CN106520700A

CN106520700A - MDCK cell line for stably expressing trypsinogen and application thereof

Info

Publication number: CN106520700A
Application number: CN201610990887.2A
Authority: CN
Inventors: 江征; 朱秀娟; 李长贵
Original assignee: National Institutes for Food and Drug Control
Current assignee: National Institutes for Food and Drug Control
Priority date: 2016-11-10
Filing date: 2016-11-10
Publication date: 2017-03-22
Anticipated expiration: 2036-11-10
Also published as: CN106520700B

Abstract

The invention provides an MDCK engineering cell line for stably secreting and expressing trypsinogen (S.pro-try) and an application thereof in culturing influenza viruses and producing influenza virus vaccines, belonging to the field of biotechnology. The invention also provides a method for establishing the cell line, wherein by establishing bovine pancreatin source and bovine pancreatin expression gene sequences in three kinds of subcellular distribution of secreting type, intracellular type and transmembrane type and transiently transfecting MDCK, the best expression mode increasing the human influenza virus titer is screened. Through the cell line provided by the invention, a cell foundation is laid for further large-scale production of influenza vaccines, and the key problems in increasing the vaccine capacity and improving the quality are solved; and moreover, the cell line also can serve as a research tool for effectively separating and culturing and monitoring the influenza viruses in a laboratory, screening the influenza virus resistant drugs, measuring a neutralizing antibody and the like, and has broad application prospects.

Description

Mdck cell system of bovine trypsinogen and application thereof is expressed stably

Technical field

The present invention relates to biological technical field, in particular it relates to engineering cell system clone MDCK-S.pro-try And its construction method, and the clone culture influenza virus, prepare influenza vaccines, anti-influenza virus medicament screening, in With the application of the aspect such as TPPA or influenza other correlative studys.

Background technology

Influenza vaccines are that current flu-prevention occurs and propagates maximally efficient means.On current market, stream of people's influenza vaccine is more Number is produced by matrix of chicken embryo, comprising H1N1, H3N2 and influenza B virus strain.Traditional chicken embryo production system is The immune effect for having the history of nearly 70 years, vaccine is fully confirmed, but in place of its own still suffers from some shortcomings, is such as trained Easily there is antigenic variation in foster influenza virus, can not match completely with crowd's epidemic strain；Residual ovalbumin easily causes allergy anti- Should；Especially when occurring being very popular, healthy chicken embryo supplies limited wilderness demand that can not be met in the short time to vaccine etc..And feed Newborn animal cell culture systems are compared chicken embryo and have obvious advantage, can avoid these problems, become future vaccines production Development trend, nineteen ninety-five WHO suggestions carry out the research with mammalian cell as production matrix.

Having explored applicable mammalian cell includes African green monkey kidney cell (African green monkey at present Kidney cell, Vero), dog renal epithelial cell (Madin-Darby canine kidney cells or Madin-Daby Canine kidney cell, MDCK) and Human embryo retinoblast PER.C6.Wherein mdck cell is easily cultivated, pancreas Enzyme tolerance is strong, susceptible to various different strains of influenza viruses, can produce higher virus titer, is the ideal of influenza vaccines production Clone.The influenza vaccines in mdck cell source have obtained European drug administration (European Medicines Agency, EMA) approval.Clinical testing shows that the influenza vaccines produced using cells such as MDCK are safe and have high immunity Originality, but relatively low virus titer is one of bottleneck of its large-scale production.Cause low in the complex environment of production system Titre reason is many, and single from for cytostromatic angle, this cell itself does not express the protease of cracking HA Class, becomes a kind of low limiting factor of viral yield.

Influenza virus hemagglutinin HA is one of viral major surface antigen, is recognizing and combining receptor in target cell, mediation film Play a significant role in terms of fusion, eliciting protective neutralizing antibody.In virus replication, HA albumen is first with precursor HA0 Form synthesizes, Jing after host protein enzymatic lysis is ripe HA1 and HA2, can mediate retroviral cyst membrane and target cell membrane fusion, Initial viral life cycle, therefore the cracking of HA is the primary premise of virus infected cell, and mdck cell is not had in itself The protease of cracking HA, research have shown that additional a certain amount of trypsase can speed up viral intercellular spread, improve virus drop Degree, accelerates viral multicycle growth, has become the routine operation of influenza virus cell culture.

Trypsase belongs to serine stretch protein enzyme family, and the serine peptidases functional domain of the long 220aa of its C-terminal being capable of specifically water Solution human influenza virus or LPAIV HA0, discharge viral genome so as to ripe HA1, HA2 play a role Enter intracellular, accelerate viral multicycle growth, but while additional pancreatin also increases the difficulty of cell culture, improve vaccine life Produce cost.

It is in its natural state in human respiratory epithelial cell, real to play protease species and the effect that viral activation is acted on Sub-cellular location is always study hotspot, not yet comes to a conclusion.The various serine protease tools with family with trypsase are known Have a function of cracking HA, and site of action be likely located on cell membrane, extracellular and intracellular transport process, it is but more further Further investigation but lack.

The content of the invention

A kind of first aspect present invention, there is provided mdck cell system of the modification of stably excreting expression bovine trypsinogen, should Clone contains the encoding gene of the complete secreting type bovine trypsinogen S.pro-try for being integrated into its cellular genome.

In a detailed embodiment, the cellular genome contains secreting type bovine trypsinogen encoding gene, core Nucleotide sequence is as shown in Genbank LOC780933.

In a detailed embodiment, the nucleic acid coding sequence of the secreting type bovine trypsinogen is carried out suitable for dog The optimization that class codon is used.

Preferably, the nucleic acid coding sequence of the secreting type bovine trypsinogen is as shown in SEQ ID No.1：

ATGAAGACCTTCATCTTCCTGGCCCTGCTGGGCGCCGCCGTGGCCTTCCCCGTGGACGACGACGACAAGATCGTGGG CGGCTACACCTGCGGCGCCAACACCGTGCCCTACCAGGTGAGCCTGAACAGCGGCTACCACTTCTGCGGCGGCAGCC TGATCAACAGCCAGTGGGTGGTGAGCGCCGCCCACTGCTACAAGAGCGGCATCCAGGTGAGGCTGGGCGAGGACAAC ATCAACGTGGTGGAGGGCAACGAGCAGTTCATCAGCGCCAGCAAGAGCATCGTGCACCCCAGCTACAACAGCAACAC CCTGAACAACGACATCATGCTGATCAAGCTGAAGAGCGCCGCCAGCCTGAACAGCAGGGTGGCCAGCATCAGCCTGC CCACCAGCTGCGCCAGCGCCGGCACCCAGTGCCTGATCAGCGGCTGGGGCAACACCAAGAGCAGCGGCACCAGCTAC CCCGACGTGCTGAAGTGCCTGAAGGCCCCCATCCTGAGCGACAGCAGCTGCAAGAGCGCCTACCCCGGCCAGATCAC CAGCAACATGTTCTGCGCCGGCTACCTGGAGGGCGGCAAGGACAGCTGCCAGGGCGACAGCGGCGGCCCCGTGGTGT GCAGCGGCAAGCTGCAGGGCATCGTGAGCTGGGGCAGCGGCTGCGCCCAGAAGAACAAGCCCGGCGTGTACACCAAG GTGTGCAACTACGTGAGCTGGATCAAGCAGACCATCGCCAGCAACTAA(SEQ ID No.1)。

In a detailed embodiment, the clone is named as MTY6, is deposited in Chinese microorganism strain preservation pipe Reason committee common micro-organisms center, address is in Yard 1, BeiChen xi Road, Chaoyang District, Beijing City institute of microbiology of the Chinese Academy of Sciences, its bacterium Planting deposit number is：CGMCC No.12681, preservation date are on July 6th, 2016.

A kind of second aspect present invention, there is provided the method for the mdck cell system of the above-mentioned modification of structure, methods described include by The ORFs cDNA sequence of coding S.pro-try is connected with carrier for expression of eukaryon, then by the eukaryotic expression vector transfection To in mdck cell system, the pressurization screening of Jing antibiotic obtains the clone of stable expression.

In a detailed embodiment, the carrier for expression of eukaryon is pcDNA3.1.

In a detailed embodiment, by totally 6 kinds of expression ways of secreting type, intracellular type and transmembrane proenzyme or enzyme Aim sequence is connected with carrier for expression of eukaryon respectively, and is transiently transfected in mdck cell system, and inoculation human influenza virus compares product Amount difference, screening improve the optimum expression pattern of virus titer.

In one preferred embodiment, the carrier for expression of eukaryon continuous pressure of secreting type bovine trypsinogen is sieved Choosing, is stably expressed monoclonal cell with reference to limiting dilution assay.

It is furthermore preferred that the continuous pressure screening is screened under the conditions of the G418 of high concentration.

Further, the concentration of the G418 is 1000 μ g/ml.

In one preferred embodiment, the nucleic acid coding sequence of secreting type bovine trypsinogen is carried out suitable for dog The optimization that class codon is used.

Preferably, the nucleic acid coding sequence of the secreting type bovine trypsinogen is as shown in SEQ ID No.1.

It is furthermore preferred that the mdck cell system of the modification is MTY6, Chinese microorganism strain preservation conservator is deposited in Meeting common micro-organisms center, address is in Yard 1, BeiChen xi Road, Chaoyang District, Beijing City institute of microbiology of the Chinese Academy of Sciences, its culture presevation Numbering is：CGMCC No.12681, preservation date are on July 6th, 2016.

A kind of third aspect present invention, there is provided application of the mdck cell system of above-mentioned modification, wherein, the application include by The mdck cell system of above-mentioned modification is used to cultivate influenza virus, prepares influenza vaccines, and Tamiflu screening, neutralizing antibody are determined Or the application in the field such as influenza other correlative studys.

Preferably, the influenza is human influenza.

A kind of a fourth aspect of the present invention, there is provided method of culture influenza virus, wherein, methods described is included using above-mentioned The mdck cell system infected by influenza of modification is cultivated.

In a detailed embodiment, the influenza in said method is human influenza.

In a detailed embodiment, said method includes, human influenza virus H1, H3 hypotype and Type B strain are inoculated with In the mdck cell system of the above-mentioned modification that the present invention builds.

In a detailed embodiment, said method includes, condition of culture of the virus on the cell be 37 DEG C, 4%CO₂, free serum culture 48-72h, harvest vial supernatant obtain final product influenza virus liquid.

Preferably, the step of propagation human influenza virus in methods described in need not add TPCK- pancreatin.

Preferably, the step of propagation human influenza virus in methods described in can also further add TPCK- pancreatin.

A kind of a fifth aspect of the present invention, there is provided method for preparing influenza vaccines, wherein, methods described is included using above-mentioned The mdck cell system infected by influenza of modification is cultivated.

In a detailed embodiment, the influenza in said method is human influenza.

The present invention takes genetic engineering means, albumen enzyme secretion, three kinds of subcellular fractions of intracellular and cross-film under simulation nature Trypsase gene is imported mdck cell, inoculation different shaped or hypotype human influenza virus, compares viral yield and filter out by distribution Secreting type proenzyme is the best use of pattern for lifting viral yield, and continuous pressure filters out the cell that stably independently can be expressed System, on the one hand for vaccine large-scale production, simplifies production technology, more efficiently lifts viral yield, is extensive in the future Cell base is established in influenza vaccines production, solves the key issue that vaccine production capacity expands and quality is improved；On the other hand can also Culture is efficiently separated as laboratory and monitor influenza virus, the screening of anti-influenza virus medicament, measure of neutralizing antibody etc. its Research tool in terms of him, is with a wide range of applications.Wherein screen the stably excreting for obtaining and express bovine trypsinogen Mdck cell system culture production of Influenza virus titre is high, particularly with the culture of B/ Heilungkiang Hulan/116/2010 influenza virus Titre, can reach the virus titer of the additional TPCK- pancreatin culture of common mdck cell, thin hence with the MDCK of present invention modification Born of the same parents system can simplify virus culture process.

Description of the drawings

Fig. 1 is the expression identification of secretion, intracellular and transmembrane proenzyme and enzyme recombinant plasmid transient transfection MDCK.

+：The bovine trypsin of TPCK process；-：The cell sample of transfection empty plasmid；S.pro-try：Secreting type proenzyme； S.try：Secreting type enzyme；T.pro-try：Transmembrane proenzyme；T.try：Transmembrane enzyme；C.pro-try：Intracellular type proenzyme； C.try：Intracellular type enzyme.

Fig. 2 is the expression that indirect immunofluorescence identifies recombinant plasmid transient transfection MDCK.

Fig. 3 is transient transfection expression enzymatic activity detection.

A：Enzymatic activity calibration curve；B：6 kinds of plasmid transient transfection MDCK express enzymatic activity.

Fig. 4 is the impact of each protease infected by influenza propagation of transient expression.

Fig. 5 is identified for the PCR and RT-PCR of monoclonal cell genes of interest.

A：Extract the PCR identifications of genomic DNA；B：Extract the RT-PCR identifications of cell RNA.

Identifications of the Fig. 6 for monoclonal cell strain MT21.

A：Indirect immunofluorescence is identified；B：Western blotting qualification；C：Enzymatic activity is determined；

D：The PCR and RT-PCR identification of the genes of interest of different generation monoclonal cells；

E：The enzymatic activity of different generation monoclonal cells is determined.

Fig. 7 is growing state of the different strains of influenza viruses in monoclonal cell.

A：The NA activity of detection A/ Tianjin Jin Nan/15/2009 (H1N1) and CCID₅₀Titre；

B：The NA activity of detection A/ Fujian Tongan City/196/2009 (H3N2) and CCID₅₀Titre；

C：The NA activity of detection B/ Heilungkiang Hulan/116/2010 and CCID₅₀Titre；

D：The NA activity of detection A/California/7/2009 (H1N1) and CCID₅₀Titre；

Fig. 8 for monoclonal cell MTY6 and MT21 expression activity ratio after optimization compared with.

Fig. 9 is compared with the growing state of MT21 in MTY6 for different virus.

A：The NA Activity determinations of attenuated live vaccine A1/17/California/2009/38；

B：The NA Activity determinations of attenuated live vaccine A3/Switzerland/9715293/2013-CDC-LA10A.

Specific embodiment

Further describe the present invention with reference to specific embodiment, advantages of the present invention and feature will be with description and It is apparent.But these embodiments are only exemplary, do not constitute any restriction to the scope of the present invention.People in the art Member is it should be understood that can enter to the details of technical solution of the present invention and form without departing from the spirit and scope of the invention Row modification is replaced, but these modifications and replacement are each fallen within protection scope of the present invention.The reagent arrived used in embodiment, Except non-used is illustrated, it is otherwise commercially available conventional reagent on market.

The material source of the present embodiment：

1st, cell：MDCK is purchased from ATCC, is preserved by National Institute for Food and Drugs Control's Respirovirus Vaccination Room.

2nd, virus：A/ Tianjin Jin Nan/15/2009 (H1N1), A/ Fujian Tongan City/196/2009 (H3N2), B/ Heilungkiang are exhaled Blue/116/2010, given by China Medical Sciences Academy Medical Biology Institute professor Liao Guoyang.Flu-A vaccine virus strain A/California/7/2009 (H1N1) is preserved by National Institute for Food and Drugs Control's Respirovirus Vaccination Room.

The structure and transient transfection function point of the recombined bovine pancreas enzyme gene carrier for expression of eukaryon of 1 different expression-forms of embodiment Analysis

(1) vector construction：, as template, design is or not bovine trypsin cDNA sequence (LOC780933) with GenBank offers Same special primer (table 1 and 2), amplification obtain secreting type zymogen expression sequence, on this basis, remove N-terminal secretion letter respectively The amplification of number peptide obtains intracellular proenzyme expressed sequence, and addition HAT transmembrane domain amplifications obtain cross-film proenzyme sequence；And respectively in enzyme In former sequence basis, remove the correspondence base sequence amplification of N-terminal APFDDDDK activated peptides and obtain respective expression of enzymes sequence.Upstream primer Introduce Nhe I (shown in italic glissade), downstream primer and introduce EcoR I (shown in italic glissade) single restriction enzyme site, while Expression efficiency is improved in N-terminal addition Kozak sequences (square frame sign) of upstream primer initiation codon ATG.50 μ l PCR react 5 μ l of template, sterilizing 32.8 μ l of distilled water, 10 × PCR buffer solutions, 5 μ l, 1 μ l of dNTP Mix (10mmol/L), 10 μm of ol/ in system 2 μ l of L upstream primers, 10 μm of 2 μ l of ol/L downstream primers, 0.2 μ l of Taq archaeal dna polymerases (Invitrogen).PCR amplification conditions： 94 DEG C of denaturations 1min, 94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 1min, totally 30 circulations, last 72 DEG C of insulations 10min.6 kinds of amplified fragments double digestion modes are connected in pcDNA3.1 carriers, it is inverted select monoclonal bacterium colony carry out it is double Digestion and sequencing identification, as a result sequence size meet expection, each gene reading frame is correct.

The amplimer of 1. secreting type of table, intracellular type trypsinogen and enzyme

The amplimer of 2. transmembrane trypsinogen of table and enzyme

(2) transient transfection：The mdck cell of exponential phase, digestion after-blow break into single cell suspension, and adjustment concentration is 1 × 10⁵Cell/ml, is inoculated with 6 well culture plates, per hole 2ml, places 37 DEG C, 4%CO₂Incubator 24h.Grasp according to LP2000 transfection reagents Explain, with 1:2.5 best proportion prepares liposome-DNA complex；It is added dropwise over when cell is up to 90% degree of converging, 37 DEG C, 4%CO₂Serum-free SFM nutrient solutions are changed after culture 6h, is continued culture 48h, is collected the cell of secreting, expressing proenzyme and enzyme respectively Supernatant, the cell and intracellular of secreting, expressing type, cross-film expression cell be separately added into 2ml precoolings containing 0.5%TritonX- 100 PBS lysates, ice bath or 4 DEG C of effect 30min, are blown and beaten 2-3 time repeatedly, and 4 DEG C of low-speed centrifugal 5min of 5000rpm remove thin Born of the same parents' fragment, draws supernatant and is placed on ice.All collection samples are concentrated by ultrafiltration using 4 DEG C of 5000 × g of Millipore 3K super filter tubes 20min, -70 DEG C of preservations.

(3) western blotting qualification expression：Each sample is collected per 20 μ l of hole loading, voltage stabilizing 120V carries out SDS-PAGE electrophoresis, PBS (pH7.4) is used to dissolve 5% defatted milk, 37 DEG C of low speed shaking table close membranes 1h after turning pvdf membrane, it is many with rabbit-anti bovine trypsin Clonal antibody be one anti-, goat anti-rabbit igg antibody be two it is anti-carry out western blotting qualification, the as a result egg of (Fig. 1) three kinds of cell distributions Bai Jun has specific bright band.The band of secreting type proenzyme supernatant cell sample is brighter, about 24-25kD；Secreting type enzyme supernatant Band is than in cell, substantially, molecular size is suitable with control；Cross-film expressing protein size is close to 30kD, and proenzyme is more slightly larger than enzyme；Born of the same parents The proenzyme and enzyme of interior distribution is suitable with secretion type expression, about 24-25kD.

(4) indirect immunofluorescence expression and localization identification：Clean glass slide, inoculation are placed in each hole central authorities of 12 porocyte plates Mdck cell 1 × 10⁵/ hole, prepares cell climbing sheet；Put 37 DEG C, 4%CO₂Culture up to 80% converge when, respectively 6 germplasm of transient transfection Grain；DMEM containing 2.5%FBS continues culture 48h, and the 1 × PBS (pH7.4) of 37 DEG C of preheatings is cleaned 3 times；Add 2ml more than 4% per hole Polyformaldehyde room temperature fixes 30min；The cell per well addition 2ml 0.1%TritonX-100 of secreting type and intracellular type, room temperature are penetrating 20min；The 2%BSA that 1ml PBS are prepared, 37 DEG C of closing 1h；Rabbit-anti bovine trypsin polyclonal antibody is anti-for one, per hole 1ml, 37 DEG C of incubation 1h；The mouse anti-rabbit IgG monoclonal antibody of FITC marks, 37 DEG C of lucifuges are incubated 1h；The DAPI room temperatures of 0.5 μ g/ml are kept away Light contaminates core 5min；Under the conditions of lucifuge, inverted fluorescence microscope is observed and is taken pictures.As a result the proenzyme and enzyme of (Fig. 2) secretion type expression are green Color fluorescence signal substantially, is focused primarily upon around the nucleus of blue-fluorescence mark；The cell green fluorescence of intracellular expression spreads In karyon periphery, it is intended to homogeneous, proenzyme is suitable with enzyme fluorescent brightness；Transmembrane cellulosa edge brightness is assembled, with reference to certainly So the same visual field cellular morphology under light microscopic, can be determined that green fluorescence is gathered on cell membrane, various express express target protein substantially Subcellular proteomics meet expection.

(5) enzymatic activity detection：TPCK-trypsin with enzymatic activity known to commercialization selects spirit as positive criteria product The high pancreatin specific fluorescence peptide substrate Boc-Leu-Gly-Arg-AMC of sensitivity, with reference to EvaAssay method, often The Tris-HCl buffer solutions of hole addition 50mmol/L pH=7.9 carry out 2 times of TPCK-trypsin being serially diluted and final concentration For each 50 μ l of fluorescence reaction substrate of 25 μm of ol/L, 35 DEG C of lucifuge reaction 30min after mixing, are placed in, fluorescence microplate reader reads each hole Value, excitation wavelength 355nm, launch wavelength 440nm.With the corresponding enzyme activity of each dilution factor of positive criteria product as abscissa, with phase The Mean Fluorescence answered is ordinate, draws enzymatic activity calibration curve, and same method detects 6 kinds of expressing protein samples and control, Substitute into calibration curve and try to achieve expression enzymatic activity.As a result (Fig. 3) secreting type pancreas zymogen activity highest, up to 10.72 × 10^-2U/ml, The 1/60 of additional 0.5 μ g/ml TPCK-trypsin activity when cultivating influenza virus using MDCK equivalent to laboratory, and secrete Type supernatant tryptic activity is suitable with the proenzyme of intracellular expression and enzymatic activity, and about 6 × 10^-2U/ml, the proenzyme of cross-film expression Minimum with enzymatic activity about 3 × 10^-2U/ml。

(6) impact to viral growth：Take the logarithm growth period mdck cell with reference to the 6 kinds of expression of said method transient transfection Plasmid, changes the DMEM culture mediums of serum-free, according to moi equal to 0.001 inoculation A/ after 37 DEG C of culture 12h after transfecting 6h California/7/2009 (H1N1) influenza virus vaccine strain, mixes rearmounted 37 DEG C of 4%CO2 incubators and treats viral growth.Per clear water surface Lower observation viral growth situation, makes for 2 times viral release, 4 DEG C of 5000rpm centrifugation 10min remove carefully to multigelation cell during 72h Born of the same parents' fragment, carries out virus N A determinations of activity, and in 96 hole fluorescence ELISA Plates, every hole MES buffer solutions series of diluted samples and NA substrates are each 50 μ l, mix room temperature reaction 30min, and 150 μ l terminate liquid terminating reactions, fluorescence microplate reader read each hole fluorescent value, excitation wavelength 355nm, launch wavelength 460nm are repeated 3 times per sample, data statistic analysis.As a result (Fig. 4) shows that secretion type expression pancreatin is former The virus N A activity of experimental group has statistical discrepancy (P with idle running control group<0.05), wherein, secreting, expressing pancreatin original experimental group Virus N A activity is 1340, and the control group that dallies is only 924, and experimental group is approximately 1.5 times of control group；Remaining 5 kinds of expression plasmid Turn MDCK culture first stream virus quantities suitable with idle running control group about 949～1000 wink.Therefore we select expression activity highest Secreting type proenzyme plasmid carry out the cell screening of follow-up stable transfection.

Embodiment 2 stably expresses the screening and identification of secreting type pancreatin original MDCK monoclonal cells

(1) in screening and culturing medium suitable G418 concentration selection：Mdck cell is seeded to degree to be converged in 24 orifice plates G418 is added when 70%, makes concentration be followed successively by 0 μ g/ml, 200 μ g/ml, 400 μ g/ml, 600 μ g/ml, 800 μ g/ml, 900 μ g/ Ml, 1000 μ g/ml, 1100 μ g/ml, per concentration multiple holes, are placed in 37 DEG C, cultivate in 5%CO2 incubators, and daily observed and recorded is thin Born of the same parents' death condition, changed liquid every 3-4 days, and culture is drawn cells survival curve after two weeks and determines G418 minimum lethal concentration (MLC)s, as a result When G418 concentration is between 800-900 μ g/ml, cell is all dead in 14 days, therefore selects 1000 μ g/ml in experiment The concentration of G418 in mdck cell pressure screening and culturing medium, maintaining liquid concentration are 500 μ g/ml.

(2) G418 pressurizations screening and limiting dilution assay screening monoclonal cell：Inoculation about 2x10⁵Individual mdck cell is to 6 holes Plate, is used to transfect when cultivating to cell density about 90%.Vitellophag after 24 hours, 1:10 ratio is passaged to 96 orifice plates In, add per hole the 5% hyclone DMEM nutrient solutions of 200 μ, 1 1000 μ g/ml G418 to continue culture, per liquid is changed within 3-5 days, continue After screening 2 weeks, it is seen that resistant cell growth.Control mdck cell does not carry out empty plasmid transfection, only makes cell contain G418 Nutrient solution in cultivate to it is all dead when, choice experiment group growth conditions good drug-resistant colonies continue to use after digestion Pressure containing 1000 μ g/ml G418 screening nutrient solution is diluted to 0.5 cell/100 μ l, is inoculated in 96 orifice plates, per 200 μ of hole l.After continuing G418 screenings 2 weeks, (extract genomic DNA, cell RNA and RT-PCR method to respectively refer to select using RT-PCR Kit) and enzymatic activity detection method is (above already described) selects expression highest, cell state preferably clone to press again Limiting dilution assay carries out single cell clone screening.Successively in 96 holes, 24 holes and 6 hole cell trainings after the cell tryptase enzymic digestion for filtering out Foster plate Amplification Culture is simultaneously frozen according to a conventional method.As a result 5 plants of positive monoclonal resisting cell strains, RT-PCR qualification results is obtained The specific band of the 750bp that meets expected size or so can be amplified, determine sequence compare with genes of interest it is consistent.With reference to pancreas Enzyme assay, therefrom have selected expression enzymatic activity highest, the preferable 21# cell lines of cell state carries out subsequent experimental, names For MDCK-S.pro-try (21), abbreviation MT21.

(3) identification of MT21 cell lines：By monoclonal cell continuous passage, extract different generation cell genomic dnas and enter The original genes of interest PCR identifications of row secreting type bovine trypsin, upstream primer is Fs：5'-TCCGGCTAGCGCCACCATGAAGACCTTC- 3'(SEQ ID No.13), downstream primer be R：5'-GCCGGAATTCTTAGTTGGAGGCGATGG-3'(SEQ ID No.14), Using GAPDH genes as internal reference, special upstream primer F is designed：5'-GTGATGCTGGTGCTGAGTATGTT-3'(SEQ ID No.15), downstream primer R：5'-GGTCTTCTGGGTGGCAGTGAT-3'(SEQ ID No.16), 50 μ l of reaction system： Premix Ex Taq^TM2 × PCR Solution25 μ l, 5 μ l of template, each 2 μ l of primer, 15 μ l of deionized water.Amplification condition：94 DEG C denaturation 1min, 94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 1min, totally 20 circulations, last 72 DEG C of insulations 10min.Extracting cell RNA carries out RT-PCR identifications, primer ibid, 10 μ l reaction systems：RT Master Mix2 μ l, the 6 μ l of water of template 2 μ l, DEPC process.RT reaction conditions：37℃15min；85℃5s；With reverse transcription CDNA enters performing PCR reaction system and condition ibid for template.Each generation cell expression supernatant and cell pyrolysis liquid are collected, is carried out respectively Western blotting, indirect immunofluorescence identification, and detect expression supernatant enzymatic activity (method is with example 1).As a result (Fig. 5,6)： MT21 is identified to prove that secreting type pancreatin protogene is successfully integrated in MDCK genomes, and can correctly transcribe (referring to Fig. 5)； MT21 being observed under simple microscope and obvious morphological differences being had no with normal mdck cell, indirect immunofluorescence shows that MT21 can See obvious green fluorescence, and cellular control unit is negative (referring to Fig. 6 A)；Western Blot identification of M T21 have it is single clearly Specific band, size is about band brightness in 24kD, and supernatant, and apparently higher than cell pyrolysis liquid, normal MDCK controls do not have Any band (referring to Fig. 6 B)；In enzymatic activity measurement result supernatant, enzymatic activity is higher, and about 20 × 10^-2U/ml, in cell Enzymatic activity about 17 × 10^-2U/ml, equivalent to 1/30 (referring to Fig. 6 C) of additional 0.5 μ g/ml TPCK-trypsin activity； Monoclonal cell strain continuous passage confirms each generation iuntercellular genes of interest inheritance stability to the 15th generation, Jing PCR and RT-PCR identification, Detection expression supernatant enzymatic activity does not have statistical discrepancy, and about 20 × 10^-2U/ml, destination protein expression it is stable (referring to Fig. 6 D and 6E).

Propagation of 3 influenza virus of embodiment on the former mdck cell of stable expression bovine trypsin

By 3 plants of wild influenza virus As/Tianjin Jin Nan/15/2009 (H1N1), A/ Fujian Tongan City/196/2009 (H3N2), B/ Heilungkiang Hulan/116/2010 and 1 plant of influenza A strain are respectively adopted chick embryo allantoic cavity and virus are expanded in a large number, receive Dispense after obtaining viral allantoic fluid centrifugation, -70 DEG C save backup.For ease of comparing, Setup Experiments monoclonal cell MT21 experimental groups (MT21), normal MDCK control groups (control), the additional 0.5 μ g/mlTPCK-trypsin experimental groups (MT21+) of MT21, normal The additional 0.5 μ g/mlTPCK-trypsin control groups (control+) of MDCK.Monoclonal cell MT21 and normal MDCK are connect respectively During kind of 6 porocyte culture plates to 90% degree of converging, cell culture fluid is sucked, using 3 times removal FBS of aseptic PBS cell, more Change containing 1% dual anti-37 DEG C of incubator culture 24h of serum-free DMEM 1.5mL, treat that monoclonal cell zymogen expression is accumulated.After 24h According to moi equal to each subtype influenza virus of 0.001 inoculation, additional pancreatin group adds final concentration of 0.5 μ g/mlTPCK- pancreases simultaneously Enzyme, per group rearmounted 37 DEG C of 4%CO are mixed per 500 μ l of hole₂Incubator culture.Respectively at 24h, 48h, multigelation cell 2 during 72h It is secondary viral release, 4 DEG C of 5000rpm centrifugation 10min is removed cell fragment, is collected viral supernatant liquid, detect that virus N A lives respectively Property and CCID₅₀Titre.

As a result in 4 strains that (Fig. 7) is tested, 3 plants of wild viruses are more sensitive to MT21 cells, and NA is active and viral Titre is above the result measured on mdck cell, and especially Type B Strain is not required to the trypsase training that additional TPCK is processed Foster 30h just reaches the viral yield consistent with during normal MDCK 0.5 μ g/mlTPCK-trypsin of addition, and MT21 expresses supernatant Middle tryptic activity is only the 1/30 of additional 0.5 μ g/mlTPCK-trypsin, it is seen that the stable cell lines MT21 calibrations of structure Often MDCK infected by influenza is more sensitive, and different shaped or hypotype action effect are different, especially aobvious to low bathmic strain effect Write.After additional 0.5 μ g/mlTPCK-trypsin, MT21 cell culture and virus yield is obviously improved in addition, virus titer highest Nearly 4 times of normal MDCK control groups yield can be reached, for example, wherein after inoculation Type B strains of influenza viruses, MT21 cell culture It is 7.9 × 10 that 72h obtains virus titer³TCID₅₀The virus titer of/ml, common MDCK culture same time is 2.0 × 10³TCID₅₀/ ml, tentatively illustrates that the MDCK-S.pro-try clones that we build compare because of secreting, expressing trypsinogen Mdck cell is more suitable for the propagation of influenza virus.

The identification and application of monoclonal cell MTY6 after 4 codon optimization of embodiment

According to the canis codon usage frequency tables that Codon Usage Database databases are provided, using online close Numeral optimization software OPTIMIZER, the gene order of the code area of bovine trypsin protogene is optimized by we.Optimization is only Change gene order and do not change amino acid sequence.Proenzyme sequence has 741 bases, and 246 amino acid have 135 after optimization Individual base there occurs change, wherein 75 bases there occurs conversion (purine-purine, pyrimidine-pyrimidine), 60 bases there occurs Transversion (purine-pyrimidine).The codon for having 101 amino acid there occurs change, and codon rate of change is 40%.Particular sequence Structure is as shown in SEQ ID No.1：

ATGAAGACCTTCATCTTCCTGGCCCTGCTGGGCGCCGCCGTGGCCTTCCCCGTGGACGACGACGACAAGATCGTGGG CGGCTACACCTGCGGCGCCAACACCGTGCCCTACCAGGTGAGCCTGAACAGCGGCTACCACTTCTGCGGCGGCAGCC TGATCAACAGCCAGTGGGTGGTGAGCGCCGCCCACTGCTACAAGAGCGGCATCCAGGTGAGGCTGGGCGAGGACAAC ATCAACGTGGTGGAGGGCAACGAGCAGTTCATCAGCGCCAGCAAGAGCATCGTGCACCCCAGCTACAACAGCAACAC CCTGAACAACGACATCATGCTGATCAAGCTGAAGAGCGCCGCCAGCCTGAACAGCAGGGTGGCCAGCATCAGCCTGC CCACCAGCTGCGCCAGCGCCGGCACCCAGTGCCTGATCAGCGGCTGGGGCAACACCAAGAGCAGCGGCACCAGCTAC CCCGACGTGCTGAAGTGCCTGAAGGCCCCCATCCTGAGCGACAGCAGCTGCAAGAGCGCCTACCCCGGCCAGATCAC CAGCAACATGTTCTGCGCCGGCTACCTGGAGGGCGGCAAGGACAGCTGCCAGGGCGACAGCGGCGGCCCCGTGGTGT GCAGCGGCAAGCTGCAGGGCATCGTGAGCTGGGGCAGCGGCTGCGCCCAGAAGAACAAGCCCGGCGTGTACACCAAG GTGTGCAACTACGTGAGCTGGATCAAGCAGACCATCGCCAGCAACTAA(SEQ ID No.1)

According to method same in embodiment 1 and 2, the bovine trypsin original encoding gene after optimization is successfully instantaneously proceeded to into MDCK Cell, obtains the monoclonal cell system of stably excreting expression Jing after G418 pressurizes screening, is named as MTY6.Determine expression enzymatic activity Front unification carries out enterokinase activation process to sample, afterwards according to enzymatic activity detection method in embodiment 1, before optimization MT21 monoclonal cells (about 9.37U/ml) are compared, and destination protein expression activity improves about 3 times (about 29.12U/ml) (Fig. 8).

Influenza virus is cultivated under the same terms, the yield of MTY6 monoclonal cell culture influenza viruses can reach common MDCK 5 times or so, such as under conditions of not additional trypsase, cultivate H3N2 subtype influenza virus 72h, MTY6 monoclonal cells receive It is 830 to obtain virus N A activity, and normal mdck cell culture virus N A activity values are only 173；Compared to MT21 Dan Ke before optimization Grand cell, MTY6 infected by influenza are more sensitive, and especially as additional 0.5 μ g/mL TPCK-Trypsin, this species diversity is more Substantially, regardless of whether additional TPCK-Trypsin, MTY6 culture viral yield is 2 times of MT21 or so (referring to Fig. 9), when During additional pancreatin culture H1N1 influenza viruses, viral yield was constantly accumulated with the time, occurred rising appreciably as 72h, and MTY6 is thin The viral yield NA values of born of the same parents are about the virus N A values about 220 of 800, MT21 cells；When not additional pancreatin culture H3N2 influenzas disease When malicious, same viral yield occurs rising appreciably during to 72h with accumulated time, and the viral yield NA values of MTY6 cells are about The virus N A values of 180, MT21 cells about 80.The MTY6 clones that we build in a word compare because of secreting, expressing trypsinogen Mdck cell is more suitable for the propagation of influenza virus, in the culture of cell influenza and related vaccines production has more using value.Together When also become in clinic or experimental study separate, culture influenza virus, monitoring virus variation, antiviral drugs screening, in With the portable tool of the measure of antibody etc., with wide application prospect.

Sequence table

<110>National Institute for Food and Drugs Control

<120>Mdck cell system of bovine trypsinogen and application thereof is expressed stably

<160> 16

<170> Patent In version 3.3

<210> 1

<211> 741

<212> DNA

<213>Artificial sequence

<400> 1

atgaagacct tcatcttcct ggccctgctg ggcgccgccg tggccttccc cgtggacgac 60

gacgacaaga tcgtgggcgg ctacacctgc ggcgccaaca ccgtgcccta ccaggtgagc 120

ctgaacagcg gctaccactt ctgcggcggc agcctgatca acagccagtg ggtggtgagc 180

gccgcccact gctacaagag cggcatccag gtgaggctgg gcgaggacaa catcaacgtg 240

gtggagggca acgagcagtt catcagcgcc agcaagagca tcgtgcaccc cagctacaac 300

agcaacaccc tgaacaacga catcatgctg atcaagctga agagcgccgc cagcctgaac 360

agcagggtgg ccagcatcag cctgcccacc agctgcgcca gcgccggcac ccagtgcctg 420

atcagcggct ggggcaacac caagagcagc ggcaccagct accccgacgt gctgaagtgc 480

ctgaaggccc ccatcctgag cgacagcagc tgcaagagcg cctaccccgg ccagatcacc 540

agcaacatgt tctgcgccgg ctacctggag ggcggcaagg acagctgcca gggcgacagc 600

ggcggccccg tggtgtgcag cggcaagctg cagggcatcg tgagctgggg cagcggctgc 660

gcccagaaga acaagcccgg cgtgtacacc aaggtgtgca actacgtgag ctggatcaag 720

cagaccatcg ccagcaacta a 741

<210> 2

<211> 28

<212> DNA

<213>Artificial sequence

<400> 2

tccggctagc gccaccatga agaccttc 28

<210> 3

<211> 81

<212> DNA

<213>Artificial sequence

<400> 3

tccggctagc gccaccatga agaccttcat ctttctggct ctcttgggag ccgctgttgc 60

tatcgtgggc ggctacacct g 81

<210> 4

<211> 43

<212> DNA

<213>Artificial sequence

<400> 4

tccggctagc gccaccatgt tccccgtgga cgatgatgac aag 43

<210> 5

<211> 36

<212> DNA

<213>Artificial sequence

<400> 5

tccggctagc gccaccatga tcgtgggcgg ctacac 36

<210> 6

<211> 27

<212> DNA

<213>Artificial sequence

<400> 6

gccggaattc ttagttggag gcgatgg 27

<210> 7

<211> 35

<212> DNA

<213>Artificial sequence

<400> 7

tccggctagc gccaccatgt ataggccagc acgtg 35

<210> 8

<211> 34

<212> DNA

<213>Artificial sequence

<400> 8

gtcatcatcg tccacgggga aaaaagctaa aaag 34

<210> 9

<211> 34

<212> DNA

<213>Artificial sequence

<400> 9

ctttttagct tttttccccg tggacgatga tgac 34

<210> 10

<211> 30

<212> DNA

<213>Artificial sequence

<400> 10

gtgtagccgc ccacgataaa agctaaaaag 30

<210> 11

<211> 30

<212> DNA

<213>Artificial sequence

<400> 11

ctttttagct tttatcgtgg gcggctacac 30

<210> 12

<211> 27

<212> DNA

<213>Artificial sequence

<400> 12

gccggaattc ttagttggag gcgatgg 27

<210> 13

<211> 28

<212> DNA

<213>Artificial sequence

<400> 13

tccggctagc gccaccatga agaccttc 28

<210> 14

<211> 27

<212> DNA

<213>Artificial sequence

<400> 14

gccggaattc ttagttggag gcgatgg 27

<210> 15

<211> 23

<212> DNA

<213>Artificial sequence

<400> 15

gtgatgctgg tgctgagtat gtt 23

<210> 16

<211> 21

<212> DNA

<213>Artificial sequence

<400> 16

ggtcttctgg gtggcagtga t 21

Claims

1. it is a kind of expression secreting type bovine trypsinogen modification mdck cell system, it is characterised in that the clone contains It is integrated into the encoding gene of the complete secreting type bovine trypsinogen S.pro-try of its cellular genome.

2. clone as claimed in claim 1, it is characterised in that add before the gene order of the coding S.pro-try Kozak sequences, and the code area to nucleotide sequence carries out the codon optimization design suitable for dog class.

3. clone as claimed in claim 2, it is characterised in that the gene order of the coding S.pro-try such as SEQ ID Shown in No.1.

4. the clone as any one of claim 1-3, it is characterised in that the clone is MTY6, in being deposited in State's Microbiological Culture Collection administration committee common micro-organisms center, deposit number are CGMCC No.12681.

5. a kind of method of clone of the structure as any one of claim 1-4, methods described include encoding The ORFs cDNA sequence of S.pro-try is connected with carrier for expression of eukaryon, then the eukaryotic expression vector transfection is arrived In mdck cell system, the pressurization screening of Jing antibiotic obtains stable expression cell line.

6. method as claimed in claim 5, it is characterised in that methods described include building respectively secreting type bovine trypsin it is former, point Secrete that type bovine trypsin, intracellular type bovine trypsin original, intracellular type bovine trypsin, transmembrane bovine trypsin be former, transmembrane bovine trypsin totally 6 kinds of genes Carrier for expression of eukaryon, transient transfection mdck cell, inoculation human influenza virus compare volume variance, and screening improves virus titer most Good expression pattern.

7. the application of the clone as any one of claim 1-4, wherein, the application is included above-mentioned modification Mdck cell system is used to cultivate influenza virus, prepares influenza vaccines, Tamiflu screening, neutralizing antibody determine or influenza its The application in the fields such as his correlative study.It is preferred that, the influenza virus is human influenza virus.

8. it is a kind of culture influenza virus method, it is characterised in that influenza virus is inoculated in by methods described under suitable conditions In clone any one of claim 1-4.It is preferred that, the influenza virus is human influenza virus.

9. a kind of method for preparing influenza vaccines, it is characterised in that influenza virus is inoculated in by methods described under suitable conditions In clone any one of claim 1-4.It is preferred that, the influenza virus is human influenza virus.

10. method as claimed in claim 8 or 9, it is characterised in that be not required in the step of breeding influenza virus in methods described Add TPCK- pancreatin.It is preferred that, in methods described breed influenza virus the step of in further add TPCK- pancreatin.