CN106609302A - Kit for auxiliary diagnosis of mitochondria diabetes - Google Patents
Kit for auxiliary diagnosis of mitochondria diabetes Download PDFInfo
- Publication number
- CN106609302A CN106609302A CN201510702679.3A CN201510702679A CN106609302A CN 106609302 A CN106609302 A CN 106609302A CN 201510702679 A CN201510702679 A CN 201510702679A CN 106609302 A CN106609302 A CN 106609302A
- Authority
- CN
- China
- Prior art keywords
- sequence
- snp sites
- primer
- under test
- person under
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kit for auxiliary diagnosis of mitochondria diabetes. The kit for auxiliary diagnosis of the mitochondria diabetes comprises a first product and/or a second product; the first product comprises matter used for detecting a genotype of mitochondrial genomes of a tested person based on a G3337A SNP locus, and the G3337A SNP locus is 151th nucleotide from the 5' tail end in a segment shown in the sequence 1 of a sequence table in mitochondrial genome DNA of the person; and the second product comprises matter used for detecting a genotype of the mitochondrial genomes of the tested person based on a T14674C SNP locus, and the T14674C SNP locus is 151th nucleotide from the 5' tail end in a segment shown in the sequence 2 of the sequence table in mitochondrial genome DNA of the person. Experiments prove that by means of the kit for auxiliary diagnosis of the mitochondria diabetes, auxiliary diagnosis of the mitochondria diabetes can be achieved, the high accuracy is achieved, and the kit has great values on diagnosis and treatment of the mitochondria diabetes.
Description
Technical field
The present invention relates to biomedical sector, and in particular to a kind of test kit of auxiliary diagnosis diabetes of chondriosome.
Background technology
Diabetes of chondriosome is a kind of specific type diabetes, clinically there is a feature sex expression, such as age of onset morning, maternal inheritance,
Without obesity, deafness and pathological investigation of neuromuscular impairment are often accompanied by, insulin secretion is substantially not enough, diabetic complication easily occur,
Due to mitochondrial function defect, easily there are lactic acidosis.In treatment, oral drugs weak curative effect needs in early days insulin to control
Treat, biguanide antidiabetic medicament (lactic acidosis easily occur) need to be used with caution, carefully using statinses and ototoxic drug (nerve
Muscle damage).However, the diagnosis of this type diabetes finally needs gene diagnosises, i.e. mitochondrial mutations detection, mitochondrion to dash forward
Become detection and contribute to early stage and diagnosed, formulate the therapeutic scheme of individuation, and judging prognosis, it helps avoid medicine from controlling
Treat and potential untoward reaction occurs.Such as, statinses are the conventional fat-reducing medicaments of diabeticss, and band muscle injury is it
One of untoward reaction, if it find that the patient with mitochondrial mutations, should just lack dosage and start, close observation.Still lack at present
The product of weary mitochondrial mutations detection, instructs diabetes diagnosis typing.
Before mitochondrion abrupt climatic change, many diabetes of chondriosome patients are misdiagnosed as type 1 diabetes or type 2 diabetes mellitus.At present
Research finds that A1555G SNP sites are related to deafness, and G3337A SNP sites are related to cardiomyopathy, T14674 C SNP sites
It is related to myopathy.
The content of the invention
Problem to be solved by this invention is auxiliary diagnosis diabetes of chondriosome.
To solve the above problems, present invention firstly provides a kind of product first of auxiliary diagnosis diabetes of chondriosome.
The product first of the auxiliary diagnosis diabetes of chondriosome may include for detecting that person under test's mitochondrial genome is based on G3337A
The material of the genotype of SNP site;The G3337A SNP sites can be the sequence of the sequence table in people mitochondrial genome DNA
From the nucleotide of 5 ' ends the 151st in section shown in row 1.
It is described to may include for expanding for detecting that person under test's mitochondrial genome is based on the material of the genotype of G3337A SNP sites
Increase the pcr amplification primer thing pair of the target sequence containing the G3337A SNP sites and/or for detecting the G3337A SNP
The typing detection primer in site.The typing detection primer concretely detects the G3337A by single base extension
The primer of SNP site.
In the said goods first, it is described for detect person under test's mitochondrial genome based on G3337A SNP sites genotype thing
Matter may include for the pcr amplification primer thing pair of target sequence of the amplification containing the G3337A SNP sites and/or for detecting
State the typing detection primer of G3337A SNP sites;The target sequence for containing the G3337A SNP sites for amplification
Pcr amplification primer thing pair can be by the primer shown in the sequence 13 of the primer 3337F shown in the sequence 12 of sequence table and sequence table
3337R is constituted;The typing detection primer for detecting the G3337A SNP sites can be the institute of sequence 34 of sequence table
The primer 3337UEP for showing.
The product first may also include the carrier 1 for recording following criterion:If person under test's mitochondrial genome is based on
The genotype of G3337A SNP sites is GA heterozygous, person under test is or candidate is the patient with diabetes of chondriosome, such as
Genotype of the fruit person under test mitochondrial genome based on G3337A SNP sites is that GG is homozygous, patient to be measured is not or candidate
It is not the patient with diabetes of chondriosome.
The present invention also provides a kind of product second of auxiliary diagnosis diabetes of chondriosome.The product second may include for detecting person under test
Material of the mitochondrial genome based on the genotype of T14674C SNP sites;The T14674C SNP sites can be people's line grain
From the nucleotide of 5 ' ends the 151st in section shown in the sequence 2 of the sequence table in body genomic DNA.
For detecting that person under test's mitochondrial genome may include for expanding based on the material of the genotype of T14674C SNP sites
The pcr amplification primer thing pair of the target sequence containing the T14674C SNP sites and/or for detecting the T14674C SNP
The typing detection primer in site.The typing detection primer concretely detects the T14674C by single base extension
The primer of SNP site.
It is described for detecting genotype of person under test's mitochondrial genome based on T14674C SNP sites in the said goods second
Material may include for the pcr amplification primer thing pair of target sequence of the amplification containing the T14674C SNP sites and/or for examining
Survey the typing detection primer of the T14674C SNP sites;The target for containing the T14674C SNP sites for amplification
The pcr amplification primer thing pair of sequence can be by shown in the sequence 15 of the primer 14674F shown in the sequence 14 of sequence table and sequence table
Primer 14674R composition;The typing detection primer for detecting the T14674C SNP sites can be sequence table
Primer 14674UEP shown in sequence 35.
The product second may also include the carrier 1 for recording following criterion:If person under test's mitochondrial genome is based on
The genotype of T14674C SNP sites is TC heterozygous, person under test is or candidate is the patient with diabetes of chondriosome, such as
Genotype of the fruit person under test mitochondrial genome based on T14674C SNP sites is that TT is homozygous, patient to be measured is not or candidate
It is not the patient with diabetes of chondriosome.
Present invention also offers a kind of test kit of auxiliary diagnosis diabetes of chondriosome, the test kit includes any of the above-described product
Product first and/or any of the above-described product second.
The test kit may also include the thing for detecting person under test's mitochondrial genome based on the genotype of A1555G SNP sites
Matter, for detect person under test's mitochondrial genome based on A3243G SNP sites genotype material, for detecting person under test
Mitochondrial genome is based on the material of the genotype of T3264C SNP sites, for detecting that person under test's mitochondrial genome is based on
The material of the genotype of T3271C SNP sites, for detect person under test's mitochondrial genome based on T4291C SNP sites base
Because type material, for detect person under test's mitochondrial genome based on A8296G SNP sites genotype material, for examining
Person under test's mitochondrial genome is surveyed based on the material of the genotype of C12258A SNP sites, for detecting person under test's mitochondrial gene
Group is based on the material of the genotype of T14709C SNP sites and/or for detecting that person under test's mitochondrial genome is based on T14577C
The material of the genotype of SNP site;
It is last from 5 ' in section shown in the sequence 3 of the sequence table in the A1555G SNP sites behaviour mitochondrial genome DNA
Hold the 151st nucleotide;Area shown in the sequence 4 of the sequence table in the A3243G SNP sites behaviour mitochondrial genome DNA
From the nucleotide of 5 ' ends the 151st in section;Sequence table in the T3264C SNP sites behaviour mitochondrial genome DNA
From the nucleotide of 5 ' ends the 151st in section shown in sequence 5;The T3271C SNP sites behaviour mitochondrial genome DNA
In sequence table sequence 6 shown in section from the nucleotide of 5 ' ends the 151st;The T4291C SNP sites behaviour line grain
From the nucleotide of 5 ' ends the 151st in section shown in the sequence 7 of the sequence table in body genomic DNA;The A8296G SNP
From the nucleotide of 5 ' ends the 151st in section shown in the sequence 8 of the sequence table in site behaviour mitochondrial genome DNA;Institute
State in section shown in the sequence 9 of sequence table in C12258A SNP site behaviour mitochondrial genome DNA from 5 ' ends the 151st
Position nucleotide;In section shown in the sequence 10 of the sequence table in the T14709C SNP sites behaviour mitochondrial genome DNA
From the nucleotide of 5 ' ends the 151st;The sequence of the sequence table in the T14577C SNP sites behaviour mitochondrial genome DNA
From the nucleotide of 5 ' ends the 151st in section shown in row 11.
It is described to may include for expanding for detecting that person under test's mitochondrial genome is based on the material of the genotype of A1555G SNP sites
Increase the pcr amplification primer thing pair of the target sequence containing the A1555G SNP sites and/or for detecting the A1555G SNP
The typing detection primer in site;The pcr amplification primer thing for target sequence of the amplification containing the A1555G SNP sites
Pair can be made up of the primer 1555R shown in the sequence 17 of the primer 1555F shown in the sequence 16 of sequence table and sequence table;Institute
It can be the primer shown in the sequence 36 of sequence table to state the typing detection primer for detecting the A1555G SNP sites
1555UEP.It is described to may include to use for detecting that person under test's mitochondrial genome is based on the material of the genotype of A3243G SNP sites
In the pcr amplification primer thing pair of target sequence of the amplification containing the A3243G SNP sites and/or for detecting the A3243G SNP
The typing detection primer in site;The pcr amplification primer thing pair for target sequence of the amplification containing the A3243G SNP sites
Can be made up of the primer 3243R shown in the sequence 19 of the primer 3243F shown in the sequence 18 of sequence table and sequence table;It is described
For detecting that the typing detection primer of the A3243G SNP sites can be the primer 3243UEP shown in the sequence 37 of sequence table.
It is described to may include for expanding for detecting that person under test's mitochondrial genome is based on the material of the genotype of T3264C SNP sites
Increase the pcr amplification primer thing pair of the target sequence containing the T3264C SNP sites and/or for detecting the T3264C SNP positions
The typing detection primer of point;The pcr amplification primer thing pair for target sequence of the amplification containing the T3264C SNP sites can
Primer 3264F shown in the sequence 20 of sequence table and the primer 3264R shown in the sequence 21 of sequence table are constituted;The use
In the typing detection primer for detecting the T3264C SNP sites can be the primer 3264UEP shown in the sequence 38 of sequence table.
It is described to may include for expanding for detecting that person under test's mitochondrial genome is based on the material of the genotype of T3271C SNP sites
Increase the pcr amplification primer thing pair of the target sequence containing the T3271C SNP sites and/or for detecting the T3271C SNP positions
The typing detection primer of point;The pcr amplification primer thing pair for target sequence of the amplification containing the T3271C SNP sites can
Primer 3271F shown in the sequence 22 of sequence table and the primer 3271R shown in the sequence 23 of sequence table are constituted;The use
In the typing detection primer for detecting the T3271C SNP sites can be the primer 3271UEP shown in the sequence 39 of sequence table.
It is described to may include for expanding for detecting that person under test's mitochondrial genome is based on the material of the genotype of T4291C SNP sites
Increase the pcr amplification primer thing pair of the target sequence containing the T4291C SNP sites and/or for detecting the T4291C SNP positions
The typing detection primer of point;The pcr amplification primer thing pair for target sequence of the amplification containing the T4291C SNP sites
Can be made up of the primer 4291R shown in the sequence 25 of the primer 4291F shown in the sequence 24 of sequence table and sequence table;It is described
For detecting that the typing detection primer of the T4291C SNP sites can be the primer 4291UEP shown in the sequence 40 of sequence table.
It is described to may include for expanding for detecting that person under test's mitochondrial genome is based on the material of the genotype of A8296G SNP sites
Increase the pcr amplification primer thing pair of the target sequence containing the A8296G SNP sites and/or for detecting the A8296G SNP positions
The typing detection primer of point;The pcr amplification primer thing pair for target sequence of the amplification containing the A8296G SNP sites can
Primer 8296F shown in the sequence 26 of sequence table and the primer 8296R shown in the sequence 27 of sequence table are constituted;The use
In the typing detection primer for detecting the A8296G SNP sites can be the primer 8296UEP shown in the sequence 41 of sequence table.
It is described for detect person under test's mitochondrial genome based on C12258A SNP sites genotype material may include for
Amplification contains the pcr amplification primer thing pair of the target sequence of the C12258A SNP sites and/or for detecting the C12258A SNP
The typing detection primer in site;The pcr amplification primer thing for target sequence of the amplification containing the C12258A SNP sites
Pair can be made up of the primer 12258R shown in the sequence 29 of the primer 12258F shown in the sequence 28 of sequence table and sequence table;
The typing detection primer for detecting the C12258A SNP sites can be the primer shown in the sequence 42 of sequence table
12258UEP。
It is described for detect person under test's mitochondrial genome based on T14709C SNP sites genotype material may include for
Amplification contains the pcr amplification primer thing pair of the target sequence of the T14709C SNP sites and/or for detecting the T14709C SNP
The typing detection primer in site;The pcr amplification primer thing for target sequence of the amplification containing the T14709C SNP sites
Pair can be made up of the primer 14709R shown in the sequence 31 of the primer 14709F shown in the sequence 30 of sequence table and sequence table;
The typing detection primer for detecting the T14709C SNP sites can be the primer shown in the sequence 43 of sequence table
14709UEP。
It is described for detect person under test's mitochondrial genome based on T14577C SNP sites genotype material may include for
Amplification contains the pcr amplification primer thing pair of the target sequence of the T14577C SNP sites and/or for detecting the T14577C SNP
The typing detection primer in site;The pcr amplification primer thing for target sequence of the amplification containing the T14577C SNP sites
Pair can be made up of the primer 14577R shown in the sequence 33 of the primer 14577F shown in the sequence 32 of sequence table and sequence table;
The typing detection primer for detecting the T14577C SNP sites can be the primer shown in the sequence 44 of sequence table
14577UEP。
The test kit may also include the carrier 3 for recording following criterion:If person under test's mitochondrial genome is based on
The genotype of A1555G SNP sites is that GG is homozygous, person under test is or candidate is the patient with diabetes of chondriosome, such as
Genotype of the fruit person under test mitochondrial genome based on A1555G SNP sites be that AA is homozygous, person under test is not or candidate not
It is the patient with diabetes of chondriosome.
The test kit may also include the carrier 4 for recording following criterion:If person under test's mitochondrial genome is based on
The genotype of A3243G SNP sites is AG heterozygous, person under test is or candidate is the patient with diabetes of chondriosome, if
Genotype of person under test's mitochondrial genome based on A3243G SNP sites is that AA is homozygous, person under test is not or candidate is not
Patient with diabetes of chondriosome.
The test kit may also include the carrier 5 for recording following criterion:If person under test's mitochondrial genome is based on
The genotype of T3264C SNP sites is that CC is homozygous or CT heterozygous, person under test are or candidate is with diabetes of chondriosome
Patient, if genotype of person under test's mitochondrial genome based on T3264C SNP sites be that TT is homozygous, person under test not
For or candidate be not the patient with diabetes of chondriosome.
The test kit may also include the carrier 6 for recording following criterion:If person under test's mitochondrial genome is based on
The genotype of T3271C SNP sites is that CC is homozygous or CT heterozygous, person under test are or candidate is with diabetes of chondriosome
Patient, if genotype of person under test's mitochondrial genome based on T3271C SNP sites be that TT is homozygous, person under test not
For or candidate be not the patient with diabetes of chondriosome.
The test kit may also include the carrier 7 for recording following criterion:If person under test's mitochondrial genome is based on
The genotype of T4291C SNP sites is that CC is homozygous or CT heterozygous, person under test are or candidate is with diabetes of chondriosome
Patient, if genotype of person under test's mitochondrial genome based on T4291C SNP sites be that TT is homozygous, person under test not
For or candidate be not the patient with diabetes of chondriosome.
The test kit may also include the carrier 8 for recording following criterion:If person under test's mitochondrial genome is based on
The genotype of A8296G SNP sites is that GG is homozygous or AG heterozygous, person under test are or candidate is with diabetes of chondriosome
Patient, if genotype of person under test's mitochondrial genome based on A8296G SNP sites be that AA is homozygous, person under test not
For or candidate be not the patient with diabetes of chondriosome.
The test kit may also include the carrier 9 for recording following criterion:If person under test's mitochondrial genome is based on
The genotype of C12258A SNP sites is that AA is homozygous or CA heterozygous, person under test are or candidate is with mitochondrion glycosuria
The patient of disease, if genotype of person under test's mitochondrial genome based on C12258A SNP sites is that CC is homozygous, person under test
It is not or candidate is not the patient with diabetes of chondriosome.
The test kit may also include the carrier 10 for recording following criterion:If person under test's mitochondrial genome is based on
The genotype of T14709C SNP sites is that CC is homozygous or TC heterozygous, person under test are or candidate is with mitochondrion glycosuria
The patient of disease, if genotype of person under test's mitochondrial genome based on T14709C SNP sites is that TT is homozygous, person under test
It is not or candidate is not the patient with diabetes of chondriosome.
The test kit may also include the carrier 11 for recording following criterion:If person under test's mitochondrial genome is based on
The genotype of T14577C SNP sites is that CC is homozygous or TC heterozygous, person under test are or candidate is with mitochondrion glycosuria
The patient of disease, if genotype of person under test's mitochondrial genome based on T14577C SNP sites is that TT is homozygous, person under test
It is not or candidate is not the patient with diabetes of chondriosome.
Any of the above-described product first, any of the above-described product second or any of the above-described test kit are being prepared for auxiliary diagnosis
Application in the test kit of diabetes of chondriosome falls within protection scope of the present invention.
Test result indicate that, can be with auxiliary diagnosis line grain using the test kit of auxiliary diagnosis diabetes of chondriosome provided by the present invention
Body diabetes, with higher accuracy rate, for the diagnosis and treatment of diabetes of chondriosome have substantial worth.
Description of the drawings
Fig. 1 is the sequencing result of the SNP site related to diabetes of chondriosome.
Wherein upper left is A3243G SNP sites, and upper right is A1555G SNP sites, and lower-left is G3337A SNP sites, right
It is down T14674C SNP sites.
Fig. 2 is the sequencing result of the genetic fragment containing SNP site of synthetic.
Wherein, A is T3264C SNP sites, and B is T3271C SNP sites, and C is T4291C SNP sites, and D is A8296G
SNP site, E is C12258A SNP sites, and F is T14709C SNP sites, and G is T14577C SNP sites.
Fig. 3 is the Mass Spectrometer Method peak figure of 11 SNP sites.
Wherein, A is T3264C SNP sites, and B is G3337A SNP sites, and C is T14577C SNP sites, and D is T14709C
SNP site, E is A1555G SNP sites, and F is A3243G SNP sites, and G is T14674C SNP sites, and H is A8296G
SNP site, I is C12258A SNP sites, and J is T3271C SNP sites, and K is T4291C SNP sites.
Specific embodiment
The present invention is further described in detail with reference to specific embodiment, the embodiment for being given is only for illustrating this
Invention, rather than in order to limit the scope of the present invention.
Experimental technique in following embodiments, if no special instructions, is conventional method.
Material used, reagent etc. in following embodiments, if no special instructions, commercially obtain.
Each test in following embodiments is carried out on the premise of each experimenter's informed consent.The Peking University people cure
90 in institute's diabetes Sample Storehouse were diagnosed as patient's (man 61, female 29, year of type 2 diabetes mellitus before 40 years old
35.4 ± 6.4 years old age) Informed Consent Form is signed, and Jing after the approval of Ethics Committee of The People's Hospital of Peking University, tried
Test.
ABI 3730XL sequenators are Applied Biosystems Products, and article No. is 3730xl.
The SNP site related to diabetes of chondriosome of embodiment 1
First, the association analysiss of new SNP site and diabetes of chondriosome
The limosis vein blood 3mL of patient is extracted, with poba gene group extracts kit (the limited public affairs of Beijing Bo Maide gene technology
Department product) extract venous blood genomic DNA, then all fronts plastochondria is carried out to 50 patients therein with secondary sequencing technologies
Remaining 40 patient is carried out full mitochondrial genome sequencing analysis by gene order-checking with ABI 3730XL sequenators, to sending out
Now cause the SNP site of diabetes of chondriosome, verified (see Fig. 1) with ABI 3730XL sequenators.
The full mitochondrial genome of normal healthy people in the full mitochondrial genome sequencing result of 90 patients and data base is surveyed
Sequence result is compared, and finds 4 SNP sites (be shown in Table 1) related to diabetes of chondriosome, respectively G3337A SNP
Site, T14674C SNP sites, A1555G SNP sites and A3243G SNP sites:G3337A SNP sites are sequence table
Sequence 1 from the nucleotide of 5 ' ends the 151st, T14674C SNP sites for sequence table sequence 2 from 5 ' ends the 151st
Position nucleotide, A1555G SNP sites are the sequence 3 of sequence table from the nucleotide of 5 ' ends the 151st, A3243G SNP sites
For sequence table sequence 4 from the nucleotide of 5 ' ends the 151st.It can be seen that, in homo mitochondrion gene group, based on G3337A SNP
Loci gene type is GA heterozygous or GG homozygous (it was found that AA homozygous situation), based on T14674C SNP sites
Genotype is TC heterozygous or TT homozygous (it was found that CC homozygous situation), based on A3243G SNP site genotype
It is AA based on A1555G SNP sites genotype for AG heterozygous or AA homozygous (it was found that GG homozygous situation)
Homozygous or GG homozygous (it was found that situation of GA heterozygous).
The genotype of the SNP site related to diabetes of chondriosome in 1. 90 patients of table
2nd, the screening of existing SNP site
Filtering out 7 relatively generally acknowledged in the world by literature search causes the related site of diabetes of chondriosome, including
T3264C SNP sites, T3271C SNP sites, T4291C SNP sites, A8296G SNP sites, C12258A SNP
Site, T14709C SNP sites and T14577C SNP sites.The result of study of existing human mitochondria gene group is as follows:
Genotype based on T3264C SNP sites is that CC is homozygous or CT heterozygous, person under test are or candidate is with line
The patient of plastochondria diabetes, if person under test's mitochondrial genome based on T3264C SNP sites genotype be TT it is homozygous,
Person under test is not or candidate is not the patient with diabetes of chondriosome;
Genotype based on T3271C SNP sites is that CC is homozygous or CT heterozygous, person under test are or candidate is with line
The patient of plastochondria diabetes, if person under test's mitochondrial genome based on T3271C SNP sites genotype be TT it is homozygous,
Person under test is not or candidate is not the patient with diabetes of chondriosome;
Genotype based on T4291C SNP sites is that CC is homozygous or CT heterozygous, person under test are or candidate is with line
The patient of plastochondria diabetes, if person under test's mitochondrial genome based on T4291C SNP sites genotype be TT it is homozygous,
Person under test is not or candidate is not the patient with diabetes of chondriosome;
Genotype based on A8296G SNP sites is that GG is homozygous or AG heterozygous, person under test are or candidate is with line
The patient of plastochondria diabetes, if person under test's mitochondrial genome based on A8296G SNP sites genotype be AA it is homozygous,
Person under test is not or candidate is not the patient with diabetes of chondriosome;
Genotype based on C12258A SNP sites is that AA is homozygous or CA heterozygous, person under test are or candidate is with line
The patient of plastochondria diabetes, if person under test's mitochondrial genome based on C12258A SNP sites genotype be CC it is homozygous,
Person under test is not or candidate is not the patient with diabetes of chondriosome;
Genotype based on T14709C SNP sites is that CC is homozygous or TC heterozygous, person under test are or candidate is with line
The patient of plastochondria diabetes, if person under test's mitochondrial genome based on T14709C SNP sites genotype be TT it is homozygous,
Person under test is not or candidate is not the patient with diabetes of chondriosome;
Genotype based on T14577C SNP sites is that CC is homozygous or TC heterozygous, person under test are or candidate is with line
The patient of plastochondria diabetes, if person under test's mitochondrial genome based on T14577C SNP sites genotype be TT it is homozygous,
Person under test is not or candidate is not the patient with diabetes of chondriosome.
The SNP site related to diabetes of chondriosome in embodiment 2, detection embodiment 1
First, the preparation of template
(1) genomic DNA of the patient for being 1 will be numbered in step one as template 1, containing such as sequence table in template 1
Human mitochondria gene fragment shown in middle sequence 1.The concentration of genomic DNA is 10ng/ μ L in template 1.
(2) DNA of the patient for being 2 will be numbered in step one as template 2, containing such as sequence 2 in sequence table in template 2
Shown human mitochondria gene fragment.The concentration of genomic DNA is 10ng/ μ L in template 2.
(3) DNA of the patient for being 3 will be numbered in step one as template 3, containing such as sequence 1 in sequence table in template 3
Shown human mitochondria gene fragment.The concentration of genomic DNA is 10ng/ μ L in template 3.
(4) DNA of the patient for being 4 will be numbered in step one as template 4, containing such as sequence 4 in sequence table in template 4
Shown human mitochondria gene fragment.The concentration of genomic DNA is 10ng/ μ L in template 4.
(5) template 5, concrete preparation process following (company assists to complete by promise match genome research centered finite) are prepared:
1. the complete sequence of the human mitochondria gene fragment shown in sequence in sequence table 5 is analyzed, internal whether containing is checked
Complicated secondary structure and repetitive sequence, analytical sequence G/C content, according to the result of sequence analysis, carries out single stranded oligonucleotide
Design and synthesis.
2. the single stranded oligonucleotide that 1. step synthesizes is spliced into the base as shown in sequence 5 in sequence table using grads PCR technology
Because of fragment, and verified with ABI 3730XL sequenators.As a result A in Fig. 2 is seen.
3. the genetic fragment for 2. step being prepared is connected with pMD18-T carriers (Takara Products), obtains recombiant plasmid.
4. the recombinant plasmid transformed bacillus coli DH 5 alpha competent cell for 3. step being prepared, obtains carrying the big of recombiant plasmid
Enterobacteria.
5. the colibacillary plasmid that 4. extraction step obtains, obtains recombinant plasmid dna.
The recombinant plasmid dna that 5. step is extracted is template 5, containing the people's line as shown in sequence 5 in sequence table in template 5
Mitochondrial genes fragment.Template 5 carries T3264C SNP sites, the SNP site for sequence table sequence 5 from 5 ' ends the
Shown in 151 nucleotide.The concentration of recombinant plasmid dna is 10ng/ μ L in template 5.
(6) according to above-mentioned preparation template 5 the step of, sequence in sequence table 5 is replaced with into respectively sequence 6, sequence in sequence table
Sequence 11 in sequence 10 and sequence table in sequence 9, sequence table in sequence 8, sequence table in sequence 7, sequence table in list,
Other steps are constant, respectively obtain template 6, template 7, template 8, template 9, template 10 and template 11.Wherein people
Work synthesizes corresponding genetic fragment and is verified with ABI 3730XL sequenators, and G in B- Fig. 2 is as a result seen in Fig. 2 successively.
Containing the human mitochondria gene fragment as shown in sequence 6 in sequence table in template 6.Template 6 carries T3271C SNP
Site, the SNP site is shown in the sequence 6 from the nucleotide of 5 ' ends the 151st of sequence table.Recombinant plasmid dna in template 6
Concentration be 10ng/ μ L.
Containing the human mitochondria gene fragment as shown in sequence 7 in sequence table in template 7.Template 7 carries T4291C SNP
Site, the SNP site is shown in the sequence 7 from the nucleotide of 5 ' ends the 151st of sequence table.Recombinant plasmid dna in template 7
Concentration be 10ng/ μ L.
Containing the human mitochondria gene fragment as shown in sequence 8 in sequence table in template 8.Template 8 carries A8296G SNP
Site, the SNP site is shown in the sequence 8 from the nucleotide of 5 ' ends the 151st of sequence table.Recombinant plasmid dna in template 8
Concentration be 10ng/ μ L.
Containing the human mitochondria gene fragment as shown in sequence 9 in sequence table in template 9.Template 9 carries C12258A SNP
Site, the SNP site is shown in the sequence 9 from the nucleotide of 5 ' ends the 151st of sequence table.Recombinant plasmid dna in template 9
Concentration be 10ng/ μ L.
Containing the human mitochondria gene fragment as shown in sequence 10 in sequence table in template 10.Template 10 carries T14709C SNP
Site, the SNP site is shown in the sequence 10 from the nucleotide of 5 ' ends the 151st of sequence table.Recombiant plasmid in template 10
The concentration of DNA is 10ng/ μ L.
Containing the human mitochondria gene fragment as shown in sequence 11 in sequence table in template 11.Template 11 carries T14577C
SNP, the SNP site is shown in the sequence 11 from the nucleotide of 5 ' ends the 151st of sequence table.Recombiant plasmid in template 11
The concentration of DNA is 10ng/ μ L.
(7) the limosis vein blood 3mL of normal healthy people is extracted, with poba gene group extracts kit (Beijing Bo Maide genes
Technology Co., Ltd.'s product) extract venous blood genomic DNA.Using the genomic DNA of normal healthy people as template 12.
2nd, the preparation of primer
Compared based on substantial amounts of sequence analysis, screening, checking and effect, designed and synthesized for identifying each SNP site
PCR primer and typing detection primer.
The PCR primer of each SNP site is shown in Table 2, and the typing detection primer of each SNP site is shown in Table 3.
The PCR primer and typing detection primer of each SNP site are synthesized by Shanghai biotechnology Services Co., Ltd.
The carrying out of the PCR primer equimolar quality that numbering in table 2 is 1-8 is mixed, mix primer 1 is obtained;By in table 2
Numbering is that the carrying out of the PCR primer equimolar quality of 9-16 mixes, and obtains mix primer 2;It is 17-22 by numbering in table 2
The carrying out of PCR primer equimolar quality mix, obtain mix primer 3.
By the typing detection primer mixing that numbering in table 3 is 23-26, mix primer 4 is obtained, numbering is in mix primer 4
The concentration of the typing detection of 23-26 is respectively 8.06 μM, 8.15 μM, 9.06 μM and 9.40 μM;To number in table 3
Typing detection primer for 27-30 mixes, and obtains mix primer 5, and numbering is the typing detection of 27-30 in mix primer 5
Concentration be respectively 8.25 μM, 9.38 μM, 10.09 μM and 11.10 μM;By the typing that numbering in table 3 is 31-33
Detection primer mixes, and obtains mix primer 6, and the concentration that the typing detection for being 31-33 is numbered in mix primer 6 is respectively
8.73 μM, 11.09 μM and 12.06 μM.
The PCR primer of each SNP site of table 2.
The typing detection primer of each SNP site of table 3.
Numbering | SNP site | Primer | Primer sequence (5 ' -3 ') | Position in sequence table |
23 | T14577C | 14577UEP | GACCACACCGCTAACAA | Sequence 44 in sequence table |
24 | T14709C | 14709UEP | AACCACGACCAATGATA | Sequence 43 in sequence table |
25 | G3337A | 3337UEP | TTGCGATTAGAATGGGTA | Sequence 34 in sequence table |
26 | T3264C | 3264UEP | CCCGGTAATCGCATAAAAC | Sequence 38 in sequence table |
27 | A3243G | 3243UEP | TTATGCGATTACCGGGC | Sequence 37 in sequence table |
28 | A1555G | 1555UEP | CTTACCATGTTACGACTTG | Sequence 36 in sequence table |
29 | A8296G | 8296UEP | ATGCTAAGTTAGCTTTACAG | Sequence 41 in sequence table |
30 | T14674C | 14674UEP | ACAGAAACAAAGCATACATCAT | Sequence 35 in sequence table |
31 | T3271C | 3271UEP | TTGAACCTCTGACTGTAA | Sequence 39 in sequence table |
32 | T4291C | 4291UEP | ATGTCTGATAAAAGAGTTACTT | Sequence 40 in sequence table |
33 | C12258A | 12258UEP | TGTTATCCTTTAAAAGTTGAGAAA | Sequence 42 in sequence table |
3rd, mass spectrography carries out gene type detection
Following experiments are respectively provided with 3 multiple holes.
1st, PCR amplifications
Pcr amplification reaction liquid is prepared according to the reagent component in table 4, multiplexed PCR amplification is carried out in 384 orifice plates.Response procedures
For:94℃2min;94 DEG C of 20s, 56 DEG C of 30s, 72 DEG C of 1min, 45 circulations;72℃3min.Template in component
For template 1, template 2, template 3, template 4, template 5, template 6, template 7, template 8, template 9, template 10,
12,0.5 μM of Primer Mix of template 11 or template be mix primer 1, mix primer 2 or mix primer 3,10 × PCR
Buffer with 15mM MgCl2、MgCl2Agena bioscience Products, catalogue are with dNTP Mix
Number be respectively 10711521,10359033 and 10767222.HotStar Taq are precious biological engineering (Dalian) company limited
Product.
Primer Mix in above-mentioned pcr amplification reaction liquid are replaced with into equivalent ultra-pure water, other components are constant, 384
Multiplexed PCR amplification is carried out in orifice plate.As blank.
The component of table 4.PCR amplification reaction solutions
Component | Final concentration in pcr amplification reaction liquid | Reactive component volume (μ L) |
Ultra-pure water | n/a | 1.8 |
10×PCR Buffer with 15mM MgCl2 | 1××PCR Buffer(1.5mM MgCl2) | 0.5 |
MgCl2(25mM) | 2mM | 0.4 |
dNTP Mix(25mM) | 500μM | 0.1 |
Primer Mix(0.5μM) | 0.1 μM (wall scroll primer) | 1 |
HotStar Taq(5U/μl) | 1 Unit | 0.2 |
Template | n/a | 1 |
Total volume(μL) | n/a | 5 |
Note:N/a represented and do not exist.
2nd, SAP reactions
After completing step 1,2 μ L SAP mixed liquors are added (to match somebody with somebody according to the component in table 5 to each hole in 384 orifice plates
Put) carry out SAP reactions, remove system middle reaches from dNTP.Response procedures are:37 DEG C, 40min, 85 DEG C, 5min, 4 DEG C
Maintain.10 × SAP Buffer and SAP Enzyme are Agena bioscience Products, catalog number difference
For 0000020182 and 0000008336.
The component of table 5.SAP mixed liquors
Component | Final concentration in SAP mixed liquors | Reactive component volume (μ l) |
Ultra-pure water | n/a | 1.53 |
10×SAP Buffer | 0.24× | 0.17 |
SAP Enzyme(1.7U/μl) | 0.4U | 0.3 |
Total volume(μL) | n/a | 2 |
Note:N/a represented and do not exist.
3rd, single base extension
After completing step 2,2 μ L single base extension liquid are added (according in table 6 to each hole in 384 orifice plates
Component is configured) extension is carried out, obtain extension products.Response procedures are:94℃30s;94℃5s、52℃5s、
80 DEG C of 5s, 52 DEG C of 5s, 80 DEG C of 5s, 52 DEG C of 5s, 80 DEG C of 5s, 52 DEG C of 5s, 80 DEG C of 5s, 52 DEG C of 5s, 80 DEG C of 5s,
40 circulations;72℃3min.10 × iPLEX Buffer Plus, iPLEX Termination mix and iPLEX Enzyme
For Agena bioscience Products, catalog number is respectively 0000008212,0000008329 and
0000008333.IPLEX Extend Primer Mix are that mix primer 4, mix primer 5 or mixing prepared by step 2 is drawn
Thing 6.
The component of the single base extension liquid of table 6.
Component | Reactive component volume (μ l) |
Ultra-pure water | 0.619 |
10×iPLEX Buffer Plus | 0.2 |
iPLEX Termination mix | 0.2 |
iPLEX Extend Primer Mix | 0.94 |
iPLEX Enzyme | 0.041 |
Total Volume(μL) | 2 |
4th, Mass Spectrometer Method
(1) chip point sample:The extension products that step 3 is obtained are desalted (6mg resins are added per hole, 30min is spun upside down,
Allow extension products to be sufficiently mixed with resin, 3000prm be centrifuged, 5min is stand-by), start MassARRAY Nanodispenser
RS1000 point sample instruments, the sample point sample of product 384 after then desalting is to 384 hole SpectroCHIP (Sequenom) cores
(2) Mass Spectrometer Method on piece:SpectroCHIP chips after step (1) point sample are used into matrix assisted laser desorption ionization electricity
From flying time mass spectrum analysis, testing result uses the softwares of TYPER 4.0 (sequenom) typing and output result.
Experimental result is shown in Fig. 3.As a result show, the inspection that PCR primer provided by the present invention and typing detection primer can be special
Survey corresponding SNP site.
Embodiment 3, using the SNP site auxiliary diagnosis diabetes of chondriosome of embodiment 1
4 patients to be measured in the present embodiment are according to Clinical symptoms (such as age of onset morning, maternal inheritance, without fertilizer
It is fat, deafness and pathological investigation of neuromuscular impairment are often accompanied by, insulin secretion is substantially not enough, diabetic complication easily occurs) be judged as suffering from
The patient of mitochondrial diabetes.
The limosis vein blood 3mL of 4 patients to be measured is extracted respectively, with poba gene group extracts kit (Beijing Bo Maideji
Because of Technology Co., Ltd.'s product) genomic DNA of venous blood is extracted, then according to step 2 and step 3 in embodiment 2
Method carries out test experience.The results are shown in Table 7, it is seen that SNP site provided by the present invention and detection method can be with auxiliary diagnosis lines
Plastochondria diabetes, with higher accuracy rate.
The genotype of the SNP site contained in the patient's mitochondrial genome to be measured of table 7.
Claims (10)
1. the product first of auxiliary diagnosis diabetes of chondriosome, including for detecting that person under test's mitochondrial genome is based on G3337A SNP
The material of the genotype in site;The institute of sequence 1 of the sequence table in the G3337A SNP sites behaviour mitochondrial genome DNA
Show in section from the nucleotide of 5 ' ends the 151st.
2. product first as claimed in claim 1, it is characterised in that:
It is described to include for expanding for detecting that person under test's mitochondrial genome is based on the material of the genotype of G3337A SNP sites
The pcr amplification primer thing pair of the target sequence containing the G3337A SNP sites and/or for detecting the G3337A SNP sites
Typing detection primer;
The pcr amplification primer thing for target sequence of the amplification containing the G3337A SNP sites is to the sequence by sequence table
Primer 3337F shown in 12 and the primer 3337R compositions shown in the sequence 13 of sequence table;It is described for detecting the G3337A
Primer 3337UEP of the typing detection primer of SNP site shown in the sequence 34 of sequence table.
3. product first as claimed in claim 1 or 2, it is characterised in that:The product first also includes recording following judgement
The carrier 1 of standard:If genotype of person under test's mitochondrial genome based on G3337A SNP sites is GA heterozygous, to be measured
Person is or candidate is the patient with diabetes of chondriosome, if person under test's mitochondrial genome is based on G3337A SNP sites
Genotype is that GG is homozygous, patient to be measured is not or candidate is not the patient with diabetes of chondriosome.
4. the product second of auxiliary diagnosis diabetes of chondriosome, including for detecting that person under test's mitochondrial genome is based on T14674C
The material of the genotype of SNP site;The sequence of the sequence table in the T14674C SNP sites behaviour mitochondrial genome DNA
From the nucleotide of 5 ' ends the 151st in section shown in 2.
5. product second as claimed in claim 4, it is characterised in that:
It is described to include for expanding for detecting that person under test's mitochondrial genome is based on the material of the genotype of T14674C SNP sites
Increase the pcr amplification primer thing pair of the target sequence containing the T14674C SNP sites and/or for detecting the T14674C SNP
The typing detection primer in site;
The pcr amplification primer thing for target sequence of the amplification containing the T14674C SNP sites is to the sequence by sequence table
Primer 14674F shown in 14 and the primer 14674R compositions shown in the sequence 15 of sequence table;It is described described for detecting
Primer 14674UEP of the typing detection primer of T14674C SNP sites shown in the sequence 35 of sequence table.
6. a kind of arbitrary product first of test kit of auxiliary diagnosis diabetes of chondriosome, including claim 1-3 and/or right
Require product second described in 4 or 5.
7. test kit as claimed in claim 6, it is characterised in that:The test kit is also included for detecting person under test's line
Mitochondrial genes group based on A1555G SNP sites genotype material, for detect person under test's mitochondrial genome be based on A3243G
The material of the genotype of SNP site, for detecting genotype of person under test's mitochondrial genome based on T3264C SNP sites
Material, for detecting material, for detect to be measured of person under test's mitochondrial genome based on the genotype of T3271C SNP sites
Person's mitochondrial genome is based on the material of the genotype of T4291C SNP sites, for detecting that person under test's mitochondrial genome is based on
The material of the genotype of A8296G SNP sites, for detecting person under test's mitochondrial genome based on C12258A SNP sites
The material of genotype, for detect person under test's mitochondrial genome based on T14709C SNP sites genotype material and/or
For detecting material of person under test's mitochondrial genome based on the genotype of T14577C SNP sites;
It is last from 5 ' in section shown in the sequence 3 of the sequence table in the A1555G SNP sites behaviour mitochondrial genome DNA
Hold the 151st nucleotide;Area shown in the sequence 4 of the sequence table in the A3243G SNP sites behaviour mitochondrial genome DNA
From the nucleotide of 5 ' ends the 151st in section;Sequence table in the T3264C SNP sites behaviour mitochondrial genome DNA
From the nucleotide of 5 ' ends the 151st in section shown in sequence 5;The T3271C SNP sites behaviour mitochondrial genome DNA
In sequence table sequence 6 shown in section from the nucleotide of 5 ' ends the 151st;The T4291C SNP sites behaviour line grain
From the nucleotide of 5 ' ends the 151st in section shown in the sequence 7 of the sequence table in body genomic DNA;The A8296G SNP
From the nucleotide of 5 ' ends the 151st in section shown in the sequence 8 of the sequence table in site behaviour mitochondrial genome DNA;Institute
State in section shown in the sequence 9 of sequence table in C12258A SNP site behaviour mitochondrial genome DNA from 5 ' ends the 151st
Position nucleotide;In section shown in the sequence 10 of the sequence table in the T14709C SNP sites behaviour mitochondrial genome DNA
From the nucleotide of 5 ' ends the 151st;The sequence of the sequence table in the T14577C SNP sites behaviour mitochondrial genome DNA
From the nucleotide of 5 ' ends the 151st in section shown in row 11.
8. test kit as claimed in claims 6 or 7, it is characterised in that:
It is described to include for expanding for detecting that person under test's mitochondrial genome is based on the material of the genotype of A1555G SNP sites
The pcr amplification primer thing pair of the target sequence containing the A1555G SNP sites and/or for detecting the A1555G SNP sites
Typing detection primer;It is described for amplification containing the A1555G SNP sites target sequence pcr amplification primer thing to by
Primer 1555F shown in the sequence 16 of sequence table and the primer 1555R compositions shown in the sequence 17 of sequence table;It is described to be used for
Detect primer 1555UEP of the typing detection primer of the A1555G SNP sites shown in the sequence 36 of sequence table;
It is described to include for expanding for detecting that person under test's mitochondrial genome is based on the material of the genotype of A3243G SNP sites
The pcr amplification primer thing pair of the target sequence containing the A3243G SNP sites and/or for detecting the A3243G SNP sites
Typing detection primer;The pcr amplification primer thing for target sequence of the amplification containing the A3243G SNP sites is to by sequence
Primer 3243F shown in the sequence 18 of list and the primer 3243R compositions shown in the sequence 19 of sequence table;It is described for examining
Survey primer 3243UEP of the typing detection primer of the A3243G SNP sites shown in the sequence 37 of sequence table;
It is described to include for expanding for detecting that person under test's mitochondrial genome is based on the material of the genotype of T3264C SNP sites
The pcr amplification primer thing pair of the target sequence containing the T3264C SNP sites and/or for detecting the T3264C SNP sites
Typing detection primer;The pcr amplification primer thing for target sequence of the amplification containing the T3264C SNP sites is to by sequence
Primer 3264F shown in the sequence 20 of list and the primer 3264R compositions shown in the sequence 21 of sequence table;It is described for examining
Survey primer 3264UEP of the typing detection primer of the T3264C SNP sites shown in the sequence 38 of sequence table;
It is described to include for expanding for detecting that person under test's mitochondrial genome is based on the material of the genotype of T3271C SNP sites
The pcr amplification primer thing pair of the target sequence containing the T3271C SNP sites and/or for detecting the T3271C SNP sites
Typing detection primer;The pcr amplification primer thing for target sequence of the amplification containing the T3271C SNP sites is to by sequence
Primer 3271F shown in the sequence 22 of list and the primer 3271R compositions shown in the sequence 23 of sequence table;It is described for examining
Survey primer 3271UEP of the typing detection primer of the T3271C SNP sites shown in the sequence 39 of sequence table;
It is described to include for expanding for detecting that person under test's mitochondrial genome is based on the material of the genotype of T4291C SNP sites
The pcr amplification primer thing pair of the target sequence containing the T4291C SNP sites and/or for detecting the T4291C SNP sites
Typing detection primer;It is described for amplification containing the T4291C SNP sites target sequence pcr amplification primer thing to by
Primer 4291F shown in the sequence 24 of sequence table and the primer 4291R compositions shown in the sequence 25 of sequence table;It is described to be used for
Detect primer 4291UEP of the typing detection primer of the T4291C SNP sites shown in the sequence 40 of sequence table;
It is described to include for expanding for detecting that person under test's mitochondrial genome is based on the material of the genotype of A8296G SNP sites
The pcr amplification primer thing pair of the target sequence containing the A8296G SNP sites and/or for detecting the A8296G SNP sites
Typing detection primer;The pcr amplification primer thing for target sequence of the amplification containing the A8296G SNP sites is to by sequence
Primer 8296F shown in the sequence 26 of list and the primer 8296R compositions shown in the sequence 27 of sequence table;It is described for examining
Survey primer 8296UEP of the typing detection primer of the A8296G SNP sites shown in the sequence 41 of sequence table;
It is described to include for expanding for detecting that person under test's mitochondrial genome is based on the material of the genotype of C12258A SNP sites
Increase the pcr amplification primer thing pair of the target sequence containing the C12258A SNP sites and/or for detecting the C12258A SNP
The typing detection primer in site;The pcr amplification primer thing for target sequence of the amplification containing the C12258A SNP sites
Primer 12258R shown in the sequence 29 of the primer 12258F shown in the sequence 28 by sequence table and sequence table is constituted;Institute
State the primer for detecting the typing detection primer of the C12258A SNP sites shown in the sequence 42 of sequence table
12258UEP;
It is described to include for expanding for detecting that person under test's mitochondrial genome is based on the material of the genotype of T14709C SNP sites
Increase the pcr amplification primer thing pair of the target sequence containing the T14709C SNP sites and/or for detecting the T14709C SNP
The typing detection primer in site;The pcr amplification primer thing for target sequence of the amplification containing the T14709C SNP sites
Primer 14709R shown in the sequence 31 of the primer 14709F shown in the sequence 30 by sequence table and sequence table is constituted;Institute
State the primer for detecting the typing detection primer of the T14709C SNP sites shown in the sequence 43 of sequence table
14709UEP;
It is described to include for expanding for detecting that person under test's mitochondrial genome is based on the material of the genotype of T14577C SNP sites
Increase the pcr amplification primer thing pair of the target sequence containing the T14577C SNP sites and/or for detecting the T14577C SNP
The typing detection primer in site;The pcr amplification primer thing for target sequence of the amplification containing the T14577C SNP sites
Primer 14577R shown in the sequence 33 of the primer 14577F shown in the sequence 32 by sequence table and sequence table is constituted;Institute
State the primer for detecting the typing detection primer of the T14577C SNP sites shown in the sequence 44 of sequence table
14577UEP。
9. the test kit as described in claim 6-8 is arbitrary, it is characterised in that:
The test kit also includes recording the carrier 3 of following criterion:If person under test's mitochondrial genome is based on A1555G
The genotype of SNP site is that GG is homozygous, person under test is or candidate is the patient with diabetes of chondriosome, if person under test
Genotype of the mitochondrial genome based on A1555G SNP sites is that AA is homozygous, person under test is not or candidate is not with line
The patient of plastochondria diabetes;
The test kit also includes recording the carrier 4 of following criterion:If person under test's mitochondrial genome is based on A3243G
The genotype of SNP site is AG heterozygous, person under test is or candidate is the patient with diabetes of chondriosome, if person under test
Genotype of the mitochondrial genome based on A3243G SNP sites is that AA is homozygous, person under test is not or candidate is not with line
The patient of plastochondria diabetes;
The test kit also includes recording the carrier 5 of following criterion:If person under test's mitochondrial genome is based on T3264C
The genotype of SNP site is that CC is homozygous or CT heterozygous, person under test are or candidate is the patient with diabetes of chondriosome,
If genotype of person under test's mitochondrial genome based on T3264C SNP sites is that TT is homozygous, person under test is not or candidate
It is not the patient with diabetes of chondriosome;
The test kit also includes recording the carrier 6 of following criterion:If person under test's mitochondrial genome is based on T3271C
The genotype of SNP site is that CC is homozygous or CT heterozygous, person under test are or candidate is the patient with diabetes of chondriosome,
If genotype of person under test's mitochondrial genome based on T3271C SNP sites is that TT is homozygous, person under test is not or candidate
It is not the patient with diabetes of chondriosome;
The test kit also includes recording the carrier 7 of following criterion:If person under test's mitochondrial genome is based on T4291C
The genotype of SNP site is that CC is homozygous or CT heterozygous, person under test are or candidate is the patient with diabetes of chondriosome,
If genotype of person under test's mitochondrial genome based on T4291C SNP sites is that TT is homozygous, person under test is not or candidate
It is not the patient with diabetes of chondriosome;
The test kit also includes recording the carrier 8 of following criterion:If person under test's mitochondrial genome is based on A8296G
The genotype of SNP site is that GG is homozygous or AG heterozygous, person under test are or candidate is the patient with diabetes of chondriosome,
If genotype of person under test's mitochondrial genome based on A8296G SNP sites is that AA is homozygous, person under test is not or candidate
It is not the patient with diabetes of chondriosome;
The test kit also includes recording the carrier 9 of following criterion:If person under test's mitochondrial genome is based on C12258A
The genotype of SNP site is that AA is homozygous or CA heterozygous, person under test are or candidate is the patient with diabetes of chondriosome,
If genotype of person under test's mitochondrial genome based on C12258A SNP sites is that CC is homozygous, person under test is not or candidate
It is not the patient with diabetes of chondriosome;
The test kit also includes recording the carrier 10 of following criterion:If person under test's mitochondrial genome is based on
The genotype of T14709C SNP sites is that CC is homozygous or TC heterozygous, person under test are or candidate is with mitochondrion glycosuria
The patient of disease, if genotype of person under test's mitochondrial genome based on T14709C SNP sites is that TT is homozygous, person under test
It is not or candidate is not the patient with diabetes of chondriosome;
The test kit also includes recording the carrier 11 of following criterion:If person under test's mitochondrial genome is based on
The genotype of T14577C SNP sites is that CC is homozygous or TC heterozygous, person under test are or candidate is with mitochondrion glycosuria
The patient of disease, if genotype of person under test's mitochondrial genome based on T14577C SNP sites is that TT is homozygous, person under test
It is not or candidate is not the patient with diabetes of chondriosome.
10. product second or the arbitrary institute of claim 6-9 described in the arbitrary product first, claim 4 or 5 of claim 1-3
State application of the test kit in the test kit for auxiliary diagnosis diabetes of chondriosome is prepared.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510702679.3A CN106609302B (en) | 2015-10-26 | 2015-10-26 | A kind of kit of auxiliary diagnosis diabetes of chondriosome |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510702679.3A CN106609302B (en) | 2015-10-26 | 2015-10-26 | A kind of kit of auxiliary diagnosis diabetes of chondriosome |
Publications (2)
Publication Number | Publication Date |
---|---|
CN106609302A true CN106609302A (en) | 2017-05-03 |
CN106609302B CN106609302B (en) | 2019-10-25 |
Family
ID=58613785
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510702679.3A Active CN106609302B (en) | 2015-10-26 | 2015-10-26 | A kind of kit of auxiliary diagnosis diabetes of chondriosome |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106609302B (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1970791A (en) * | 2006-12-08 | 2007-05-30 | 武汉大学 | Membrane chip for detecting 45 gene locus of mitochondria diabetes |
CN101016564A (en) * | 2006-12-08 | 2007-08-15 | 武汉大学 | Micro-array chip with forty-five gene locus for detecting mitochondria diabetes |
CN102660636A (en) * | 2012-02-14 | 2012-09-12 | 北京科聆金仪生物技术有限公司 | A fluorescence detection kit for detecting deafness susceptibility gene 12S rRNA 1555A>G and application thereof |
CN104212894A (en) * | 2014-08-25 | 2014-12-17 | 四川大学 | 26 mitochondria SNP genetic markers-based forensic medical composite detection kit |
-
2015
- 2015-10-26 CN CN201510702679.3A patent/CN106609302B/en active Active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1970791A (en) * | 2006-12-08 | 2007-05-30 | 武汉大学 | Membrane chip for detecting 45 gene locus of mitochondria diabetes |
CN101016564A (en) * | 2006-12-08 | 2007-08-15 | 武汉大学 | Micro-array chip with forty-five gene locus for detecting mitochondria diabetes |
CN102660636A (en) * | 2012-02-14 | 2012-09-12 | 北京科聆金仪生物技术有限公司 | A fluorescence detection kit for detecting deafness susceptibility gene 12S rRNA 1555A>G and application thereof |
CN104212894A (en) * | 2014-08-25 | 2014-12-17 | 四川大学 | 26 mitochondria SNP genetic markers-based forensic medical composite detection kit |
Non-Patent Citations (2)
Title |
---|
NAJLA MEZGHANI ET AL: "The mitochondrial ND1 m.3337G>A mutation associated to multiple mitochondrial DNA deletions in a patient with Wolfram syndrome and cardiomyopathy", 《BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATION》 * |
R.HORVATH ET AL: "Infantile reversible COX deficiency myopathy caused by the m.14674T>C mutation in mt-tRNAGlu in a German family", 《NEUROMUSCULAR DISORDERS》 * |
Also Published As
Publication number | Publication date |
---|---|
CN106609302B (en) | 2019-10-25 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Reynolds et al. | Pharmacogenetics of treatment in first-episode schizophrenia: D3 and 5-HT2C receptor polymorphisms separately associate with positive and negative symptom response | |
CN101892302B (en) | Use and detection kit of locus rs2336384 of susceptibility gene of hypertension | |
KR102050637B1 (en) | Alleles associated with adverse drug reaction and detecting method thereof | |
Mastaglia et al. | Novel mutation in the myelin protein zero gene in a family with intermediate hereditary motor and sensory neuropathy | |
CN101892305A (en) | Method for detecting rs2295281 locus of hypertension susceptibility gene and detection kit | |
CN101892311A (en) | Detection method and kit of single nucleotide polymorphism locus rs7550536 of susceptibility gene of hypertension | |
Mittal et al. | A comprehensive analysis of mitochondrial genes variants and their association with antipsychotic-induced weight gain | |
CN101338337B (en) | Polymorphism site genotype estimation depression, use and process of medicine effect and kit | |
Tallerico et al. | Dopamine D2 receptor promoter polymorphism: no association with schizophrenia | |
Zai et al. | Association study of BDNF and DRD3 genes in schizophrenia diagnosis using matched case–control and family based study designs | |
CN105018602B (en) | Susceptibility gene of antipsychotic drug-related metabolic syndrome and application thereof | |
CN110241197A (en) | Primer combination of probe and kit and application for instructing Atorvastatin drug personalized medicine related gene to detect | |
CN106609302B (en) | A kind of kit of auxiliary diagnosis diabetes of chondriosome | |
Ohadi et al. | Gender dimorphism in the DAT1− 67 T-allele homozygosity and predisposition to bipolar disorder | |
CN101886125A (en) | Method for detecting mononucleotide polymorphism locus rs2236058 of hypertension susceptibility genes and detection kit | |
CN113046432A (en) | Kit for guiding human hypertension medication | |
Wang et al. | Association of genetic variants of insulin degrading enzyme with metabolic features in women with polycystic ovary syndrome | |
CN101886121A (en) | Method for detecting locus rs873457 of hypertension susceptibility genes and detection kit | |
CN110951858A (en) | Primer-probe combination for guiding detection of genes related to glibenclamide drug personalized administration, kit and application | |
CN101892298B (en) | Method for detecting mononucleotide polymorphism rs2236055 locus of hypertension susceptibility gene and kit thereof | |
CN104762387B (en) | Application of single nucleotide polymorphism rs17083838 in detection of pituitary adenoma | |
CN101113466A (en) | Susceptibility gene of hyperthyroidism disease and application thereof | |
Zeng et al. | Analysis of mitochondrial DNA variations in a Chinese family with spinocerebellar ataxia | |
CN202401074U (en) | Kit for detecting obese gene locus in human body | |
CN101892296A (en) | Method for detecting hypertension susceptible gene and detection kit |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |