CN106544360A - A kind of method of termination lncRNA dialleles transcription - Google Patents

A kind of method of termination lncRNA dialleles transcription Download PDF

Info

Publication number
CN106544360A
CN106544360A CN201610905097.XA CN201610905097A CN106544360A CN 106544360 A CN106544360 A CN 106544360A CN 201610905097 A CN201610905097 A CN 201610905097A CN 106544360 A CN106544360 A CN 106544360A
Authority
CN
China
Prior art keywords
gene
antibiotic
homologous recombination
lncrna
transcription
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201610905097.XA
Other languages
Chinese (zh)
Other versions
CN106544360B (en
Inventor
崔恒宓
刘洋洋
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yangzhou University
Original Assignee
Yangzhou University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yangzhou University filed Critical Yangzhou University
Priority to CN201610905097.XA priority Critical patent/CN106544360B/en
Publication of CN106544360A publication Critical patent/CN106544360A/en
Application granted granted Critical
Publication of CN106544360B publication Critical patent/CN106544360B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/60—Vectors containing traps for, e.g. exons, promoters
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/10—Vectors comprising a non-peptidic targeting moiety
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides a kind of method of termination lncRNA dialleles transcription, comprises the following steps：1) the CMV antibiotic-screening gene PolyA DNA fragmentations respectively containing two kinds of different antibiotic-screening genes are built；2) gRNA is designed according to different target genes, build Cas9/gRNA expression vectors；3) in target gene inserting step 1) in gained CMV antibiotic-screening gene PolyA DNA fragmentations, build the homologous recombination vector containing target gene；4) import cell：By step 3) obtained in the pair of homologous recombinant vector containing target gene, and step 2) obtained in the Cas9/gRNA expression vector cotransfection cells containing target gene；5) using step 1) used in associated antibiotic screen at least 2 weeks, obtain the polyclonal cells strain that is knocked of lncRNA dialleles；The method can be realized reaching the purpose that the cell line that lncRNA dialleles are knocked out simultaneously is quickly obtained while efficiently fixed point is inserted.

Description

A kind of method of termination lncRNA dialleles transcription
Technical field
The present invention relates to genetic engineering field, and in particular to a kind of termination long-chain non-coding RNA diallele transcription Method.
Background technology
The research of long-chain non-coding RNA (lncRNA) function becoming one it is popular, and the disappearance of gene expression is being ground Highly important effect is played in studying carefully gene function.The conventional strategy for causing gene expression disappearance is to carry out RNA interference, but Due to high miss rate and the incomplete downward of RNA, the extensive application of the method is largely limited.Although utilizing base Because edit tool mediation encoding gene frameshift mutation, or for whole gene or promoter large fragment delete can have Realize gene knockout or strike low purpose to effect.But frameshift mutation can not effectively knock out lncRNA, while in long-chain The deletion of large fragment in non-coding RNA research may cause the loss of other gene-correlation function original papers, cause gene work( The erroneous judgement of energy.Additionally, knocking out cell line in order to diallele is obtained in gene knockout, the plenty of time is needed to carry out monoclonal Cell line screening operation.
CRISPR/CAS systems are that a kind of adaptive immunity of the degraded that bacterium and archeobacteria are used for exogenous genetic material is prevented Imperial mechanism, it can also be used in the gene editing including the various systems including mammalian cell.Knocked out using CRISPR/Cas9 During encoding gene, can be knocked out by the insertion of genes of interest base and disappearance.Due to most of base of diploid cell It is because containing two allele, conventional to utilize CRISPR/Cas9 or other technologies means to induce the homologous method pair that recombinated When lncRNA carries out large fragment deletion, in the cell of part, the knockout that there is genes of interest is occurred over just on an allele. That is, the cell population of CRISPR/Cas9 transfections contains the cell that diallele and monoallelic are knocked out.Wherein As the cell quantity of the equal homologous recombination of two allele is very few, bigger difficulty is brought to screening operation.
Chinese patent application CN201010592737.9 discloses a kind of allele double knockout targeting vector system, and this is System is made up of two complementing vectors of pGT-V1 and pGT-V2, and each carrier includes two LoxP elements in the same direction, contains therebetween Two positive riddled basins, outside contain a negative riddled basins, i.e. pGT-V1 carries positive selection markers neomycin phosphorus Sour transferase gene and green fluorescence protein gene, pGT-V2 carry positive selection markers hygromycin gene and red fluorescent protein base Cause, the two all contains negative selection markers herpes simplex virus thymidine kinase gene.In the technical scheme of the patent application, through medicine The selection of thing and the double selection markers of fluorescence, disposably realizes the genetic modification or knockout to two allele of target gene, so as to The efficiency of gene targeting is improved, shortens experimental period.Although the technical scheme is possible in theory, may in practical operation Can there is great number of issues, for example：1) in mammalian embryonic cells, the incidence of homologous recombination is extremely low, therefore, if relied on The homologous recombination of cell itself, that is, allow to realize, the target practice of allele is also extremely difficult, if while realized same Cell diallele is practiced shooting then increasingly difficult simultaneously；Relative to traditional embryonic cell gene targeting, the cell of terminal differentiation As abiogenous same recombination fraction is low, cause the gene knockout for relying on conventional homologous recombination more difficult；This is also the patent In the reason for fail to the example for providing cell targeting, the same program does not have the using value of reality；2) in the technical scheme Fail to provide the example of cell targeting, even if the system is carried out using the method for homologous recombination, can only also be base traditionally Because of restructuring, the homologous recombination arm of thousands of bp brings very big difficulty to the structure of homologous recombination vector；3) system only for The target practice of encoding gene, is not directed to the knockout of Noncoding gene.
The content of the invention
The purpose of the present invention is to set up a kind of method of termination lncRNA dialleles transcription, and the method is a kind of CRISPR/Cas9 mediations, integrate the transcription stop signalses containing double screening labels simultaneously with efficiently accurate in the diallele The transcription of true ground terminator, and efficiently set up the method that homozygous diallele knocks out cell line.Its cardinal principle is： CRISPR/Cas technologies are applied first, the generation of the homologous recombination events of the upper frequency of target gene region induction in the cell, The efficiency (either in embryonic cell or in terminally differentiated cells) of homologous recombination is greatly improved；Secondly, using in genes of interest In by homologous recombination insert PolyA signals, with reach terminator transcription knock out gene purpose；Finally, set up containing double The PolyA homologous recombination vectors of screening label (puromycin resistance gene PuroR and neomycin resistance gene NeoR), it is described After homology arm of the homologous recombination vector in change upstream with downstream, in the double-strand break (Double of CRISPR/Cas9 mediations StRNAd break, DSB) under repair, efficiently can contain two by homologous recombination insertion on two allele The PolyA sequences of individual different screening labels, are subsequently screened using twin antibiotic.By three above advantage, realize efficient While fixed point insertion, the quick purpose for obtaining the cell line that diallele is knocked out simultaneously.
To achieve these goals, technical scheme is as follows：
The invention provides a kind of for terminating the homologous recombination vector that lncRNA dialleles are transcribed, its feature exists In described each homologous recombination vector includes that activity is higher and (refers to effectively transcribe resistant gene, it is ensured that cell expression foot Enough resist the resistance protein of antibiotic) promoter, antibiotic-screening gene and transcription stop signals (Termination Signal) fragment, wherein, there are two kinds of different antibiotic-screening genes, with convenient between each pair homologous recombination vector Screening, the transcription stop signals fragment are located at antibiotic-screening downstream of gene.
Alternatively, the higher promoter of described activity be CMV promoter, its nucleotide sequence be respectively SEQ ID NO.1, antibiotic-screening gene can be Neomycin antibiotic gene (NeoR) or puromycin antibiotic gene (PuroR), Its nucleotide sequence is respectively SEQ ID NO.2 and SEQ ID NO.3.The selection of antibiotic resistance gene is not limited in the two bases Cause can be any two kinds without interactional antibiotic resistance gene.
Alternatively, described transcription stop signals is SV40PolyA (Simian vacuolating virus 40PolyA), β-globin teminator or BGH PolyA (bovine growth hormone PolyA), its nucleosides Acid sequence is respectively SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6；And three kinds of termination signals are not limited only to, Other termination signals can also, as long as meet a) termination efficiency high；B) the characteristics of fragment less easy integration.Preferably, make With BGH PolyA as transcription stop signals, its advantage is as follows：1) BGH PolyA study relatively unambiguous, applied range, and The relatively small insertion for being conducive to homologous recombination of fragment；2) BGH PolyA sequence ends effect be it is directive, its forward direction Terminate activity relatively strong, and reverse termination activity is relatively weak；The transcription stop signals is particularly suitable for grinding for antisense RNA Study carefully, only the transcription of silent DNA positive-sense strand, and weaker is affected on antisense strand, lncRNA is knocked out and will not cause its antisense strand Abnormal expression.
Preferably, the Insert Fragment of described homologous recombination vector is included containing puromycin resistance gene (PuroR) The CMV-PuroR-BGH PolyA and CMV-NeoR-BGH PolyA containing Neomycin antibiotic gene (NeoR)；The former core Nucleotide sequence as shown in SEQ ID NO.7, the sequence for the specific site homologous recombination in target gene, and in target location Insertion CMV-PuroR-BGH PolyA signals；, as shown in SEQ ID NO.8, the sequence is in target for the nucleotide sequence of the latter To the specific site homologous recombination of gene, CMV-NeoR-BGH PolyA signals are inserted in target location.
Present invention also offers a kind of method of termination lncRNA dialleles transcription, it is characterised in that including following Step：
1) build as above respectively containing two kinds of different antibiotic-screening gene (alternatively, puromycin-resistant bases Because of (PuroR) or neomycin resistance gene (NeoR)) CMV- antibiotic-screening gene-PolyA DNA fragmentations；Wherein, exist Preferred BGH PolyA in above-mentioned termination signal, build CMV-PuroR-BGH PolyA and CMV-NeoR-BGH PolyA DNA pieces Section；
2) different gRNA are designed according to different target genes, build the Cas9/gRNA expression vectors containing target gene, For example, gRNA targeting lncRNA gene Ms ALAT1 for building in embodiment；
3) in target gene inserting step 1) obtained in respectively containing two kinds of different antibiotic-screening genes PolyA DNA fragmentations, build the homologous recombination vector containing target gene；Alternatively, when step 2) in select containing targeting The targeting genes of interest group of the Cas9/gRNA expression vectors of gene is MALAT1 gene locis, upper and lower in MALAT1 target sites Trip respectively takes 800bp respectively as left side homology arm and right side homology arm, with step 1) the middle CMV-PuroR-BGH PolyA for obtaining Connect with CMV-NeoR-BGH PolyA fragments, build MALAT1-CMV-PuroR-BGH PolyA and MALAT1-CMV-NeoR- BGH PolyA homologous recombination vectors；
4) import cell：By step 3) obtained in the homologous recombination vector containing target gene, and step 2) in The Cas9/gRNA expression vector cotransfection experiments cells containing target gene for being obtained (can transfect inhomogeneity as needed Type cell), such as：HEK293 cells；
5) using step 1) used in the associated antibiotic of antibiotic resistance gene screen at least 2 weeks, obtain lncRNA double The polyclonal cells strain that allele is knocked.
The beneficial effect that technical scheme reaches is：
1) using CRISPR/Cas9 System-mediateds, by transcription stop signals (such as：PolyA) target as element insertion In lncRNA genes, and the PolyA signal segments be located at antibiotic-screening downstream of gene, and with resistant gene co-integration Termination transcription of targeted genes is reached to target gene promoters downstream, finally realize the purpose of gene knockout.The PolyA signals can A) to ensure normal transcription and the translation of resistant gene, while terminating the transcription in resistant gene downstream；B) PolyA signals insertion In genes of interest, can not only terminate the transcription in resistant gene downstream, while genes of interest is also terminated in PolyA downstream parts Transcription (both carry out) simultaneously.Compared with existing gene knockout method, the gene knockout method that the present invention is provided is not only Quickly, accurate and success rate is high, and is not result in the loss of other gene-correlation function element, it is ensured that Functional identification of genes It is more accurate.It is particularly well-suited to the research of long-chain non-coding RNA.In addition the CMV promoter that homologous recombination vector is included ensure that The stable expression of resistant gene, with prevent integrate after by resistance protein caused by endogenous weaker gene promoter too low, nothing Method is effectively screened.
2) due to the efficient specificity of CRISPR/Cas9 targeting DNA sequence dnas and homologous recombination, method energy of the present invention It is enough that efficiently target gene is modified, and cause the transcription of diallele terminator；Simultaneously because homologous recombination Specificity also further increases the accuracy for obtaining that diallele is knocked out.
3) in the method for twin antibiotic screening, using double mechanism just screened, it is ensured that rapidly and accurately can filter out same Source recombinant vector is stably inserted into, and smooth gene of expression group, to guarantee that high-efficiency sieve selects diallele knockout Cell line, improves the screening efficiency of genetically modified cell, efficiently to produce homozygous Knockout cells strain.
4) method of the present invention, it is adaptable to which the genetic transcription of clone terminates, and then determine gene function.The present invention The homologous recombination vector containing CMV-PuroR-BGH PolyA and CMV-NeoR-BGH PolyA elements for providing, this professional people Member can design corresponding homologous recombination sequence according to different target position, to reach suitable for different plant species clone, carry out gene The purpose that tanscription termination gene expression is knocked out, the research for gene lacks functionality provide effective ways.
Description of the drawings
Fig. 1 is the different termination signal of screening.Termination signal is inserted into pIRES-EGFP MCSs, and is transfected thin Born of the same parents.
Fig. 2 is detection IRES primer targeting schematic diagrames.
Fig. 3 is the transcriptional level of IRES sequence RNAs.
Fig. 4 is the CMV-PuroR-BGH PolyA and CMV-NeoR-BGH PolyA pieces obtained after over-lap PCR is expanded Section schematic diagram.
Fig. 5 is the structural representation of the MALAT1 homologous recombination vectors built in embodiment 1.Amplification targeting MALAT1 sites The common 1600bp DNA of upstream and downstream, and be cloned in carrier T.By inverse PCR, in MALAT1 target sites by the carrier line After property, it is attached with CMV-PuroR-BGH PolyA and CMV-NeoR-BGH PolyA respectively.
Fig. 6 be containing double screening label carriers respectively with two allele homologous recombination schematic diagrames.
Fig. 7 is to separately design primer in homologous recombination region upstream and downstream, for identifying the cell line of PolyA insertions.
Fig. 8 is the cell line that PolyA is inserted using homologous recombination region upstream and downstream primer primer identification allele.Its In, 1. using the DNA of untransfected genome as template, amplification shows 1 band, i.e.,：Wild type 1831bp；2. using the present invention Two allele of method insert PolyA monoclonal cell system genomic DNA be template, only containing PolyA insertion Two bands are respectively 3173bp and 3318bp.
Fig. 9 is the RT-qPCR testing results of the transcription situation for detecting MALAT1 genes.Using homologous recombination region upstream and downstream After primer identification, four clones for taking diallele knockout are selected at random, MALAT1-KD-2, MALAT1- is respectively designated as KD-3, MALAT1-KD-5 and MALAT1-KD-7, detect the MALAT1mRNA levels of the clone.Using GAPDH as internal reference.
Specific embodiment
In order to illustrate technical scheme and technical purpose, below in conjunction with the accompanying drawings and specific embodiment is to the present invention It is described further.Method in following embodiments, if no special instructions, is conventional method.
Embodiment 1
The present embodiment 1 provides the targeting knock out for how applying the inventive method to carry out for MALAT1 genes.Its In, select MALAT1 (being located at MALAT1 First Introns) to be target area, build containing the homologous heavy of twin antibiotic gene Group carrier MALAT1-CMV-PuroR-BGH PolyA and MALAT1-CMV-NeoR-BGH PolyA, are situated between using CRISPR/Cas9 The DNA double chain fracture led, inserts MALAT1 promoters downstream by homologous recombination, terminates the expression of MALAT1 genes, most High frequency zone is carried out using twin antibiotic gene afterwards diallele is obtained while the cell line for knocking out.
According to different target genes, can by design and be revised as the corresponding homology arm sequence of required target gene and (gene targetted by CRISPR/Cas) gRNA sequences, so as to this method is applied to different plant species cell including people Pnca gene tanscription termination.
1. the PolyA DNA fragmentations containing double screening labels are built：CMV-PuroR-BGH PolyA and CMV-NeoR-BGH PolyA：
1.1 amplification CMV promoter regions
With pcDNA3.1 (+) (Invitrogen) as template, using high-fidelity enzyme (Phanta HS Super-Fidelity DNA Polymerase, Nuo Weizan biotech firm) amplification CMV promoter.Its reaction system includes：1ng pcDNA3.1 (+) make For template, 1 μ L (10 μM) CMV-F and 1 μ L (10 μM) CMV-R respectively as amplimer, 1 μ L DNA Polymerase, 10 μ L 5x SF Buffer, 1 μ L (10 μM) dNTP Mix and 32 μ L ddH2O.Its reaction condition is：95℃2min；95 DEG C of 10s, 54 DEG C 30S, 72 DEG C of 30s, 30x are circulated；72℃5min；4 DEG C of maintenances.Primer is as follows：
CMV-F:GACATTGATTATTGACTAGTTATTAAT；(SEQ ID NO.9)
CMV-R:TGGGCCAGGATTCTAGCTCTGCTTATATAGACCTCCC。(SEQ ID NO.10)
1.2 amplification PuroR and NeoR gene orders and with CMV sequence assemblies：
With pSMPUW-IRES-Puro (Cell Biolabs) as template, using high-fidelity enzyme (Phanta HS Super- Fidelity DNA Polymerase, Nuo Weizan biotech firms) amplification PuroR genes, wherein, the primer PuroR-F and The nucleotide sequence of PuroR-R is as follows：
PuroR-F：5’-GGAGAATCCTGGCCCAATGACCGAGTACAAGCCCAC-3’；(SEQ ID NO.11)
PuroR-R：5’-GTTGGGCGCGCCTCATCCTGCAGTCAGGCACCGGGCTTGCGG-3’.(SEQ ID NO.12)
With pcDNA3.1 (+) (Invitrogen) as template, using high-fidelity enzyme (Phanta HS Super-Fidelity DNA Polymerase, Nuo Weizan biotech firm) amplification NeoR genes, wherein, the nucleosides of the primer NeoR-F and NeoR-R Acid sequence is as follows：
NeoR-F：5’-AGAATCCTGGCCCAATGATTGAACAAGATGGATTGCACG-3’；(SEQ ID NO.13)
NeoR-R：5’-AGGTTGGGCGCGCCGGCGTCGCTTGGTCGGTC-3’.(SEQ ID NO.14)
PuroR genes and NeoR genes after amplification is spelled by over-lap PCR (overlap PCR) with CMV sequences respectively Connect, obtain CMV-PuroR and CMV-NeoR.Wherein the primer sequence is ibid.Its reaction system includes：100ng PuroR or , respectively as template, 1 μ L (10 μM) upstream primer CMV-F and 1 μ L (10 μM) PuroR-R or NeoR-R are respectively as amplification for NeoR Primer, 1 μ L DNA Polymerase, 10 μ L 5x SF Buffer, 1 μ L (10 μM) dNTP Mix and 32 μ L ddH2O.Which is anti- The condition is answered to be：95℃2min；95 DEG C of 10s, 54 DEG C of 30s, 72 DEG C of 30s, 10x are circulated；95 DEG C of 10s, 65 DEG C of 20s, 72 DEG C of 20s, 25x Circulation；72℃5min；4 DEG C of maintenances.
1.3 amplification BGH PolyA sequences, and splice with CMV-PuroR and CMV-NeoR respectively：
With pcDNA3.1 (+) as template, using high-fidelity enzyme (Phanta HS Super-Fidelity DNA Polymerase, Nuo Weizan biotech firm) amplification BGH PolyA signal sequences.Its reaction system includes：1ng pcDNA3.1 (+) as template, 1 μ L (10 μM) upstream primer BGH-F and 1 μ L (10 μM) BGH-R respectively as amplimer, 1 μ L DNA Polymerase, 10 μ L 5x SF Buffer, 1 μ L (10 μM) dNTP Mix and 32 μ L ddH2O.Its reaction condition is：95℃ 10s, 65 DEG C of 20s, 72 DEG C of 20s, 30x are circulated；72℃5min；4 DEG C of maintenances.Wherein, the nucleosides of the primer BGH-F and BGH-R Acid sequence is as follows
BGH-F：5’-GGCGCGCCCAACCTACGACTGTGCCTTCTAGTTGCCAGC-3’；(SEQ ID NO.15)
BGH-R：5’-CTAGCCATAGAGCCCACCGCATCCC-3’.(SEQ ID NO.16)
CMV-PuroR and CMV-NeoR will be obtained subsequently and in step 1.2 pass through Chong Die with BGH PolyA signal sequences PCR obtains CMV-PuroR-BGH PolyA and CMV-NeoR-BGH PolyA fragments (Fig. 4), wherein comprising CMV promoter, PuroR or NeoR and BGH PolyA signals.Nucleotide sequence is respectively as shown in SEQ ID NO.1 and SEQ ID NO.2.Which is anti- In answering system, template is 10ng CMV-PuroR or CMV-NeoR and 10ng BGH PolyA, and primer draws for 1 μ L (10 μM) upstream Thing CMV and 1 μ L (10 μM) BGH-R, the system and reaction condition of remainder is with described in step 1.2.
1.4 using T4 polynueleotide kinases ((being purchased from NEB) Business Name) process CMV-PuroR-BGH PolyA and CMV-NeoR-BGH PolyA fragments, make 5 ' terminal phosphate of DNA fragmentation for follow-up coupled reaction.
2. the Cas9/gRNA-MALAT1 expression vectors of targeting MALAT1 genes are built：
2.1 using BsmbI restriction endonucleases (being purchased from NEB companies) digestion CRISPR/Cas9 expression vectors (the biological public affairs of Yao and Shun Yu Department), and cut glue reclaim DNA fragmentation；
2.2 use http:GRNA sequence of the //crispr.mit.edu/ designs for MALAT1 (GCAACGCAGAAGCCCGGCGC), and synthesize build MALAT1-gRNA two oligonucleotide sequence MALAT1-F and MALAT1-R, is dissolved using TE buffer, and using annealing Buffer two sections of oligonucleotide sequences of annealing.Its reaction system bag Include：48 μ L annealing buffers, 1 μ L (100 μM) MALAT1-F and 1 μ L (100 μM) MALAT1-R.95 DEG C of 5min are heated using PCR, Then Temperature fall.Wherein, the nucleotide sequence of primer sequence is as follows：
MALAT1-F：5’-CACCGCAACGCAGAAGCCCGGCGC-3’；(SEQ ID NO.17)
MALAT1-R：5’-AAACGCGCCGGGCTTCTGCGTTGC-3’.(SEQ ID NO.18)
2.3 by annealed product and CRISPR/Cas9 expression vectors linearized fragment using T4 ligases (being purchased from NEB companies) Connection, and DH5 α bacterium competence is transformed into, build Cas9/gRNA-MALAT1 expression vectors.
3. targeting MALAT1 homologous recombination vectors are built:
With pGEM-T easy carriers (being purchased from Promega companies) as skeleton carrier, homologous recombination vector is built respectively MALAT1-CMV-PuroR-BGH PolyA and MALAT1-CMV-NeoR-BGH PolyA (Fig. 5).CMV promoter ensure that anti- Property stable gene expression (other activated promoters)；Puromycin antibiotic gene (PuroR) or neomycin antibiosis Plain gene (NeoR) is applied to the screening after homologous recombination；Ox growth factor polyadenosine acid signal (BGH PolyA) is for end The only transcription of RNA, MALAT1 be left and right homologous recombination arm, each 800bp of upstream and downstream.Step is as follows：
3.1 is template using HEK293 genomic DNAs, is expanded using the primer MALAT1-LHA-F and MALAT1-RHA-R Increase MALAT1 homology arm sequences, using PCR primer Purification Kit after, and with Taq enzyme (being purchased from Nuo Weizan biotech firms) Add A in DNA afterbodys, be then attached to pGEM-T easy carriers (being purchased from Promega companies), obtain MALAT1-T carriers.It is used The nucleotide sequence of primer is as follows：
MALAT1-LHA-F：5’-TTTGCTCACGTCTCACTCTCGGAGAGGGTGGGTGTCACC-3’；(SEQ ID NO.19)
MALAT1-RHA-R：5’-ATGTAACGCGTCTCACTCTTACTTTCCATTACGCAACTGAGCCCCAG-3’. (SEQ ID NO.20)
3.2 with MALAT1-T carriers as template, whole with the primer MALAT1-LHA-R and MALAT1-RHA-F amplifications The carrier is linearized (schematic diagram is shown in Fig. 5) in ad-hoc location using inverse PCR by MALAT1-T carriers, and uses DpnI inscribes Enzyme (being purchased from NEB companies) processes PCR primer, removes plasmid template, obtains linearizing MALAT1-T carriers.The core of the primer Nucleotide sequence is as follows：
MALAT1-LHA-R：5’-TTTGCTCACGTCTCGAATTCGCCGGGAAGCCTCAGCTCG-3’；(SEQ ID NO.21)
MALAT1-RHA-F：5’-ATGTAACGCGTCTCATAGACGGGCTTCTGCGTTGCTAAAATGG-3’.(SEQ ID NO.22)
3.3 by the phosphorylation CMV-PuroR-BGH PolyA and CMV-NeoR-BGH PolyA obtained in step 1.4 point It is not connected with linearizing MALAT1-T carriers, and is transformed into DH5 α bacterium competence, builds MALAT1-PuroR-BGH PolyA and MALAT1-NeoR-BGH PolyA homologous recombination vectors are simultaneously sequenced.Its MALAT1 homologous recombination vector structural representation As shown in Figure 5.
4. homologous recombination vector and Cas9/gRNA transfectional cells and screening.
4.1 using lip2000 transfection reagents (being purchased from Gbico), according to reagent specification, obtains in cotransfection step 3.3 Linearisation homologous recombination vector and step 2.3 obtained in Cas9/gRNA-MALAT1 expression vectors.Cell culture is used (DMEM culture mediums (being purchased from Gbico) serum containing 10%FBS (being purchased from Gbico) and 1% mycillin (are purchased from DMEM culture mediums Hyclone),；2*10 is inoculated with 6mm Tissue Culture Dish using trypsase (being purchased from Gbico) vitellophag6Individual cell/per hole, Transfection after 24h linearizes homologous recombination vector totally 4 μ g (MALAT1-CMV-PuroR-BGH PolyA and MALAT1-CMV-NeoR- BGH PolyA carriers) and 4 μ g Cas9/gRNA-MALAT1 carriers.Should containing double screening label carriers respectively with two equipotential bases Because homologous recombination schematic diagram is shown in Fig. 5.
After 4.2 transfections 24 hours, by cell 1:3 are passed on.
After 4.3 transfections 72 hours, the puromycin (Sigma) of 1 μ g/mL concentration is added to be screened.
After 4.4 add puromycin to screen 72 hours, add the G418 (Sigma) of 400 μ g/mL to carry out screening 2 weeks, obtain Polyclonal cells strain.
Embodiment 2
This example 2 is there is provided to (the Simian vacuolating virus of transcription stop signals SV40PolyA in the present invention 40PolyA), BGH PolyA (bovine growth hormone PolyA) and β-globin teminator are in its termination effect (see Fig. 1) is compared in optimization in terms of the termination efficiency of rate, molecular size range and reverse sequence.Wherein, SV40PolyA (Simian vacuolating virus 40PolyA), BGH PolyA (bovine growth hormone PolyA) are point Son can grand wide variety of transcription stop signals；And β-globin teminator are the termination signals of gene β-globin, To study more thorough transcription stop signals.Using these three transcription stop signalses, compare which and terminate efficiency, and molecular weight Size, and the termination efficiency of reverse sequence is shown in Fig. 1.
Specifically include following steps：
A) pcr amplification primer thing is designed for SV40PolyA, β-globin teminator and BGH PolyA. SV40PolyA is expanded with plasmid ----as template；β-globin teminator are with human genome as template；BGH PolyA With pcDNA3.1 as template.The DNA fragmentation of acquisition inserts pIRES-EGFP MCSs by EcoRI restriction enzyme sites.Respectively Build BGH PolyA (+), BGH PolyA (-), SV40PolyA and β-globin and see Fig. 1.BGH PolyA used, SV40PolyA and β-globin primer sequences are as follows：
BGH-PolyA-F：5’-TTCGAATTCCTGTGCCTTCTAGTTGCC-3’
BGH-PolyA-R：5’-CAGAATTCCCATAGAGCCCACCGCATC-3’
SV40PolyA-F：5’-GCTGAATTCTTAACTTGTTTATTGCAGCTTATAATGGTTAC-3’
SV40PolyA-R：5’-GCTGAATTCTAAGATACATTGATGAGTTTGGACAAACCA-3’
β-globin-F：5’-TTCGAATTCGCTCGCTTTCTTGCTG-3’
β-globin-R：5’-GCAGAATTCCTCCCACCCCCAAC-3’
B) by the carrier difference transfected HEK 293 for building, (it is purchased from according to TRIzol RNA extracts reagents within 24 hours Life companies) specification extracts RNA, and (purchase according to PrimeScriptTM RT reagent Kit with gDNA Eraser In Takara) RNA that extracts of specification reverse transcription, and the transcriptional expression level of IRES is detected using RT-qPCR, NeoR is transcribed into It is interior referring to Fig. 2.The nucleotide sequence of the primer used in this detection method is as follows：
IRES-F：5’-CCCTGTCTTCTTGACGAGCAT-3’
IRES-R：5’-GGGTCGCTACAGACGTTGTTT-3’
NEO-F：5’-ATCCATCATGGCTGATGCAATGCG-3’
NEO-R：5’-CCATGATATTCGGCAAGCAGGCAT-3’
As a result (Fig. 3) shows that the BGH PolyA of three termination signals have good termination efficiency, wherein BGH PolyA Terminate efficiency highest with β-globin, while BGH PolyA reversely only have faint termination efficiency seeing.Three termination signals it is big It is little to be respectively：BGH-PolyA：255bp, SV40PolyA：122bp, β-globin teminator：1753bp.In view of transcription The efficiency of termination and the size of molecular weight, termination signals of the preferred BGH PolyA as the present invention.
Embodiment 3
In the present embodiment 3, in the polyclonal cells strain using limiting dilution assay from obtained in embodiment 1, monoclonal is obtained Cell line, and the transcription situation of MALAT1 is detected by RT-qPCR.
Specifically include following steps：
A) when monoclonal cell strain is obtained using limiting dilution assay, first the cell to obtaining after screening in embodiment 1 enters Row dilution.About 50 cells in 10ml culture mediums, in 96 orifice plates, each hole is inoculated with 100 μ l, cultivates 15 days；
B) DNA and RNA is extracted according to TRIzol reagents (being purchased from Life companies) specification respectively；
C) using Genotyping PCR method, with the upstream and downstream primer in homologous recombination region as shown in fig. 7, to extract Sample DNA is template, enters performing PCR detection (Fig. 8).The nucleotide sequence of the primer used in this detection method is as follows：
MALAT1-HDR-F：5’-CCCTCGGAGTTGACTGCCTA-3’；
MALAT1-HDR-R：5’-CGGGTCATCAAACACCTCACA-3’.
During the wherein DNA of untransfected genome is as the sample of template, a band is amplified：1831bp is wild type equipotential Gene magnification band；However, with the monoclonal cell system genomic DNA after being transcribed using method of the present invention terminator being In the sample 2 of template, its amplification only has 3318bp and 3173bp, without wild type band.Check sample in relatively Fig. 6 with Sample 2,3,5 and 7 is as can be seen that two allele insert the PolyA containing different antibiotic resistance genes in monoclonal Signal, and there is no the allele containing wild type (i.e. 1831bp sequences).
D) according to PrimeScriptTM RT reagent Kit with gDNA Eraser (being purchased from Takara) specifications The RNA that reverse transcription is extracted, and RT-qPCR detection MALAT1RNA are carried out using SYBR Premix Ex Taq (being purchased from Takara) Expression, GAPDH is internal reference.Following (the Primer of the nucleotide sequence of the primer used in this detection method Express3.0, is purchased from ABI companies)：
MALAT1-F：5’-GGTAACGATGGTGTCGAGGTC-3’；
MALAT1-R：5’-CCAGCATTACAGTTCTTGAACATG-3’；
GAPDH-F：5’-GACTCCACGACGTACTCAGCGCCAGCATCG-3’；
GAPDH-R：5’-AAGGTGAAGGTCGGAAGGTGAAGGTCGG-3’.
The positive clone strain of the PolyA inserted according to double equipotential Ji Jiyin that the method in c) step is selected.Select three Individual clone, clone1-3 detect that the expression testing result of its MALAT1RNA is as shown in Figure 9.Relative to being not inserted into PolyA Compared with control cells, three of BGH PolyA clone the expression for significantly reducing MALAT1 mRNAs.Under each sample Precipitation is to extremely low level.The result shows that allele inserts BGH PolyA, can effectively terminate lncRNA genes The transcription of MALAT1 genes, pole significantly decrease the expression of mRNA.
Embodiment 4
In the present embodiment 4, in the polyclonal cells strain using limiting dilution assay from obtained in embodiment 1, monoclonal is obtained Cell line, have evaluated the insertion efficiency that lncRNA dialleles insert BGH PolyA by Genotyping PCR.
Specifically include following steps：
A) using in above-described embodiment 3 a) in method obtain a large amount of monoclonal cells；
B) monoclonal cell extracts DNA according to TRIzol reagents (being purchased from Life companies) specification；
C) using in above-described embodiment 3 c) in method, with monoclonal DNA as template assessment genome insertion efficiency.
Table 1 shows the genotype that lncRNA diallele insertions are carried out for monoclonal sample extraction genomic DNA Analysis result：In 47 monoclonal samples, the monoclonal that double equipotential Ji Jiyin insertions occur is 37, and single allele is inserted The monoclonal for entering is 8.It is integrated in allele using the homologous recombination vector containing Double screening-gene simultaneously, is passed through The screening of twin antibiotic can efficiently obtain the positive colony of diallele insertion, and its efficiency high is up to 78.7%.Wherein it is The carrier of homologous recombination is 4, it may be possible to false positive caused by homologous recombination vector radom insertion.As a result show to use and contain two The PolyA methods of antibiotic resistance gene are planted, the cell line that diallele is inserted extremely can be efficiently screened.And Insert Fragment PolyA signals then efficient terminator transcription, extremely significantly reduce the expression of mRNA.
The insertion efficiency of 1. diallele BGH PolyA of table：
Note：Cell allele inserts the BGH PolyA sequences containing different resistant genes respectively by homologous recombination, inspection Survey the homologous recombination efficiency for obtaining monoclonal cell strain.
General principle, principal character and the advantages of the present invention of the present invention has been shown and described above.The technology of the industry Personnel it should be appreciated that the present invention is not restricted to the described embodiments, the simply explanation described in above-described embodiment and specification this The principle of invention, without departing from the spirit and scope of the present invention, the present invention also has various changes and modifications, the present invention Claimed scope is by appending claims, specification and its equivalent thereof.

Claims (9)

1. a kind of homologous recombination vector for terminating the transcription of lncRNA dialleles, it is characterised in that described each is homologous Recombinant vector includes effectively transcribing resistant gene and ensures that opening for the resistance protein of antibiotic is resisted in cell expression enough Mover, antibiotic-screening gene and transcription stop signals (Termination signal) fragment, wherein, each pair homologous recombination is carried There are between body two kinds of different antibiotic-screening genes, the transcription stop signals fragment is located under antibiotic-screening gene Trip.
2. a kind of homologous recombination vector for terminating the transcription of lncRNA dialleles as claimed in claim 1, its feature It is that described promoter is CMV promoter, its nucleotides sequence is classified as SEQ ID NO.1.
3. a kind of homologous recombination vector for terminating the transcription of lncRNA dialleles as claimed in claim 2, its feature It is that described antibiotic-screening gene is puromycin resistance gene (PuroR) or neomycin resistance gene (NeoR), its Nucleotide sequence is respectively SEQ ID NO.2 and SEQ ID NO.3.
4. a kind of for terminating the homologous recombination vector that lncRNA dialleles are transcribed as described in claim 1 or 2, its Be characterised by, described transcription stop signals fragment be SV40PolyA (Simian vacuolating virus 40PolyA), β-globin teminator or BGH PolyA (bovine growth hormone PolyA), its nucleotide sequence distinguish For SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6.
5. a kind of homologous recombination vector for terminating the transcription of lncRNA dialleles as claimed in claim 3, its feature Be, described transcription stop signals fragment be SV40PolyA (Simian vacuolating virus 40PolyA), β- Globin teminator or BGH PolyA (bovine growth hormone PolyA), its nucleotide sequence is respectively SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6.
6. a kind of homologous recombination vector for terminating the transcription of lncRNA dialleles as claimed in claim 5, its feature It is that described transcription stop signals fragment is BGH PolyA.
7. a kind of homologous recombination vector for terminating the transcription of lncRNA dialleles as claimed in claim 6, its feature It is that the Insert Fragment of described each pair homologous recombination vector is included respectively containing puromycin antibiotic gene (PuroR) The CMV-PuroR-BGH PolyA and CMV-NeoR-BGH PolyA containing Neomycin antibiotic gene (NeoR)；Wherein, the former Nucleotide sequence as shown in SEQ ID NO.7, the nucleotide sequence of the latter is as shown in SEQ ID NO.8.
8. a kind of homologous recombination vector for terminating the transcription of lncRNA dialleles as claimed in claim 1, its feature It is that described antibiotic-screening gene is puromycin resistance gene (PuroR) or neomycin resistance gene (NeoR), its Nucleotide sequence is respectively SEQ ID NO.2 and SEQ ID NO.3.
9. a kind of method that termination lncRNA dialleles are transcribed, it is characterised in that comprise the following steps：
1) the CMV- antibiotic-screening gene-PolyA DNA fragmentations respectively containing two kinds of different antibiotic-screening genes are built；
2) different gRNA are designed according to different target genes, builds the Cas9/gRNA expression vectors containing target gene；
3) in target gene inserting step 1) obtained in the CMV- respectively containing two kinds of different antibiotic-screening genes resist Raw element screening-gene-PolyA DNA fragmentations, build the homologous recombination vector containing target gene；
4) import cell：By step 3) obtained in the pair of homologous recombinant vector containing target gene, and step 2) in The Cas9/gRNA expression vector cotransfection cells containing target gene for being obtained；
5) using step 1) used in the associated antibiotic of antibiotic resistance gene screen at least 2 weeks, obtain the double equipotentials of lncRNA The polyclonal cells strain that gene is knocked.
CN201610905097.XA 2016-10-17 2016-10-17 A method of terminating the transcription of lncRNA diallele Active CN106544360B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610905097.XA CN106544360B (en) 2016-10-17 2016-10-17 A method of terminating the transcription of lncRNA diallele

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610905097.XA CN106544360B (en) 2016-10-17 2016-10-17 A method of terminating the transcription of lncRNA diallele

Publications (2)

Publication Number Publication Date
CN106544360A true CN106544360A (en) 2017-03-29
CN106544360B CN106544360B (en) 2019-11-05

Family

ID=58369195

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610905097.XA Active CN106544360B (en) 2016-10-17 2016-10-17 A method of terminating the transcription of lncRNA diallele

Country Status (1)

Country Link
CN (1) CN106544360B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108148861A (en) * 2018-01-17 2018-06-12 扬州大学 A kind of the HEK293 cell lines and its construction method of RNA methylases TRDMT1 gene knockouts
CN111218479A (en) * 2018-11-26 2020-06-02 上海长海医院 Method for realizing knock-out of transcribable element by knocking-in terminator by gene editing technology
CN114107291A (en) * 2020-08-27 2022-03-01 阿思科力(苏州)生物科技有限公司 Gene editing system and method for site-specific insertion of exogenous gene

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1539988A (en) * 2003-07-15 2004-10-27 南开大学 Gene target sequence box
CN103525868A (en) * 2013-10-17 2014-01-22 百泰生物药业有限公司 Construction and application of mammal cell high-efficiency expression vector
CN103525867A (en) * 2013-10-17 2014-01-22 北京东方百泰生物科技有限公司 Construction and application of vector used for developing high-expression cell strain
CN104946687A (en) * 2015-06-09 2015-09-30 北京东方百泰生物科技有限公司 Mammal dual gene highly efficient screening expression vectors and construction method thereof
CN105980568A (en) * 2013-12-11 2016-09-28 瑞泽恩制药公司 Methods and compositions for the targeted modification of a genome

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1539988A (en) * 2003-07-15 2004-10-27 南开大学 Gene target sequence box
CN103525868A (en) * 2013-10-17 2014-01-22 百泰生物药业有限公司 Construction and application of mammal cell high-efficiency expression vector
CN103525867A (en) * 2013-10-17 2014-01-22 北京东方百泰生物科技有限公司 Construction and application of vector used for developing high-expression cell strain
CN105980568A (en) * 2013-12-11 2016-09-28 瑞泽恩制药公司 Methods and compositions for the targeted modification of a genome
CN104946687A (en) * 2015-06-09 2015-09-30 北京东方百泰生物科技有限公司 Mammal dual gene highly efficient screening expression vectors and construction method thereof

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
JINXIONG HAN ET AL.: ""Efficient in vivo deletion of a large imprinted lncRNA by CRISPR/Cas9"", 《RNA BIOLOGY》 *
MORITZ EIΒMANN ET AL.: ""Loss of the abundant nuclear non-coding RNA MALAT1 is compatible with life and development"", 《RNA BIOLOGY》 *
SCOTT J.GRATZ ET AL.: ""Highly Specific and Efficient CRISPR/Cas9-Catalyzed Homology-Directed Repair in Drosophila"", 《GENETICS》 *
SHOTA NAKADE ET AL.: ""Microhomology-mediated end-joining-dependent ntegration of donor DNA in cells and animals using TALENs and CRISPR/Cas9"", 《NATURE COMMUNICATIONS》 *
TONY GUTSCHNER ET AL.: ""Noncoding RNA gene silencing through genomic integration of RNA destabilizing elements using zinc finger nucleases"", 《GENOME RESEARCH》 *
VIKRAM R.PARALKAR ET AL.: ""Unlinking an lncRNA from Its Associated cis Element"", 《MOLECULAR CELL》 *
YAFEI YIN ET AL.: ""Opposing Roles for the lncRNA Haunt and Its Genomic Locus in Regulating HOXA Gene Activation during Embryonic Stem Cell Differentiation"", 《CELL STEM CELL》 *
魏庆信 等: "《转基因猪制备技术》", 31 October 2013, 中国农业出版社 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108148861A (en) * 2018-01-17 2018-06-12 扬州大学 A kind of the HEK293 cell lines and its construction method of RNA methylases TRDMT1 gene knockouts
CN111218479A (en) * 2018-11-26 2020-06-02 上海长海医院 Method for realizing knock-out of transcribable element by knocking-in terminator by gene editing technology
CN114107291A (en) * 2020-08-27 2022-03-01 阿思科力(苏州)生物科技有限公司 Gene editing system and method for site-specific insertion of exogenous gene
CN114107291B (en) * 2020-08-27 2024-05-03 苏州因特药物研发有限公司 Gene editing system and method for exogenous gene fixed-point insertion

Also Published As

Publication number Publication date
CN106544360B (en) 2019-11-05

Similar Documents

Publication Publication Date Title
Hanson et al. Analysis of biological selections for high-efficiency gene targeting
AU2019408503B2 (en) Compositions and methods for highly efficient genetic screening using barcoded guide rna constructs
US20230183884A1 (en) A method for crispr library screening
CN107828738A (en) A kind of dnmt rna deficiency Chinese hamster ovary celI system and preparation method and application
US20020150945A1 (en) Methods for making polynucleotide libraries, polynucleotide arrays, and cell libraries for high-throughput genomics analysis
US20210198699A1 (en) Kit for reparing fbn1t7498c mutation, combination for making and repairing mutation, and method of repairing thereof
WO2023142594A1 (en) Accurate pam-limitation-free adenine base editor and use thereof
CN106520829A (en) Method for terminating biallelic gene transcription
CN106544360B (en) A method of terminating the transcription of lncRNA diallele
JPWO2018030457A1 (en) Method for modifying target site of eukaryotic cell genome and method for detecting presence or absence of nucleic acid sequence to be detected in target site
US11946163B2 (en) Methods for measuring and improving CRISPR reagent function
WO2020100361A1 (en) Method for producing genome-edited cells
CN107881200A (en) A kind of rapid screening method applied to model animal zebra fish transgenosis
Doria-Borrell et al. Generation of knockout mouse trophoblast stem cells by CRISPR/Cas9
WO2021204807A1 (en) Methods for targeted integration
Cai et al. A stress-free strategy to correct point mutations in patient iPS cells
CN113881703A (en) Method for improving CHO cell homologous recombination efficiency and related product and application thereof
WO2020036181A1 (en) Method for isolating or identifying cell, and cell mass
Raghavan et al. High-throughput screening and CRISPR-Cas9 modeling of causal lipid-associated expression quantitative trait locus variants
US20020094536A1 (en) Methods for making polynucleotide libraries, polynucleotide arrays, and cell libraries for high-throughput genomics analysis
CN109082426A (en) The zebra fish cip2a gene mutation body and its construction method constructed using CRISPR-Cas9
WO2023050158A1 (en) Method for achieving multi-base editing
CN113025652B (en) Cell strain capable of stably expressing ABEmax protein and preparation method and application thereof
US20230227818A1 (en) Clinically applicable characterization of genetic variants by genome editing
CN115725652A (en) Method for realizing multi-base editing

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant