CN106520926A - A kind of primer sets and detection method for detecting cancer of pancreas - Google Patents

Abstract

The present invention is provided to detect the primer sets and its detection method of cancer of pancreas, the primer of the present invention includes SEQ ID No.1 SEQ ID No.18, can carry out joint-detection to CK18, CK20, CEA, Vimentin, MUC1, Epcam, Birc5, EGFR and C met genes.By PCR or the method for quantitative fluorescent PCR, Sensitive Detection expression and the expression of target gene can be gone out at short notice；Using the PCR conditions of optimization, make observation result more notable, further improve the applicability of the present invention；Amplified production has specificity, it is ensured that the high accuracy and sensitivity of PCR and fluorescence quantitative PCR detection.Implement the primer sets for cancer of pancreas detection in the present invention, by detecting the expression of patient's sample target gene, can simply, conveniently and accurately diagnosis of pancreatic cancer.

Description

A kind of primer sets and detection method for detecting cancer of pancreas

Technical field

The present invention relates to oncogene field, and in particular to a kind of primer sets and detection method for detecting cancer of pancreas.

Background technology

Cancer of pancreas is a kind of digestive system tumor of high malignancy, occupies the 4th of the american cancer cause of death in the world Scope is also one of most fatal malignant tumour.China's cancer of pancreas the death rate at the 7th to the 8th.

In the last thirty years, cancer of pancreas year survival rate only 2% from improving to 6%, and contemporaneity, all sites tumour 5 years survival rates bring up to 68% from 49%, and the survival rate of certain cancers can reach even more than 90%.The pancreas region of anatomy is hidden Hide, cancer of pancreas is difficult to early detection and makes a definite diagnosis, patient own Jing during clinical symptoms occurs and transfer occurs, it is difficult to surgery excision.Cancer of pancreas Due to itself Highly invasive and the drug resistance to chemotherapeutics, traditional operation and chemicotherapy means are difficult to root Control, therefore with compared with high mortality.Additionally, the incidence of cancer of pancreas is in ascendant trend year by year, recent portion address prediction, according to Current trend, to year cancer of pancreas by become american cancer associated death it is second largest common the reason for.Find and participate in cancer of pancreas Generation develops, especially the new biological indicator related to cancer of pancreas early diagnosis and prognosis, for early detection cancer of pancreas And it is significant to improve the prognosis of Pancreas cancer patients.

Recently, detection of the appearance that circulating tumor cell (Circulating Tumor Cells, CTCs) is detected to patient Bring new hope.CTCs is to depart from and be displaced to the tumour cell in blood from tumor focus, is malignant tumor patient art The major reason of recurrence and DISTANT METASTASES IN, and the key factor for causing tumor patient dead afterwards.With other histological specimens such as Marrow etc. is compared, and periphery blood specimen is easily obtained, and little to patient trauma, is that clinically the ideal sample of conventional detection comes Source.CTCs detections contribute to the early diagnosis of tumour, judge patient's prognosis, the curative effect of assessment antineoplastic and formulate individuation Therapeutic scheme.Compared with traditional diagnostic method, CTCs detections can more sensitively find the change of disease, and patient is not had Side effect.

The detection of CTC is generally carried out by extracting the blood of certain volume.Detection is divided into two classes, including not capturing (be enriched with) Direct detection and first capture (enrichment) detect afterwards, latter of which for main flow detection method.The side that (enrichment) is detected afterwards is captured first Method is also classified into two classes, i.e. key player on a team and negative choosing.Key player on a team is mainly (size, close by the physical property of CTC surface markers or cell Degree) captured；The former is that, based on biomolecular technology and microfluidic chip technology, the latter is based on the original for filtering, be centrifuged Reason.Negative choosing is then to capture indirectly CTC by leukocyte surface markers thing.But had based on the method that first capture (enrichment) is detected afterwards Obvious defect.It depends critically upon the expression of tumor cell surface marker thing, therefore cannot capture and do not express surface tumours The CTC cells of label.

It is another mode of CTC cell detections using the specific gene of the method detection CTC cells of RT-PCR.It is first The blood of certain volume is first extracted, CTCs is enriched with by way of density gradient centrifugation, is then detected by way of RT-PCR With this, the mRNA of specific gene, judges that CTCs whether there is, and quantitative to CTCs by detecting the change of CT values.This method inspection Survey CTCs expenses low, susceptibility is high, and easily automates.

The examination criteria of cancer of pancreas CTCs of RT-PCR method detection at present is also not set up.We are suffered from by detecting cancer of pancreas The CTCs characterizing genes of person, determine detection method and the examination criteria of cancer of pancreas CTCs.These detection methods and establishment of standard Contribute to the early diagnosis of tumor patient, judge patient's prognosis, assess antineoplastic (including NK and CAR-T immunization therapies) Curative effect and formulation individualized treatment scheme.

For the problems referred to above, a kind of high-sensitive polygene combined detection method of present invention exploitation, by joint-detection 9 genes of CK18, CK20, CEA, Vimentin, MUC1, Epcam, Birc5, EGFR and C-met realize the early stage inspection of tumour Survey.The present invention designs and uses target specific primer group, increases substantially the sensitivity of detection.The recall rate of the detection method can Reach 95%, be provided simultaneously with that sensitivity is high, specificity is good, quick and precisely the advantages of.

The content of the invention

Present invention aims to the deficiencies in the prior art, there is provided a kind of primer sets and inspection for detecting cancer of pancreas Survey method,

The purpose of the present invention is achieved through the following technical solutions：A kind of primer sets for detecting cancer of pancreas, comprising：

The primer sets of the present invention can realize the detection of cancer of pancreas by following two methods.

Method 1：PCR method.

(1) 9 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extraction Thing, reverse transcriptase, RNase inhibitor, archaeal dna polymerase, dNTP；Wherein, the condition of each circulation of PCR reactions is 94 Celsius Degree, 30s；55 degrees Celsius, 30s；72 degrees Celsius, 10s；

(2) reverse transcription and PCR reactions is carried out, is detected with agarose gel electrophoresis method.

Method 2：Fluorescence quantifying PCR method

(1) 9 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extraction Thing, reverse transcriptase, RNase inhibitor, archaeal dna polymerase, dNTP；2 × ChamQ SYBR qPCR Master Mix are separately added into, Wherein, the condition of each circulation of PCR reactions is 95 degrees Celsius, 10s and 60 degree Celsius, 30s；40 circulations；Often pipe sets up three Individual multiple holes；

(2) reverse transcription and PCR reactions, and real-time detection fluorescence are carried out；

(3) the Ct values calculated according to fluoroscopic examination result, determine whether mark expression of target gene in sample.

The beneficial effects of the present invention is：The present invention is developed for cancer of pancreas early stage by designing Specific PCR primers The polygene combined detection method of detection.The method：(1) PCR system set up can to CK18, CK20, CEA, Vimentin, MUC1, Epcam, Birc5, EGFR and C-met gene carries out joint-detection；(2) by carrying out detection pancreas to multiple genes simultaneously Gland cancer recall rate can reach 98%；(3) sensitivity is high, and the gene expression dose of as little as 1-5 copies can be detected；(4) specificity By force, normal person or non-Patients with Pancreatic Cancer sample will not produce non-specific signals；(5) detection speed is fast, and simple to operate, expense is low It is honest and clean.

Description of the drawings

Fig. 1 is healthy human peripheral blood pattern detection feminine gender PCR figures in embodiment.

Fig. 2 is non-Pancreas cancer patients peripheral blood sample detection feminine gender PCR figures in embodiment.

Fig. 3 is non-Pancreas cancer patients cancerous tissue detection feminine gender PCR figures in embodiment.

Fig. 4 is Pancreas cancer patients peripheral blood detection positive PCR figures in embodiment.

Fig. 5 is Pancreas cancer patients tumor tissues detection positive PCR figures in embodiment.

In figure, M.100bp marker；1.B2M；2.CK18；3.CK20；4.CEA；5.Vimentin；6.MUC1； 7.Epcam；8.Birc5；9.EGFR；10.C-met.

Specific embodiment

The present invention drives gene for the tumour in current cancer of pancreas, by joint-detection CK18, CK20, CEA, 9 genes of Vimentin, MUC1, Epcam, Birc5, EGFR and C-met realize the early detection of cancer of pancreas.For inspection at present Survey method sensitivity is low, and detection process complexity is loaded down with trivial details, long the time required to detection, it is impossible to meet the actual demand of clinical detection.Pin To the problems referred to above, a whole set of specific primer group for detecting above-mentioned 9 genes is designed.

Specificity amplification primer is designed according to the reference sequences of above-mentioned 9 genes, its PCR primer length optimum is in 180- Between 200bp, not higher than 60 degree of annealing temperature, G/C content meets the requirement of general primer-design software between 40-60%. By using real-time fluorescence PCR reaction detection system, realizing the highly sensitive detection of multiple gene associations, the following institute of its detection method State.

The present invention is further described in conjunction with the accompanying drawings and embodiments.As do not specialized part, can be according to this area skill Familiar to art personnel institute《Molecule can grand experiment guide》The third edition (Cold Spring Harbor laboratory Press), 《Cell experiment guide》(Science Press, Beijing, China, calendar year 2001),《RNA experimental technique handbooks》(Science Press, north Capital, China, 2004),《Immunoassay technology》1991) (Science Press, Beijing, China, laboratory manual and this paper such as

In cited bibliography, listed method is implementing.Wherein, (tape label) probe used, primer can be entrusted The synthesis of support Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.

With reference to embodiment, the invention will be further described.

Embodiment 1:Gene selects

Multiple studies have shown that, single-gene examination susceptibility is about 20-60%, is mostly used in the single of tumour early screening Genetic test, its detection sensitivity or specificity it is low, it is impossible to meet clinical needs.Can be effective using polygene combined detection Solve the problems, such as that susceptibility is low, improve the degree of accuracy of tumour early screening and diagnosis.Zhou J et al. (Zhou J, Hu L, Yu Z,et al.Marker expression incirculating cancer cells of pancreatic cancerpatients.J Surg Res 2011；171:631 6.) while detection hTERT, CK20, C-met, CEA gene, knot Fruit shows four genes of joint-detection and detects far above single-gene for the susceptibility that cancer of pancreas is early diagnosed.In order to improve early stage The recall rate of tumour, improves the cure rate of tumor patient, improves patient's prognosis, our difference tables to cancer of pancreas and normal structure Screened up to gene.We by a large amount of control experiments find CK18, CK20, CEA, Vimentin, MUC1, Epcam, The genome of Birc5, EGFR and C-met composition has higher recall rate to cancer of pancreas, reaches 98%, relative to existing inspection Survey technology, generates unexpected technique effect, with significant progressive.

Embodiment 2:Primer screening

(1) design primer a1～a3, b1～b3, c1～c3, d1～d3, e1～e3, f1～f3, g1～g3, h1～h3, i1 ～i3, specially：Target gene A-I sequences are analyzed using bioinformatics software, it is special using sequence analysis software design Specific primer group, using each pairing specificity of the primer in human genome of NCBI primers search software detection, separately designs out 3 To specificity amplification primer a1～a3, b1～b3, c1～c3, d1～d3, e1～e3, f1～f3, g1～g3, h1～h3, i1～ i3；

Table 1：PCR detection primers

(2) process of peripheral blood sample

The Pancreas cancer patients peripheral blood that certain hospital accepts simultaneously Jing proved by pathology for medical treatment is collected, in 7 points of early morning, on an empty stomach, Jing ulnar veins are adopted Collection new blood, deposits in anticoagulant tube, shakes up, preservation≤4hr under normal temperature.

Whole blood sample in anticoagulant tube is added equal-volume PBS (pH7.0) by 2.1,5min is centrifuged in room temperature 3000rpm, goes Except upper plasma；

2.2 add equal-volume ammonium chloride erythrocyte cracked liquid (being purchased from the green skies), mix in room temperature 200rpm centrifugation 8min After even, 5min, supernatant discarded are centrifuged with 3000rpm room temperatures；

2.3 by lower floor's haemocyte and physiological saline according to volume ratio 1:2～2:After 1 mixing, Ficoll separating liquids are added, mixed The volume ratio that liquid is closed with Ficoll separating liquids is 1:2～2:1, centrifugal force is 700g, and 20～40min is centrifuged；

Supernatant is abandoned in 2.4 suctions, takes cell precipitation, is washed, that is, is obtained PBMC；

2.5 take PBMC for nucleic acid extraction, and unnecessary PBMC is resuspended with RNA protective agents, are stored in -20 degree.

(3) extraction of nucleic acid

3.1 take not more than 5 × 10⁵PBMC, add 250 μ LBuffer RLT Plus, piping and druming mix；

Lysate is transferred to gDNA by 3.2 to be removed in centrifugal type post, 8000 × g (10,000rpm) centrifugation 30s.Collect stream Liquid is worn, centrifugal column is abandoned；

To flowing through in liquid, piping and druming is mixed 70% ethanol (350 μ L) of 3.3 1 times of volume of addition；

Sample is transferred to RNeasyMinElute centrifugal columns by 3.4, covers tightly lid, 8000 × g (10,000rpm) centrifugations 15s, abandoned stream wear liquid；

3.5 add 700 μ L Buffer RW1 in RNeasyMinElute centrifugal columns, cover tightly lid, 8000 × g (10, 15s is centrifuged 000rpm), abandoned stream wears liquid；

3.6 add 500 μ L Buffer RPE in RNeasyMinElute centrifugal columns, cover tightly lid, 8000 × g (10, 15s is centrifuged 000rpm), abandoned stream wears liquid；

3.7 are placed in RNeasyMinElute centrifugal columns in new 2mL collecting pipes, open lid, and centrifugation 5min, makes at full speed Ethanol volatilizees；

3.8 are placed in RNeasyMinElute centrifugal columns in new 1.5mL collecting pipes, add 20 μ LRNase-free H₂O, covers tightly lid, at full speed centrifugation 1min eluted rnas.

(4) acquisition of template cDNA

4.1 accurately measure sample RNA concentration；

4.2 prepare reverse transcription system in strict accordance with cDNA reverse transcription reagent box specifications on ice；

Composition	Volume
		5×Mix	8μL
RNA	500ng
		RNase-free H2O	To 40 μ L

4.3 soft mixing above reaction systems, and the of short duration centrifugation of centrifuge is utilized, 55 degree of 20min, 85 degree of 2min are obtained Template cDNA；

(5) regular-PCR amplification

Reaction system is configured with Taq archaeal dna polymerases, with primer be a-i and people's reference gene (B2M) enters performing PCR amplification respectively Sample, 1% gel detection of product；

Amplification system

Composition	Volume
		2×Mix	10μL
cDNA	1μL
		Primer-F	0.8μL
Primer-R	0.8μL
		RNase-free H2O	7.4μL

PCR reaction conditions are 95 DEG C of denaturations 3 minutes, 1 circulation；95 DEG C of denaturation 20 seconds, 55 DEG C are annealed 20 seconds, and 72 DEG C are prolonged Stretch 10 seconds, 35 circulations；72 DEG C extend 7 minutes.

(6) fluorescence real-time quantitative PCR amplification

Specifically draw a group a-i according to what is designed, expanded by quantitative fluorescent PCR, system is as follows：

Composition	Volume
		2×ChamQ SYBR qPCRMaster Mix	10μL
cDNA	2μL
		Primer-F	0.4μL
Primer-R	0.4μL
		RNase-free H2O	7.2μL
Total	20μL

95 DEG C of denaturations 20s, 1 circulation；95 DEG C of 10s, 60 DEG C of 30s, 40 circulations；Often pipe sets up three multiple holes；

According to step 5 and 6 pcr results, following primer sets are filtered out, be used for detecting the primer of cancer of pancreas as the present invention Group.

Embodiment 3：Compliance test result

According to the selection result of embodiment 2,200 tumor samples are detected using the primer sets described in following table.

Wherein, the forward primer of CK8 is CGCCTGGAAGGGCTGACCGA, and reverse primer is GTTGGCAATATCCTCGTACT；The forward primer of N-cadherin is CCTTAACTGAGGAGTCAGTG, and reverse primer is CAGACCTGATCCTGACAAGC；The forward primer of VEGF is GTGCCCGCTGCTGTCTAATG, and reverse primer is CACATCTGCAAGTACGTTCG；The forward primer of VEGFR2 is GAGAAGCAGAGCCATGTGGT, and reverse primer is GCACTCTTCCTCCAACTGCC。

The recall rate of 1～No. 9 primer sets as shown above, as can be seen from the table, in primer sets, with primer quantity Increase, its recall rate can be improved to a certain extent.Further, by comparing 5～No. 9 primer sets it is found that primer Combination in group is had a major impact for the height of recall rate.Simultaneously in the case of identical detection gene dosage, No. 5 primer sets Recall rate be higher than 6～No. 9 primer sets.Therefore, the assortment of genes of our preferably No. 5 primer sets is used for the detection of cancer of pancreas.Enter One step finds that by studying, in No. 5 primer sets, the expression of CK18, CK20 can point out the tumour of epithelial cell origin；Epidermal growth Factor acceptor (EGFR) is played an important role in the generation evolution of numerous malignant tumours, becomes current tumor research new One of focus；C-met is related to the growth of tumour cell, invasion and attack, transfer and apoptosis as receptor tyrosine kinase；Vimentin It is the tumor marker in normal mesenchymal cell and its source, during EMT is participated in, and plays critical effect； EPCAM belongs to epithelial cell adhesion molecule, plays and act on during carcinogenesis；Birc5 is IAP, swollen Unconventionality expression in knurl；MUC 1 plays an important role in the progress of inflammation and tumour；CEA is a kind of broad-spectrum tumor mark. From the foregoing, it will be observed that the present invention is not that 9 pairs of primers are carried out simple superposition combination, 9 pairs of primers complement each other, functionally prop up each other Hold so that recall rate is improved significantly, achieve unexpected technique effect.In sum, select in the present invention Gene is related to the aspects such as the metabolism of tumour, propagation, invasion and attack, more can comprehensively detect the cell biological characteristics of cancer of pancreas.

Embodiment 4：Specificity analysis

According to the selection result of embodiment 2, using the primer sets described in upper table to normal person's peripheral blood sample (Fig. 1), non- The peripheral blood (Fig. 2) and tumor tissues sample (Fig. 3) of Patients with Pancreatic Cancer, the peripheral blood (Fig. 4) of Patients with Pancreatic Cancer and tumor sample (Fig. 5) detected.As a result as Figure 1-5, primer sets described as seen from the figure are in normal human peripheral blood (Fig. 1), non-pancreas The low expression of gene is detected in the peripheral blood (Fig. 2) and tumor tissues sample (Fig. 3) of gland cancer patient or is not expressed.In cancer of pancreas In the peripheral blood (Fig. 4) of patient and tumor tissues, (Fig. 5) can detect that the expression of multiple genes, respectively 5/9 and 6/9, explanation Heretofore described primer sets have the specificity of height.

Claims (3)

1. a kind of primer sets for detecting cancer of pancreas, it is characterised in that the primer sets can be comprising a～i9 to primer, institute The forward primer of primer a is stated as shown in SEQ ID No.1, as shown in SEQ ID No.2, primer b is just for the reverse primer of primer a To primer as shown in SEQ ID No.3, the reverse primer of primer b as shown in SEQ ID No.4, the forward primer such as SEQ of primer c Shown in ID No.5, the reverse primer of primer c as shown in SEQ ID No.6, the forward primer such as SEQ ID No.7 institutes of primer d Show, the reverse primer of primer d as shown in SEQ ID No.8, the forward primer of primer e as shown in SEQ ID No.9, primer e's Reverse primer as shown in SEQ ID No.10, the forward primer of primer f as shown in SEQ ID No.11, the reverse primer of primer f As shown in SEQ ID No.12, the forward primer of primer g as shown in SEQ ID No.13, the reverse primer such as SEQ ID of primer g Shown in No.14, the forward primer of primer h as shown in SEQ ID No.15, the reverse primer such as SEQ ID No.16 institutes of primer h Show, as shown in SEQ ID No.17, the reverse primer of primer i is as shown in SEQ ID No.18 for the forward primer of primer i.

2. primer sets described in a kind of claim 1 detect the PCR method of cancer of pancreas, it is characterised in that comprise the steps：

(1) 9 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extractive, Reverse transcriptase, RNase inhibitor, archaeal dna polymerase, dNTP；Wherein, PCR reaction each circulation condition be 94 degrees Celsius, 30s；55 degrees Celsius, 30s；72 degrees Celsius, 10s；

(2) reverse transcription and PCR reactions is carried out, is detected with agarose gel electrophoresis method.

3. primer sets described in a kind of claim 1 detect the fluorescence quantifying PCR method of cancer of pancreas, it is characterised in that including as follows Step：

(1) 9 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extractive, Reverse transcriptase, RNase inhibitor, archaeal dna polymerase, dNTP；2 × ChamQ SYBR qPCR Master Mix are separately added into, its In, the condition of each circulation of PCR reactions is 95 degrees Celsius, 10s and 60 degree Celsius, 30s；40 circulations；Often pipe sets up three Multiple holes；

(2) reverse transcription and PCR reactions, and real-time detection fluorescence are carried out；

(3) the Ct values calculated according to fluoroscopic examination result, determine whether mark expression of target gene in sample.