation.
Fig. 5 is the immanoprotection action that CpG-ODN-C4 and CpG-ODN-C5 enhancing zebra fish resists Aeromonas hydrophila；A
It is counted for zebra fish survival number under the conditions of A.h bacterial invasion after CpG-ODN-C4 stimulation, B is that A.h is thin after CpG-ODN-C5 is stimulated
Zebra fish survival number counts under bacterium infection condition, and C is zebra fish survival number under the conditions of V.a bacterial invasion after CpG-ODN-C4 stimulation
Statistics, D are that zebra fish survival number counts under the conditions of V.a bacterial invasion after CpG-ODN-C5 is stimulated.
(5) specific embodiment
The present invention is described further combined with specific embodiments below, but protection scope of the present invention is not limited in
This:
Embodiment 1, design and synthesis with the potential CpG-ODN sequence for activating fish Hepcidin ability to express:
CpG-ODN designed by the present invention is that slant acidity is modified without methylation, the widow of part or complete sequence thio-modification
Nucleotide fragments, the sequence of designed various CpG-ODN is shown in Table 1, and (title is labeled as character and digit, and letter represents its CpG-
ODN type, thio-modification site font-weight).CpG-ODN sequence utilizes Germany by Shanghai Jierui Biology Engineering Co., Ltd
The 96 column DNA/RNA synthetic work station PolyGen is on behalf of synthesis.
CpG-ODN sequence designed by 1. present invention of table
Embodiment 2, fluorescence quantitative RT-RCR detect various CpG-ODN to the inducing action of zebra fish Hepcidin:
The zebra fish (3-4 grams of weight) that fish is laboratory breeding is tested, raising is in 28 DEG C of constant temperature Rearing facilities of standard, experiment
Preceding training is simultaneously observed 2 weeks, is tested after confirmation health.Artificial synthesized various CpG-ODN is diluted to 1.0 μ with sterilizing PBS
The concentration of M, injects adult zebra fish in a manner of intraperitoneal injection respectively, and volume injected is 10 μ L.Extract the liver of zebra fish afterwards for 24 hours
Dirty tissue, another setting is using the zebra fish liver organization that the PBS of same volume is injected as negative control.According to Trizol kit
Explanation, extract total serum IgE from zebra fish liver, it is using the 3-Full RACE Core Set kit of TaKaRa that RNA is inverse
It is transcribed into cDNA.Using the cDNA as template, with primer Hepcidin F1, R1 to the transcriptional expression water of antibacterial peptide Hepcidin
It is flat to carry out quantitative fluorescent PCR (hereinafter referred to as qPCR) detection.Fluorescent quantitative PCR system composition is shown in Table 2；PCR primer is shown in Table
3；QPCR program are as follows: 95 DEG C initial denaturation 3 minutes, 95 DEG C be denaturalized 15 seconds, 60 DEG C anneal 15 seconds, 72 DEG C extend 20 seconds, totally 40 are followed
Ring, using the expression of β-actin as internal reference, qPCR result is with 2-ΔΔCtRelative expression's difference of value method processing analysis Hepcidin.
The results show that same concentration stimulation under conditions of, the present invention designed by CpG-ODN-C4 and CpG-ODN-C5CpG-ODN pairs
The induction stimulation highest of Hepcidin expression, compared with other experimental groups, conspicuousness has raised Hepcidin expression (figure
1).Note: " * " number indicates there is significant difference (P < 0.05) between data.
2. zebra fish Hepcidin qPCR amplification system of table
3. zebra fish Hepcidin qPCR primer of table
The dose-dependent effect of embodiment 3, CpG-ODN-C4 and CpG-ODN-C5 induction Hepcidin expression
Respectively with the concentration (by artificial synthesized CpG-ODN sterilizing PBS dilution) of 0.5 μ g, 1.0 μ g and 1.5 μ g, will close
At CpG-ODN-C4 and CpG-ODN-C5 be injected intraperitoneally adult zebra fish, injection volume be 10 μ L；Control group separately is set, i.e., with 10 μ L
Sterile physiological saline solution (PBS) be injected intraperitoneally adult zebra fish.24 hours after injection, respectively extract zebra fish liver organization with
Blood.Liver rna extracts and reverse transcription and fluorescence quantitative PCR detection process are with 2 content of embodiment, related qPCR system referring to
Table 2, Hepcidin primer sequence is referring to table 3.Blood centrifuging and taking serum after 4 DEG C of standing 4h, in ELISA method measurement serum
Hepcidin protein concentration；Serum is subjected to Western Blot detection simultaneously.
ELISA tests coating buffer are as follows: Na2CO31.59g NaHCO32.94g, distilled water are settled to 1L and adjust the pH value to be
9.6.Confining liquid are as follows: 0.05g BSA and 10 μ L Tween-20 is added in 1L PBS.Substrate solution are as follows: prepare substrate buffer solution
Na2HPO4·12H2O 9.2g adding citric acid 2.35g adds water to be settled to 500mL and adjusts pH to 5.0.Substrate buffer solution 9.5mL is taken to add
The H of TMB 0.5mL and 40 μ L 0.75%2O2It is that (substrate solution need to now match substrate solution, prepare and complete to make in 15 minutes after mixing
With).ELISA experiment uses antigen (Hepcidin in serum) coated indirect method: each serum group is measured into protein concentration, it is dense
Degree is coated with 12 hours with 1 to 100 extension rate with 4 DEG C of coating buffer after being adjusted to unanimously, the rabbit then prepared using this laboratory
Anti- Hepcidin polyclonal antibody and goat anti-rabbit igg-HRP purchased from Promega company carry out ELISA experiment, and substrate solution is aobvious
Color reads the numerical value of each experimental port light absorption value OD450 and OD630 using microplate reader after terminating, the numerical value of every hole OD450 is subtracted
It is the relative concentration values of Hepcidin in test serum after the numerical value of OD630.Western blot tests confining liquid are as follows: 10mL
5mg BSA is added in PBS.Developing solution are as follows: select the bottom Immobilon Western HRP for being purchased from U.S. Millipore company
Object chemical luminescence reagent kit (A liquid and B liquid equal proportion are mixed and used).
The results show that it is significant to inject post-stimulatory zebra fish Hepcidin expression quantity through CpG-ODN-C4 and CpG-ODN-C5
Rise, and there is concentration dose effect (Fig. 2) to the stimulation of two kinds of CpG-ODN.Note: " * " number indicates have conspicuousness poor between data
Different (P < 0.05), " * * " number indicate there is extremely significant difference (P < 0.01) between data.
The antibacterial action for the Hepcidin that embodiment 4, CpG-ODN-C4 and CpG-ODN-C5 are induced
The serum induced through CpG-ODN-C4 and CpG-ODN-C5 is handled using anti-Hepcidin antibody, measurement serum is antibacterial
The variation of ability, the antibacterial action for the Hepcidin that analysis CpG-ODN-C4 and CpG-ODN-C5 is induced.
Two groups of adult zebra fish are taken, wherein one group of 20 tail, 10 μ L PBS are injected intraperitoneally as control in every tail；Another group takes 40
CpG-ODN-C4 designed by the present invention of 1.5 μ g (PBS dilution) and CpG-ODN-C5 is injected intraperitoneally as experiment in tail, every tail
Group, injection volume are 10 μ L.It takes a blood sample after 24 hours from each group zebra fish, by centrifuging and taking serum after 4 DEG C of standing 4h of blood.By experimental group
Serum is bisected into two parts, and a serum is without any processing stand-by；It is 1:1000 that another serum is mixed into titre potency in equal volume
Rabbit-anti Hepcidin polyclonal antibody, after being reacted 2 hours under the conditions of 37 DEG C (make rabbit-anti Hepcidin polyclonal antibody and warp
The post-stimulatory zebra fish serum of CpG-ODN-C4 and CpG-ODN-C5 is reacted) it is stand-by.It separately will be thermophilic in logarithmic growth phase
Hydrophila (A.h) is inoculated in three pipe LB culture solutions (every pipe contains LB liquid medium 2mL) in equal volume, measures each after being inoculated with
It is consistent to manage real-time bacterial concentration Colony Forming Unit value (CFU).Above-mentioned three kinds of zebra fish serums (are compareed, do not processed
Experimental group serum and the processing of rabbit-anti Hepcidin polyclonal antibody experimental group serum) be separately added into three pipe culture mediums it is (every
It is 100 μ L that serum amount, which is added, in pipe), to be cultivated under conditions of 37 DEG C, 200rpm in constant-temperature table.1,3,6,9 and 12 after culture
Hour respectively takes 100 μ L culture solutions to measure bacterial concentration CFU value respectively.Experiment is repeated 3 times.
The results show that through CpG-ODN-C4 (A in Fig. 3) or CpG-ODN-C5 (B in Fig. 3) stimulation after zebra fish serum suppression
Bacterium ability is obviously improved；But the bacteriostasis of the zebra fish serum after Hepcidin antibody neutralisation treatment then receives
Inhibit.Show that the Hepcidin in zebra fish serum plays a role during inhibiting Aeromonas hydrophila activity.Note: " * "
Number indicate there is significant difference (P < 0.05) between data, " * * " number indicates there is extremely significant difference (P < 0.01) between data.
Embodiment 5, CpG-ODN-C4 and CpG-ODN-C5 induction zebra fish serum iron ion content decline
Take two groups of adult zebra fish, every group of each 10 tail.Wherein 10 μ L, 1.5 μ g institute of the present invention are injected intraperitoneally in one group of every fish
CpG-ODN-C5 designed by 10 μ L, the 1.5 μ g present invention is injected intraperitoneally in the CpG-ODN-C4 of design, another group of every fish；Control
Group sets PBS and blank control, takes blood afterwards for 24 hours, takes and centrifugal blood is taken serum after blood, serum is small through 60 DEG C of 65% nitric acid processing 2
When after using icp ms (ICP-MS) measure iron concentration, experiment is repeated 3 times.The results show that PBS
The iron content of group is in 22-24ppm or so, and CpG-ODN-C4 and the iron content of CpG-ODN-C5 stimulation group be in 15ppm or so,
Without significant difference between PBS group and control group, and significant decrease is presented in iron concentration to CpG stimulation group compared with the control group
(Fig. 4).Note: " * " number indicates there is significant difference (P < 0.05) between data.
The immunity protection function of embodiment 6, CpG-ODN-C4 and CpG-ODN-C5
Take eight groups of adult zebra fish, every group of each 30 tail.CpG-ODN-C4 and CpG-ODN-C5 is injected intraperitoneally in experimental group respectively
The sterile PBS of same volume is injected intraperitoneally in (every 10 μ L of tail, 1.5 μ g), control group.By experimental group, the zebra fish of control group after 12h
10 μ L/CFU 1.0 × 10 are injected intraperitoneally respectively6Aeromonas hydrophila (Aeromonas hydrophila, A.h, bacterium numbering
1.927, it is purchased from China General Microbiological culture presevation administrative center (China General Microbiological
Culture Collection Center, CGMCC)) (A in Fig. 5) and 10 μ L/CFU 1.5 × 106Vibrio alginolyticus (Vibrio
Alginolyticus, V.a, bacterium numbering ATCC 17749, source is with A.h bacterium) (B in Fig. 5), control group does not do any
Processing.Since for 24 hours, every the survival rate of statistics zebra fish for 24 hours, and calculates and injected CpG-ODN-C4's or CpG-ODN-C5
Zebra fish group various time points (0d~6d) relative immunity protective rate (the 1- experimental group death rate/control group death rate ×
100%), test is repeated 3 times.The results show that relative to the zebra fish for not injecting CpG-ODN-C4 or CpG-ODN-C5, injection
The zebra fish of CpG-ODN-C4 or CpG-ODN-C5 death rate after by A.h bacterium infection is substantially reduced, wherein CpG-ODN-C5
Experimental group has nearly 24% relative immunity protective rate relative to control group；CpG-ODN-C4 experimental group also has relative to control group
20% relative immunity protective rate.Its immune protective rate is obviously improved (P < 0.05)；And control group is then during the experiment
Phenomenon of not falling ill (table 4).Note: " * " number indicates there is significant difference (P < 0.05) between data, and " * * " number indicates there is pole between data
Significant difference (P < 0.01).
Immune protective rate of the 4. two kinds of CpG-ODN of table to A.h or bacterium infection zebra fish
In conclusion CpG-ODN-C4 and CpG-ODN-C5 through design synthesis inject adult zebra fish in the present invention, it can
The immune antibacterial response that efficient activation zebra fish Hepcidin expression and Hepcidin are mediated.It is this safe and efficient, environmental-friendly
The nucleic acid immune disease-resistance preparation of type will provide one for the research of exploitation novel fish disease-resistant drug and novel fish vaccine
A completely new direction.
It should be noted that several specific examples only of the invention that the above experiment is enumerated, it is clear that the present invention is also
Many deformations, all deformations that those skilled in the art directly can export or associate from present disclosure,
It is considered as protection scope of the present invention.
SEQUENCE LISTING
<110>Zhejiang University
<120>a kind of fish Hepcidin expression promotor and its application
<130>
<160> 19
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 1
ggtcggacgt tcgagggggg 20
<210> 2
<211> 20
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 2
ggtcggtcgt tcgagggggg 20
<210> 3
<211> 20
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 3
ggtcgaacgt tcgagggggg 20
<210> 4
<211> 20
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 4
ggtcggtcgt ccgagggggg 20
<210> 5
<211> 20
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 5
ggtcgacggg tcgagggggg 20
<210> 6
<211> 20
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 6
tcgtcggacg ttacgtcgtt 20
<210> 7
<211> 20
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 7
tcgtcggtcg ttacgtcgtt 20
<210> 8
<211> 20
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 8
tcgtcgaacg ttacgtcgtt 20
<210> 9
<211> 20
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 9
tcgtcggtcg tcacgtcgtt 20
<210> 10
<211> 20
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 10
tcgtcgacgg gtacgtcgtt 20
<210> 11
<211> 24
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 11
tcgtcgtcga tcgatcgagt cgtt 24
<210> 12
<211> 24
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 12
tcgtcgtcga ccggtgcagt cgtt 24
<210> 13
<211> 24
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 13
tcgtcgtcga tcgatgcagt cgtt 24
<210> 14
<211> 24
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 14
tcgtcgtcga gcgaggcagt cgtt 24
<210> 15
<211> 24
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 15
gtcgtttcga cgggtgcagt cgtt 24
<210> 16
<211> 22
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 16
tcgtcggacg tttcgagtcg tt 22
<210> 17
<211> 22
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 17
tcgtcggtcg tttcgagtcg tt 22
<210> 18
<211> 22
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 18
tcgtcgaacg tttcgagtcg tt 22
<210> 19
<211> 22
<212> DNA
<213> unknown
<220>
<223>artificial sequence
<400> 19
tcgtcggtcg tctcgagtcg tt 22
Claims (4)
1. a kind of fish Hepcidin expresses promotor, it is characterised in that the promotor is one of following: CpG-ODN-C4:
TCGTCGTCGAGCGAGGCAGTCGTT and
CpG-ODN-C5:GTCGTTTCGACGGGTGCAGTCGTT.
2. a kind of expression promotor of fish Hepcidin described in claim 1 is preparing the application in immune formulation.
3. application as claimed in claim 2, it is characterised in that the immune formulation is Aeromonas hydrophila (Aeromonas
Hydrophila) infection immunity inhibitor.
4. application as claimed in claim 2, it is characterised in that the immune formulation is vibrio alginolyticus (Vibrio
Alginolyticus) infection immunity inhibitor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610978521.3A CN106636115B (en) | 2016-11-08 | 2016-11-08 | A kind of fish Hepcidin expression promotor and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610978521.3A CN106636115B (en) | 2016-11-08 | 2016-11-08 | A kind of fish Hepcidin expression promotor and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106636115A CN106636115A (en) | 2017-05-10 |
| CN106636115B true CN106636115B (en) | 2019-05-31 |
Family
ID=58805748
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610978521.3A Active CN106636115B (en) | 2016-11-08 | 2016-11-08 | A kind of fish Hepcidin expression promotor and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636115B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112080504A (en) * | 2020-07-23 | 2020-12-15 | 浙江理工大学 | CG island oligonucleotide with immunostimulation capability of aquaculture animals and application thereof |
| CN112080505A (en) * | 2020-07-23 | 2020-12-15 | 杭州华缔集团有限公司 | CG island oligonucleotide with piglet immunostimulation capacity and application thereof in feed additive |
-
2016
- 2016-11-08 CN CN201610978521.3A patent/CN106636115B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| Bacterial Cell Wall Constituents Induce Hepcidin Expression in Macrophages Through MyD88 Signaling;Antonio Layoun 等;《Inflammation》;20120804;第35卷(第4期);第1500-1506页 |
| Hepcidin、铁和炎症相互关系的初步研究;潘新民;《中国优秀硕士学位论文全文数据库医药卫生科技辑》;20110715(第07期);第E059-22页 |
| Iron Regulator Hepcidin Exhibits Antiviral Activity against Hepatitis C Virus;Hongyan Liu 等;《plos one》;20121031;第7卷(第10期);第1-8页 |
| 罗非鱼免疫学研究进展;甘桢 等;《生物技术通报》;20141231(第11期);第32-39页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106636115A (en) | 2017-05-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cornelissen et al. | Differential innate responses of chickens and ducks to low-pathogenic avian influenza | |
| Yan et al. | Molecular characterization and function of a p38 MAPK gene from Litopenaeus vannamei | |
| CN103060326A (en) | Six oligonucleotide sequences and application thereof | |
| Hu et al. | Identification, characterization and immunological analysis of Ras related C3 botulinum toxin substrate 1 (Rac1) from grass carp Ctenopharyngodon idella | |
| CN106636115B (en) | A kind of fish Hepcidin expression promotor and its application | |
| Guo et al. | The efficacy of lactic acid bacteria usage in turbot Scophthalmus maximus on intestinal microbiota and expression of the immune related genes | |
| Chen et al. | Cgi-miR-92d indirectly regulates TNF expression by targeting CDS region of lipopolysaccharide-induced TNF-α factor 3 (CgLITAF3) in oyster Crassostrea gigas | |
| CN107916264B (en) | dsRNA (double-stranded ribonucleic acid) of wing development related gene vestigial and application of dsRNA in controlling bactrocera dorsalis | |
| CN101831444B (en) | Insect chitin synthetase 1 gene fragment and dsRNA and application thereof | |
| CN102352356B (en) | Bcl11a siRNA-2292 restraining expression of BCL11A and proliferation of tumorous B cells and application thereof | |
| CN104450755B (en) | The application of a kind of Asiatic migrotory locust atp synthase α subunit genes and its dsRNA in control of insect | |
| KR101839260B1 (en) | Avian influenza virus miRNA, and appraisal, detection, and application thereof | |
| CN104404042B (en) | The application of a kind of Asiatic migrotory locust atp synthase beta subunit gene and its dsRNA in control of insect | |
| CN106434680B (en) | A kind of shrimps masculine gene and its application | |
| CN104694535A (en) | Non-coding RNA of in-vivo infecting microorganism, parasitic microorganism, symbiotic microorganism, as well as identification and application thereof | |
| CN102517295A (en) | DNA sequence, interfering RNA and application of DNA sequence and interfering RNA in pest control | |
| CN103695421A (en) | SiRNA (Ribonucleic Acid) for specifically inhibiting p21 gene expression and application thereof | |
| Li et al. | Scallop NEMO interacts with IKK1 and regulates host innate immunity against PAMPs | |
| Liu et al. | HD-13 Induces Swine Pneumonia Progression via Activation of TLR9 | |
| CN102382813A (en) | Systematic evolution of ligands by exponential enrichment (SELEX) technical method aiming at electrophoresis gel retardation of liquid-phase non-purification composite targets | |
| CN107641658B (en) | Method for detecting insect life by using heat shock protein Hsp70 gene and application | |
| CN102108369A (en) | Application of DNA repair protein RAD51 in preparing medicament for treating osteosarcoma | |
| CN105457030A (en) | Application of B2M in serving as treatment target of ovarian cancer | |
| CN103276084A (en) | Method for detecting bastard halibut LITAF gene expression by applying reverse transcription-polymerase chain reaction (RT-PCR) | |
| Ren et al. | Trained immunity can improve the disease resistance of red swamp crayfish (Procambarus clarkii) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |