CN106544418B - The clone of pig birth weight character correlation HAI-1 gene molecule marker and its application - Google Patents
The clone of pig birth weight character correlation HAI-1 gene molecule marker and its application Download PDFInfo
- Publication number
- CN106544418B CN106544418B CN201610898124.5A CN201610898124A CN106544418B CN 106544418 B CN106544418 B CN 106544418B CN 201610898124 A CN201610898124 A CN 201610898124A CN 106544418 B CN106544418 B CN 106544418B
- Authority
- CN
- China
- Prior art keywords
- pig
- hai
- gene
- birth weight
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the molecular labeling preparation technical fields of pig, and in particular to the clone of pig birth weight character correlation HAI-1 gene molecule marker and its application.The molecular labeling is to clone to obtain from the HAI-1 gene for influencing mammalian placenta development, its partial nucleotide sequence is as shown in SEQ ID NO:1, there are the allelic mutation of a T/C at 36 bit bases of the sequence, which leads to Alu1-RFLP polymorphism.The invention discloses application of the molecular labeling in the analysis of pig pig birth weight trait associations.The present invention provides new genetic resources for the marking supplementary breeding of pig.
Description
Technical field
The invention belongs to pig molecule mark preparation technical fields, and in particular to pig birth weight character correlation HAI-1 gene point
The clone of son label and its application.Molecular marker clone of the invention is from HAI-1 gene.
Background technique
During pig production, how to improve the production performance of sow, reduces production cost into pig production person pass
The focus of note and the research emphasis of pig breeding worker.The birth weight of the pig reproductive trait important as one is born to pig
Survival rate and growth speed afterwards all has important influence, has very strong positive correlation with pig farm economic benefit.
Document report birth weight is significant effects factor (the Mesa H etc., Genetic for influencing Preweaning death rate
and phenotypic relationships of farrowing and weaning survival to birth and
placental weights in pigs[J].J Anim Sci.2010).Gondret, F.L. etc. (Gondret, F.L. etc.,
Low birth weight is associated with enlarged muscle fiber area and impaired
Meat tendesness of the longissimus muscle in pigs.J.Anim.Sci.2006) and Wolter etc.
(the The effect of birth weight and feeding of supplement such as Wolter, B.F. milk
replacer to piglets during lactation on preweaning and postweaning growth
Performance and carcass characteristic.J.Anim.Sci.2002) it studies and reports the small tire of birth weight
Youngster is weaker than great fetus of coming into being, and preferably environmental condition is needed after birth to guarantee its survival.Especially in recent years with
The raising of breeding technique, number born of sow has certain raising, however the decline of birth weight is so that Preweaning death rate is continuous
Increase, seriously affected effective number pigs weaned (Rootwelt V etc., Postpartum deaths:Piglet,
Placental, and umbilical characteristics [J] .J Anim Sci.2013), to constrain pig breeding industry
Economic benefit.
In addition many researchs report influence of the birth weight to pig postnatal growth speed recently.Li Jianhao (Li Jianhao
Landrace birth weight produces [J] .2006.18 to the influence piglet of the speed of growth and nurture rate) by Landrace 35,60 days
Age weight and the research of birth weight are found: 35 age in days weights and 60 ages in days weight are all positively correlated with birth weight, and birth weight and growth
Speed is positively correlated.In addition (Poore K.R. etc., The effects of birth the weight and such as Poore
postnatal growth patterns on fat depth and plasma leptin concentrations in
Juvenile and adult pigs.J.Physiol.2004) and (Beaulieu AD etc., the Impact of such as Beaulieu
piglet birth weight,birth order and litter size on subsequent growth
performance,carcass quality,muscle composition and eating quality of pork[J]
.J Anim Sci.2010) also to report the lower growth speed of pigs of birth weight slower for research.So how to improve sow production
The birth weight for guaranteeing piglet while young number is that pig raising enterprise and breeder need the problem of paying attention to.
Therefore, the functional study for influencing pig birth weight related gene can be grown for explanation pig and other mammalian fetals
The genetic mechanism of development provides important clue, and provides theoretical foundation for the reproductive trait genetic improvement of pig.Study gene mutation
Polymorphism of the site in group, and it is a very strong hand for studying gene function that character association analysis is carried out to it
Section, and the basis of assisted Selection is marked.The albumen of HAI-1 gene coding is a kind of Kunitz type serine protease suppression
The factor processed is expressed in a variety of epithelial tissues, such as small intestine epithelium, salivary gland epithelia, lung epithelial and placenta, is moved to regulating cell
Move, differentiation, tissue remodeling and placenta development play a significant role (Kirchhofer D etc., Tissue expression,
protease specificity,and Kunitz domain functions of hepatocyte growth factor
activator inhibitor-1B(HAI-1B),a new splice variant of HAI-1[J].J Bio Chem,
2003).HAI-1 can be by adjusting hepatocyte growth factor activity factor (Hepatocyte growth factor
Activator, HGFA), the activity of Matriptase, Hepsin etc. come organization of regulation control remodeling and regeneration, the differentiation of cell with move
The biological processes such as shifting have important regulating and controlling effect (Herter S etc., Hepatocyte to mouse and Human plactnta development
growth factor is a preferred in vitro substrate for human hepsin,a membrane-
anchored serine protease implicated in prostate and ovarian cancers[J]
.Biochemical Journal,2005).The above research has shown that, the hair of HAI-1 gene pairs mammal placenta during pregnancy
It educates and plays a significant role, may be related with the adjusting of Placental Efficiency, to influence the Transportation Efficiency of nutriment between parent and fetus
Rate.Therefore, applicant has carried out polymorphism research and association analysis to HAI-1 gene, to obtain a kind of nascent principal characteristic of and pig
The relevant molecular labeling of shape.
Summary of the invention
The purpose of invention is to clone a kind of molecular labeling relevant to pig birth weight character from HAI-1 gene, is pig
The detection of birth weight character provides a kind of method of marker assisted selection.
Technical scheme is as follows:
Applicant clones to obtain the part DNA fragmentation with pig birth weight trait related gene from pig gene HAI-1, it
DNA sequence dna is as described in sequence table SEQ ID NO:1 and Fig. 2.There is one at the 36th bit base of sequence table SEQ ID NO:1
The mutation of the allele of T36-C36, the mutation lead to Alu1-RFLP polymorphism.This base mutation is located at HAI-1 gene 3 '
The area UTR.In addition applicant has detected HAI-1mRNA transcriptional level in different cultivars and different gestational age pig placenta tissues
Expression finds that HAI-1 gene has different spatial and temporal expression profiles in different gestational period placentas, illustrates that it may be to pig
Placenta development plays a significant role, to influence growth and development of the fetus in placenta.
Molecular labeling of the present invention the preparation method is as follows:
(1) drawn with the pig HAI-1 gene reference sequence (sequence number: NM_001244422.2) that NCBI is announced for stencil design
The sequence of object, the primer is as follows:
Forward primer: 5'-ACTGGTTCCTGAGAAAGAGCA-3',
Reverse primer: 5'-CGCTGAACCAAAAGCAAAACTC-3'(is shown in SEQ ID NO:2 and 3)
(2) pig genomic DNA is extracted, purifies and is sequenced by PCR amplification, PCR product, obtain such as sequence table SEQ
IDNO:1 and nucleotide sequence shown in Fig. 2.
(3) method of the conventional PCR-RFLP of application is mutated the 36th bit base shown in shown in SEQ ID NO:1 and Fig. 2
It is detected, and tentatively carries out the application of the association analysis between its genotype and pig birth weight character, be the molecule mark of pig
Note assisted Selection provides a new molecular labeling.
(4) in addition, further to inquire into the relationship of the gene Yu pig placenta development, applicant also testing goal gene HAI-
The expression of 1mRNA transcriptional level in pig placenta tissue, the primer designed for testing goal gene HAI-1mRNA expression
Pair and as reference gene GAPDH primer pair, sequence difference it is as follows:
The primer pair of target gene HAI-1:
Forward primer: 5'AGACACCGGCCACTGCTTG 3',
Reverse primer: 5'GCTTTCCCGCCGTAGACCAAA 3', (see sequence table SEQ ID NO:4,5)
The primer pair of reference gene GAPDH:
Forward primer: 5'CCTCCAAGGAGTAAGAGCC 3',
Reverse primer: 5'GTCTGGGATGGAAACTGG 3'；(see sequence table SEQ ID NO:6,7)
More detailed technical solution refers to the embodiment in " Detailed description of the invention " and " specific embodiment " of specification.
Detailed description of the invention
Sequence table SEQ ID NO:1 is the part DNA sequence for the pig birth weight trait related gene HAI-1 that the present invention clones
Column, sequence 110bp, there are the base mutation (allele of a T36-C36 at the 36th bit base of the sequence
Mutation).
Sequence table SEQ ID NO:2-7 is the primer sequence of the invention designed (in these primer sequences and specification text
The sequence order is consistent).
Fig. 1: the technology of the present invention flow diagram.
Fig. 2: being the partial dna sequence of clone pig HAI-1 gene of the present invention (with sequence pair shown in SEQ ID NO:1
Answer), there are the mutation of an allele at 36 bit bases of sequence shown in Fig. 2, it is denoted as " R ", the bracket after " R " is
(T/C) (show) that the primer sequence that the head and the tail of the segment of the amplification are shown is aobvious with underscore with overstriking italics for mutational site
Show.The underscore of the base of the sequence be design just, direction primer sequence.
Fig. 3: the electrophoresis result of three kinds of genotype of the Alu1-RFLP in the 3 ' area UTR of pig HAI-1 gene in the present invention, respectively
For TT, TC and CC genotype, wherein TT and CC is homozygote, and TC is heterozygote.TT genotype contains there are two segment, and size is distinguished
It is 34bp and 76bp；CC genotype contains a segment, and size 110bp, TC genotype contains there are three segment, and size is respectively
34bp, 76bp and 110bp.Description of symbols: in Fig. 3, swimming lane M:DNA molecular weight standard (DL500ladder).
Fig. 4: the T-C (backward sequencing A-G) of the sequencing of pig HAI-1 gene forward direction and backward sequencing discovery is prominent in the present invention
Become.
Fig. 5: pig placenta tissue HAI-1mRNA expression quantity qPCR testing result.Description of symbols: ordinate indicates purpose
The relative expression quantity of gene HAI-1mRNA transcriptional level, abscissa indicate different pregnant times.Kind is respectively Large White
(Yorkshire, Yorkshire, a kind of common external pig variety), plum mountain pig (Meishan, a kind of common place of china pig product
Kind).Variance analysis is carried out with the mixed linear model in SAS software, different letters, which represent, significant difference (P < 0.05), indulges
Coordinate digital indicates are as follows: mean ± SD.
Specific embodiment
Embodiment 1: pig HAI-1 Gene Partial DNA sequence dna amplification
(1) method for extracting Large White blood sample genomic DNA (refers to J. Pehanorm cloth according to conventional phenol/chloroform extraction method
Luke and D.W. Russell write, the Molecular Cloning:A Laboratory guide third edition (2002) of the translations such as Huang Peitang, Science Press, 463-
Page 470), it is described that specific step is as follows:
Step 1: being digested overnight :+20 μ l protease k of 2ml whole blood+2ml lysate (Tris/EDTA/SDS), shakes by 55 DEG C
Bed water-bath, is digested overnight.
Step 2: phenol imitates alcohol extracting
1) Tris- saturated phenol extracts: 4ml Tris- saturated phenol, mixing 10 minutes of lightly turning upside down, centrifugation (4 DEG C,
5000r/min, 15min), supernatant is shifted to a new centrifuge tube with the heavy caliber pipette tips for cutting sharp mouth.
2) it repeats to extract: 4mlTris- saturated phenol, mixing 10 minutes of lightly turning upside down, centrifugation (4 DEG C, 5000r/
Min, 15min), supernatant is shifted to a new centrifuge tube with the heavy caliber pipette tips for cutting sharp mouth.
3) phenol imitates alcohol extracting: 4ml phenol/imitative/alcohol (volume ratio 25:24:1) lightly turns upside down and mixes 10 minutes, from
The heart (4 DEG C, 5000r/min, 15min) shifts supernatant to a new centrifuge tube with the heavy caliber pipette tips for cutting sharp mouth.
4) chloroform/isoamyl alcohol extraction: 4ml phenol/imitative (volume ratio 24:1), mixing 10 minutes of lightly turning upside down, from
The heart (4 DEG C, 5000r/min, 15min) shifts supernatant to a new centrifuge tube with the heavy caliber pipette tips for cutting sharp mouth.
5) DNA:4ml dehydrated alcohol is precipitated, it is slight to shake, cotton-shaped DNA, -20 DEG C of placement 1h-3h is precipitated.
6) it washs DNA: DNA being drawn in 1.5ml centrifuge tube with clip Huang pipette tips, 75% ethyl alcohol of 1-1.5ml is added, washes
It washs, is centrifuged (4 DEG C, 3000rpm, 5min), abandon ethyl alcohol.
7) it washes repeatedly: 75% ethyl alcohol of 1-1.5ml is added, washing is centrifuged (4 DEG C, 3000rpm, 5min), abandons ethyl alcohol.
8) naturally dry.
(2) design of primers:
The pig HAI-1 gene announced using NCBI draws as reference sequences (number of logging in NM_001244422.2) for stencil design
Object, using biology primer-design software Oligo 7, the primer of design amplification HAI-1 gene, the sequence of the primer pair is as follows:
Forward primer: 5'-ACTGGTTCCTGAGAAAGAGCA-3',
Reverse primer: 5'-GAGTTTTGCTTTTGGTTCAGCG-3', (with SEQ ID NO:2,3 sequence is corresponded to)
Amplification obtains the segment of 110bp.
(3) pcr amplification reaction:
PCR reacts 20 μ l of total volume, wherein pig genomic DNA about 100ng, (public purchased from Promega containing 1 times of buffer
Department), the final concentration of 150 μm of ol/L of 1.5mmol/L MgCl2, dNTP, primer final concentration of 0.4 μm of ol/L, 2U TaqDNA polymerization
Enzyme (is purchased from Promega company).PCR amplification program is: 94 DEG C of 3min, recycle 35 94 DEG C of 30s, 60 DEG C of 30s, then 72 DEG C
25s, last 72 DEG C of extensions 5min.PCR reaction product is detected with 2% agarose gel electrophoresis.Obtain the specific amplified piece of 110bp
Section, the segment are located at the 3 ' areas UTR (code area), (see sequence shown in Fig. 2 and SEQ ID NO:1).Sequencing as a result, it has been found that
There are an Alu1 restriction enzyme sites (AG ↓ CT) in the 110bp segment, wherein being polymorphic site at the 36th bit base (such as Fig. 4 institute
Show).
(4) purifying and sequencing of PCR product
The purifying of PCR product: PCR purification and recovery kit (DP214) is purchased from Tiangeng (Beijing) Bioisystech Co., Ltd,
Method is operated by kit specification.
PCR product sequencing: sequencing service is completed by Shanghai Invitrogen company, and genetic fragment surveys positive and negative two reactions.
The foundation of embodiment 2:PCR-RFLP diagnostic method
(1) PCR-RFLP primer sequence (primer is also the primer for expanding 3 ' UTR of HAI-1 gene),
Forward primer: 5'-ACTGGTTCCTGAGAAAGAGCA-3',
Reverse primer: 5'-GAGTTTTGCTTTTGGTTCAGCG-3', (sequence is shown in SEQ ID NO:2 and 3)
Amplification obtains the segment of 110bp.
(2) PCR amplification condition
PCR amplification system is 20 μ L.Wherein, 10 μ L of 0.4 μ L of forward primer, 0.4 μ L, 2 × PCR Mix of reverse primer,
DNA profiling 1.0 μ L, remaining ddH2O adds to 20 μ L.PCR amplification program is: 94 DEG C of 3min, recycle 35 94 DEG C of 30s, 60 DEG C
30s, then 72 DEG C of 25s, last 72 DEG C of extensions 5min.PCR reaction product is detected with 2% agarose gel electrophoresis.
(3) RFLP is detected
PCR product endonuclease reaction volume is 10 μ l, wherein 1 × buffer, 1 μ l, PCR product 3-5 μ l, restriction enzyme
Alu1 is 0.2 μ l (10U), uses H2O supplies 10 μ l, will be centrifuged after sample blending, 37 DEG C of water-bath 4h, with 2% Ago-Gel electricity
Swimming detection digestion is taken pictures in the UV lamp as a result, record genotype.Digestion generates three kinds of genotype: where CC genotype only has
Mono- band of 110bp, TT genotype have two band of 34bp and 76bp, and heterozygote CT genotype has three of 34bp, 76bp and 110bp
Band, specific glue figure are shown in Fig. 3.
Embodiment 3: the application of molecular labeling of the invention in pig reproductive trait association analysis
The present embodiment swinery comes from Large White group, totally 400 piglet individuals, the characters such as record piglet individual birth weight.
According to the group structure of acquisition sample, it is polymorphic that applicant statisticallys analyze the 3rd ' area UTR C/T of HAI-1 gene with mixed model
The genotype effects in property site and its relationship with birth weight character.
Its model is as follows:
Yijkl=μ+genei+sexj+parityk+batchl+littesizer+eijkl
YijklFor character value, μ is population mean, geneiFor genotype effects, sexjFor sex-effects, paritykFor tire
Sub-effect, batch are batch effect (every batch of poultry raiser is different)；Littersize is total yield coefficient, as covariant, eijklFor
Random error.It is for statistical analysis using MIXED MODELS program in SAS (Version 8.0) software.
Pig HAI-1 Gene A lu1-RFLP polymorphic site carries out character association analysis in Large White group, the result is shown in
Table, this gene mutation site is in 400 piglet individuals, and CC genotype individuals have 3, and TC genotype individuals have 46, TT base
Because type individual has 351.Character association analysis is carried out using polymorphism of the SAS statistical analysis software to this mutational site, this is prominent
The polymorphic of displacement point has a significant impact (P < 0.05) with piglet birth weight, and wherein the piglet birth weight of CC genotype individuals is significantly high
(1 is shown in Table in the piglet birth weight of TT genotype and TC genotype individuals.
1 HAI-1SNP trait associations of table analyze result
Character value is average value ± standard error in table 1, and the representative of P < 0.05 has significant difference.
The fluorogenic quantitative detection of embodiment 4HAI-1 gene mrna expression amount in placenta tissue
(1) pig placenta tissue sample acquires
Choosing purebred Large White and Mei Shan pig sow pig is research object, the 26th day of gestation, 50 days, 95 days it is (every
Each 3 of the pregnant sow in a period) it carries out butchering acquisition pig placenta tissue sample respectively.
(2) extraction of placenta tissue total serum IgE
Placenta tissue Total RNAs extraction is using total RNA from animal tissues extracts kit (the limited public affairs of Tiangeng biochemistry (Beijing) science and technology
Department, DP431) it extracts, concrete operation step is detailed in the kit specification.The RNA of extraction Thermo scientific company
2000 nucleic acid-protein analyzer of NanoDrop measure total rna concentration.
The synthesis of (3) first chain cDNA
The total serum IgE and 0.4 μ g of 2 μ g is added in the centrifuge tube of the 0.2mL of the processed no RNase pollution of DEPC
The random primer of oligo (dT) primer and 0.1 μ g, 70 DEG C incubate 5min to unlock the secondary structure of total serum IgE, are immediately placed on ice
To prevent secondary structure renaturation.Then primary to be added: 10 μ 5 × reverse transcription buffers of L, 2.5 μ L 10mmol/L dNTP mix, 1 μ
L RNase inhibitor, 1.5 μ L M-MLV reverse transcriptase (200U/ μ L) are mended final volume to 50 μ L with nuclease-free water,
It mixes after being centrifuged in 37 DEG C of incubations 10min, 42 DEG C of incubation 50min, in 85 DEG C of incubation 5min to inactivate reverse transcriptase.After reverse transcription
CDNA can in -20 DEG C save 3 months.
(4) it is used for the design of primers of fluorescence quantitative PCR detection
With NCBI announce pig HAI-1 gene order (indexed number: NM_001244422.2) and pig GAPDH (indexed number:
NM_001206359.1 gene order) is template, and using 7 design primer of Oligo, nucleotide sequence difference is as described below:
The primer pair of target gene HAI-1:
Forward primer: 5'AGACACCGGCCACTGCTTG 3',
Reverse primer: 5'GCTTTCCCGCCGTAGACCAAA 3', (sequence is shown in SEQ ID NO:4 and 5)
The primer pair of reference gene GAPDH:
Forward primer: 5'CCTCCAAGGAGTAAGAGCC 3',
Reverse primer: 5'GTCTGGGATGGAAACTGG 3', (sequence is shown in SEQ ID NO:6 and 7)
(5) fluorescence quantitative PCR detection
Quantitative fluorescent PCR reaction system is added in 96 orifice plate of Roche fluorescent quantitation, system is as follows: 2 × SYBR Green
The Forward Primer of the Reverse Primer, 0.4 μ L of I dyestuff 10 μ L, 0.4 μ L, the cDNA template of 1 μ L add ddH2O to mend
To 20 μ L of total volume, three technologies of each sample are repeated, and it is control group that amplification each time, which is intended to setting reference gene GAPDH,.
Response procedures are 95 DEG C of 3min, and 40 recycle, and 94 DEG C of 20s, 60 DEG C of 30s, 72 DEG C of 20s finally do melt curve analysis from 55 DEG C -90
DEG C per minute rise 0.5 DEG C.
(6) quantitative PCR data is analyzed
Each sample of target gene HAI-1 is all expanded with the primer of reference gene GAPDH simultaneously, the relative quantity of reaction with
The difference DELTA Ct of the Ct value (taking three duplicate average values) of target gene HAI-1 and reference gene GAPDH is calculated, then chooses Δ
Ct maximum is subtracted with the Δ Ct of other samples as reference and obtains Δ Δ Ct referring to Δ Ct.Relative expression's water of last each gene
It puts down with 2-ΔΔCtValue indicates.
(7) fluorescent quantitative PCR result
The result shows that (as described in Figure 5), there were significant differences in the different gestational periods for HAI-1 gene expression amount.HAI-1 gene exists
Expression quantity in pregnant 50 days placenta tissues is significantly higher than the expression quantity in pregnant 26 and 95 days placentas.HAI-1 gene is not
With having different spatial and temporal expression profiles in gestational period placenta, illustrate that it may play a significant role to pig placenta development, thus
Influence growth and development of the fetus in placenta.
Claims (1)
- Application of the 1.HAI-1 genetic fragment in detection pig birth weight character as molecular labeling, which is characterized in that point The nucleotide sequence of son label has the equipotential of a T36-C36 as shown in SEQ ID NO:1 at the 36th bit base of the sequence The mutation of gene, the mutation lead to Alu1-RFLP polymorphism.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610898124.5A CN106544418B (en) | 2016-10-14 | 2016-10-14 | The clone of pig birth weight character correlation HAI-1 gene molecule marker and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610898124.5A CN106544418B (en) | 2016-10-14 | 2016-10-14 | The clone of pig birth weight character correlation HAI-1 gene molecule marker and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106544418A CN106544418A (en) | 2017-03-29 |
| CN106544418B true CN106544418B (en) | 2019-11-15 |
Family
ID=58369009
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610898124.5A Active CN106544418B (en) | 2016-10-14 | 2016-10-14 | The clone of pig birth weight character correlation HAI-1 gene molecule marker and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106544418B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107779516B (en) * | 2017-09-12 | 2018-10-19 | 华南农业大学 | It is a kind of influence pig birth weight character SNP marker and its application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101824417A (en) * | 2010-05-12 | 2010-09-08 | 湖南农业大学 | Porcine reproductive trait related gene NCOA1 and application thereof in porcine marker-assisted selection |
| CN105063059A (en) * | 2015-08-11 | 2015-11-18 | 湖南农业大学 | Cloning and application of pork quality character related GADD45G gene molecule marker |
-
2016
- 2016-10-14 CN CN201610898124.5A patent/CN106544418B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101824417A (en) * | 2010-05-12 | 2010-09-08 | 湖南农业大学 | Porcine reproductive trait related gene NCOA1 and application thereof in porcine marker-assisted selection |
| CN105063059A (en) * | 2015-08-11 | 2015-11-18 | 湖南农业大学 | Cloning and application of pork quality character related GADD45G gene molecule marker |
Non-Patent Citations (3)
| Title |
|---|
| Hepatocyte growth factor activator inhibitor-1 (HAI-1) is essential for the integrity of basement membranes in the developing placental labyrinth;Bin Fan，et,al;《Developmental Biology》;20071231;第303卷;第222-230页 * |
| Loss of Matriptase Suppression Underlies Spint1 Mutation-Associated Ichthyosis and Postnatal Lethality;Roman Szabo，et，al;《The American Journal of Pathology》;20091231;第174卷(第6期);第2015-2022页 * |
| ss1716630339;ss1716630339;《dbSNP》;20150407;第1-2页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106544418A (en) | 2017-03-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898107B (en) | Major SNP (single nucleotide polymorphism) marker influencing growth traits of pigs and application thereof in genetic improvement of productivity of breeding pigs | |
| CN105524991B (en) | One kind genetic marker relevant to pig semen quality trait and application | |
| CN109811063B (en) | SNP molecular marker related to pig growth speed and application thereof | |
| CN111225977B (en) | Sex-linked genome marker of crayfish and application thereof | |
| CN113502335A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN111926085B (en) | Molecular marker influencing chicken muscle brightness and application thereof | |
| CN106544418B (en) | The clone of pig birth weight character correlation HAI-1 gene molecule marker and its application | |
| EP2478118B1 (en) | Methods of genotyping livestock to determine haplotypes associated with meat quality traits and primer for amplification of a polymorphic region in nt5m | |
| CN108753995A (en) | A kind of and Eriocheir sinensis sex premature character significantly correlated SNP site and application | |
| CN102220410B (en) | Method for auxiliary identification of chickens with different weight properties | |
| CN102220314B (en) | Method for auxiliary identification of chicken populations with different weight traits | |
| CN114574600B (en) | Male molecular marker of alosa sapidissima, and specific primer pair and application thereof | |
| CN103421770B (en) | Heredity markers of pig carcass quality trait and pig meat quality trait related to DIO3 gene and application of heredity markers | |
| CN114875028B (en) | Mutation site associated with sow total litter size trait and application thereof | |
| CN112852974B (en) | Application method of sheep AHR gene insertion/deletion as breeding trait early selection | |
| CN117844944B (en) | SNP (Single nucleotide polymorphism) marker related to pig fat deposition character and application thereof | |
| CN109486957A (en) | Pig multiple groups integrate accurate breeding method | |
| CN108570505B (en) | Multi-group integrated precise breeding method for pigs | |
| CN112458183B (en) | Copy number variation molecular marker on pig No. 3 chromosome and related to daily gain and weight and age on market of pig and application thereof | |
| CN111454958B (en) | SNPs (single nucleotide polymorphisms) of fast-growing high-quality grass carp and application thereof | |
| CN109486956B (en) | Multi-group integrated precise breeding method for pigs | |
| Eichie et al. | Genetic diversity of prolactin gene in Japanese quail (Coturnix coturnix japonica) | |
| Ropka-Molik et al. | New Polymorphisms in Regulatory Regions of Porcine μ-Calpain Gene and Their Association with Transcript Abundance | |
| CN114350820A (en) | Molecular marker related to pig carcass traits and application thereof | |
| CN113774150A (en) | 5 SNPs (single nucleotide polymorphism) markers related to grass carp fructose-1,6-bisphosphatase and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |