CN106520654A - Salmonella choleraesuls attenuation carrier bacterium based on fur gene and construction method thereof - Google Patents

Abstract

The invention provides a salmonella choleraesuls attenuation vector bacterium based on a fur gene and a construction method thereof and relates to the technical field of genetic engineering. Firstly, a suicide vector having an arac PBAD structure inserted into a promoter of a virulence gene is constructed; then attenuation salmonella choleraesuls rSC0008 and rSC0009 mutant strains are constructed in sequence; and a delta asd mutant gene is introduced into the rSC0009 mutant strain to obtain a mutant salmonella choleraesuls attenuation vector rSC0012 based on the fur gene and containing delta manA, delta relA::araC PBAD lacI TT, delta Pfur:TTaraC PBAD fur and delta asdA. The salmonella choleraesuls attenuation vector bacterium provided by the invention has higher safety when used as a young animal vaccine vector and can be used for preparing a vaccine vector for transmitting pig pathogens.

Description

A kind of Salmonella choleraesuls attenuated carrier bacterium and its structure based on fur genes Method

Technical field

The present invention relates to the research and application of gene engineering technology field, particularly Salmonella choleraesuls attenuated carrier bacterium Field.

Background technology

Gene engineering method causes weak salmonella typhimurium as vector expression foreign gene, is widely used in tumour, disease The Therapy study of viral disease, bacterial disease, parasitic disease etc., achieved with good result.But the sramana in many research reports Salmonella carrier, or making attenuated carrier excessive attenuation, loses immunogenicity；Or good immunogenicity is remained, but Carrier bacterial strain is but attenuated not enough, lacks security and cannot function as vaccine.Therefore carry in the urgent need to developing a kind of such vaccine Body, should be such that vaccine carrier is attenuated enough, it is ensured that animal is completely safe, make the exogenous antigen of vaccine carrier and its carrying again Outstanding protection antibody can be induced, the infection of related cause of disease is resisted.

Salmonella choleraesuls are the important pathogens of pig, with regard to Salmonella choleraesuls as vehicle delivery pig other The research of pathogen antigen, it is existing at home and abroad to report on a small quantity.And regulate and control Salmonella choleraesuls virulence gene with arabinose Expression and the report for lacking but are fresh few.Inventor is had found during early-stage Study, with arabinose regulation and control hog cholera sramana Carrier bacterium produced by the crp virulence genes of Salmonella can be induced to the preferable immunogenicity of Balb/c mouse of growing up, but The attenuation of vaccine strain not enough, there may be certain risk, such as Chinese patent literature as the security of vaccine strain CN104498418A。

Streptococcus suis are a kind of important infectious diseases common to human beings and animals, not only affect pig industry sound development, also serious to endanger Do harm to the health of the mankind.The pig of China also has many incomplete aspects, therefore I with commercialization hammer bacteria vaccine at present Select the Sao that most of Streptococcus suis serological type strains have（surface antigen one)）As the different of attenuated strain Source antigen, to the correlation properties of the Salmonella choleraesuls vaccine candidate strain of regulatable delay attenuation that build in this research and Immune efficiency is evaluated, and the prevention and control with which as swine disease provide new thinking.

Recombinant attenuated salmonella vaccine can induce body to produce significant mucosal immunity and cellular immunity, therefore possess The carrier characteristics of delivering exogenous antigen.Existing clearly research show Salmonella carrier the foreign gene entrained by which is had compared with Many advantageous effects, for example, can induce the cell and mucosal immune response for salmonella itself and foreign protein.Research Also find there are many attenuated Salmonella vectors because the immune pressure of host or itself limited colonization ability, it is difficult to reach The immunogenicity to as wild-type strain；Although and some attenuation salmonellas obtain enough immune responses, bacterial strain Itself it is attenuated inadequate, it is impossible to as vaccine carrier.In addition, Salmonella carrier is mainly as the immune response that intracellular bacterium induces Based on cell and mucosa-immune, it is pale and weak for the HI required for most of pathogen infections seems.

SalmonellacrpGene code adenyl cyclase receptor protein, is that bacterium is absorbed in mammalian hosts The unique channel of cAMP；If lacking salmonellacrpGene, just make its lose metabolism carbohydrate, amino acid and Small peptide ability is so as to reducing its virulence.Find during early-stage Study（Such as CN104498418A）, regulate and control pig with arabinose Cholera salmonellacrpCarrier bacterium produced by virulence gene can induce to grow up the preferable cell of BALB/c mouse and Mucosa-immune originality, but the attenuation of vaccine strain is not enough, and the HI of induction is on the weak side, used as the peace to piglet vaccine strain May still there is certain risk in full property, need to continue the gene that screening is more attenuated, build the Salmonella choleraesuis of safety Vaccine carrier.And the characteristic based on cellular immunity of salmonella induction, for the cause of disease for needing HI still It is a defect, the technology and method in the urgent need to searching out statocyte immunity and humoral immunity.

The content of the invention

It is an object of the invention to provide a kind of higher cellular immunity compared with balance of security, humoral immunity and mucosa-immune Response based onfurThe Salmonella choleraesuls attenuated carrier bacterium of gene.

Salmonella choleraesuls attenuated carrier bacterium of the present invention is missing from ΔmanA、ΔP_fur::TT araC P_BAD fur、 ΔrelA::araC P_BAD lacI TT and ΔasdAThe C78-3 Salmonella choleraesuls of four kinds of genes, are named as rSC0012.

rSC0012(ΔmanA、ΔP_fur::TT araC P_BAD fur、ΔrelA::araC P_BAD lacI TT and ΔasdA) It is deposited in common positioned at the China Committee for Culture Collection of Microorganisms of city of BeiJing, China Chaoyang District North Star West Road 1 institute 3 Microorganism center (CGMCC), preservation day are on June 20th, 2016, and deposit number is CGMCC NO.12644, the biomaterial Classification And Nomenclature is：Salmonella choleraesuls are attenuated, Latin name is:Salmonella choleraesuis。

Advantageous of the present invention exist：

1st, the security of attenuated strain is higher：RSC0012 strains ratio possesses Δ P_crp::TT araCP_BAD crpThe rSC0011 attenuations of mutation Strain is more attenuated, and has higher security as young animal vaccine carrier.

2nd, attenuated strain induces the cell and HI of balance：Carry the SaoA albumen of streptococcus suis 2-type RSC0012 (pS-SaoA) can induce cell, body fluid and the mucosal immune response for more balancing, it is possible to which 100% opposing is wild The attack of raw type streptococcus suis 2-type.As a result prove to postpone disappearancefurThe Salmonella choleraesuls attenuated carrier of gene is for young age The vaccine development of animal has practice significance.The present invention can be applied in terms of the former vaccine carrier of delivering swine disease is prepared.

The present invention another object is that the construction method for proposing above Salmonella choleraesuls attenuated carrier bacterium rSC0012.

Technical scheme is as follows：

1）BuildfurInsert in the promoter of virulence genearaC P_BADThe suicide vector of structure：

To be attenuated Salmonella choleraesuls C78-3 as template, carried out using primer P1 and P2, P3 and P4 and P5 and P6 respectively After PCR amplifications, amplified production fragment 1, fragment 2 and fragment 3 are obtained, fragment 1 is connected with fragment 3 and fragment 2 successively, produced ΔP_fur::TT araC P_BAD fur Structure sequence；Again by Δ P_fur::TT araC P_BAD fur Structure sequence is connected to suicide and carries Body pRE112, obtains suicide vector plasmid；Then suicide vector plasmid is converted into Escherichia coli χ 7213, is obtainedfurVirulence Insert in the promoter of genearaC P_BADThe suicide vector of structure, is named as χ 7213 (pS005)；

The nucleotide sequence difference of described primer P1, P2, P3, P4, P5 and P6 is as follows：

P1：5’-ACATGCATGCTGTGACTGGGATGACTTCTTCCCG- 3’；

P2：5’-TGCGAGCTCGTGTAAATCTTTCGAAGAGCCAA- 3’；

P3：5’-AAGCTCGAGAGTCATGCGGAATCTGTCCTG- 3’；

P4：5’-TCCCCCGGGCACTTTTCCGCAATCAAGGCAG- 3’；

P5：5’-CCTGGTACCTAGGCCTCTAGATAAATAAAAGCAGTTTACAACTCCTAGAATTGT- 3’；

P6：5’-AGAGGTACCCTCGAGGCTAGCCCAAAAAAACGGG- 3’；

2）Build attenuation Salmonella choleraesuls rSC0008：

Insertion mutation Δ is distinguished in Salmonella choleraesuls C78-3manAAnd ΔrelA::araC P_BAD lacITT, must be attenuated Salmonella choleraesuls rSC0008；

3）Build rSC0009 mutant strains：

Attenuation Salmonella choleraesuls rSC0008 is introduced into describedfurInsert in the promoter of virulence genearaC P_BADStructure Suicide vector, obtain rSC0009 mutant strains；

4）Build the Salmonella choleraesuls attenuated carrier bacterium based on fur genes：

Δ will be introduced in rSC0009 mutant strainsasd Mutator, obtains the Salmonella choleraesuls attenuated carrier based on fur genes Bacterium.

The present invention absorbs regulatory protein (ferric uptake using the iron that arabinose regulates and controls Salmonella choleraesuls Regulator, Fur) postpone disappearance, the opportunity of Salmonella choleraesuls virulence gene disappearance is controlled, Salmonella choleraesuls are made Metabolism to iron gets muddled and is attenuated, while affecting salmonella in lymphoid colonization ability, causes to lack Fur albumen The level of cellular immunity, humoral immunity and mucosa-immune of attenuation salmonella induction change, subtracted with which enough Poison, finally enables attenuated strain high efficiency invasion host's lymphatic system as wild type Salmonella choleraesuls, induces ratio The relatively cellular immunity of balance, humoral immunity and mucosal immune response, obtain the piglet of immune response of safe enough and balance suddenly Random Salmonella carrier bacterium.

The present invention is built on Salmonella choleraesuls C78-3, is usedaraC P_BAD Activation promoter technology is in pig The coding iron of cholera salmonella absorbs regulatory protein (ferric uptake regulator, Fur)furGene is opened Introduce in promoter sequencesaraC P_BADGene, makes genefurExpression in thalline chromosome is regulated and controled by arabinose, with So that salmonella virulence gene postpones disappearance and expresses, Salmonella choleraesuls are builtfurGene containing Δ P_fur::TTaraC P_BAD fur The suicide vector of structure sequence.The present invention makes Salmonella choleraesuls C78-3 obtain ΔmanA、ΔrelA::araC P_BAD lacI TT、ΔP_fur::TT araCP_BAD fur And ΔasdA Mutation（Preferably, obtained by methods of homologous recombination Obtain these mutation）, it is built into containing ΔmanA, ΔrelA::araC P_BAD lacI TT, Δ P_fur::TT araCP_BAD furWith ΔasdA Salmonella choleraesuls attenuated carrier rSC0012 of mutation.

The beneficial effect of the constructing technology of the present invention：

1st, the present invention is using Arabinose promoter gene in the design of carrier constructionaraC P_BADRegulation and control hog cholera sramana SalmonellafurThe expression of virulence gene, i.e.,：Using the characteristic for not having arabinose in animal body, artificial culture carrier bacterium in vitro When can artificially add certain density arabinose, carrier bacteriumfurVirulence gene can be expressed completely, enter carrier bacterium The initial stage of host is invaded with the invasive ability as wild-type strain, the lymphatic system in host is colonized, is induced as wild The immune response of bacterium induction；And enter in host's body in carrier bacterium, with the duplication of bacterium, the external artificial arabinose for adding Concentration is constantly diluted, and the Fur protein concentrations of carrier bacterium expression are also constantly reduced, and makes bacterium gradually be attenuated acquisition and carries as vaccine The security of body；This method is to be used for Salmonella choleraesuls firstfurThe structure of virulence gene.

2nd, method of the present invention using the suicide vector of non-resistant mark as Salmonella choleraesuls carrier is built, can be with Avoid the carrier using antibiotic marker, it is to avoid attenuated carrier produces drug resistance.

3rd, the present invention additionally uses the bacterium/carrier system method of balance-lethal.Wherein balance-lethal bacterium/carrier system System method deletes bacteriumasdGene, forcibly makes the growth needs of bacterium artificially add diaminopimelic acid（It is bacterium A kind of basis of whole cell peptidoglycan layer）, while adding wild-type bacterium on expression exogenous antigen plasmid vectorasd Gene.Then willasd ⁺Plasmid electricity be transformed intoasd ^-Bacteria carrier on form complementary, it is ensured that only carry exogenous antigen Vaccine strain could production vaccine and immunity host in survive, improve vaccine Immune efficiency.

Description of the drawings

Fig. 1 is Δ P_fur::TT araCP_BAD furGene delection builds figure.

Fig. 2 is Δ P_fur::TT araCP_BAD furSuicide vector figure.

Fig. 3 is ΔmanAThe LPS AgNOR stain figures of the phenotypic evaluation of gene-deleted strain positive bacteria.In figure, swimming lane A：ΔmanALack Strain is lost without mannose；Swimming lane B：ΔmanAGene-deleted strain has mannose；Swimming lane C：C78-3 street strains.

Fig. 4 is the Western blot figures of the expression of arabinose regulation and control LacI albumen.In figure, swimming lane 1～5 is respectively χ 0008 generation passed in nutrient medium, LacI.38 kD；Swimming lane M is albumen marker.

Fig. 5 is Δ P_fur::TT araC P_BAD furThe electrophoretogram of the PCR electrophoretograms identification of gene-deleted strain positive bacteria.Swimming lane M： DL2000 DNA marker；Swimming lane 1～5：Positive findings（I.e.：It is accredited as after the positive sample of mutation is further purified and takes out at random Take the PCR electrophoretograms of bacterium colony；" positive findings " for appearing below, unless specifically indicated, is such case）.

Fig. 6 is ΔasdAThe electrophoretogram of the PCR electrophoretograms identification of mutant strain.Swimming lane M：DL2000 DNA Marker；Swimming lane 1～6 ΔasdPositive findings.

Fig. 7 is rSC0012 (ΔsmanA, ΔrelA::araC P_BAD lacI TT, Δ P_fur::TT araC P_BAD fur, ΔasdA) PCR electrophoretograms identification.Swimming lane M：DL2000 DNA Marker；Swimming lane 1：ΔP_fur::TT araC P_BAD furIt is positive As a result；Swimming lane 2：ΔmanAPositive findings；Swimming lane 3,4：ΔrelA::araC P_BAD lacI Single-swap positive findings before and after TT； Swimming lane 5：Δ asdAPositive findings.

Fig. 8 is to lose O antigens without rSC0012 during mannose, recovers the electrophoretogram of O antigens when having mannose.Swimming lane A： C78-3 velogen strains；Swimming lane B：RSC0018 low virulent strains；Swimming lane C：RSC0012 bacterial strains (- mannose)；Swimming lane D：RSC0012 bacterial strains (+mannose)。

Fig. 9 is the Western blot figures of the expression of arabinose regulation and control SaoA albumen.Swimming lane M：Albumen marker；Swimming lane 1～5：The generation of respectively rSC0012 (pS-SaoA) blind passages in NB nutrient solutions.

Figure 10 is the Western blot figures of the expression of arabinose regulation and control Fur albumen.Swimming lane M：Albumen marker；Swimming lane 1～5：The generation of respectively rSC0012 (pS-SaoA) blind passages in NB nutrient solutions.

Figure 11 is the comparison diagram of rSC0012 growth conditions in containing DAP and the LB fluid nutrient mediums without DAP.Left side examination Bottle：RSC0012 is not grown in the LB fluid nutrient mediums without DAP；Right side trial jar：RSC0012 is in the LB Liquid Cultures containing DAP Normal growth in base.

Figure 12 isSaoAThe amplification electrophoretogram of gene.Swimming lane M：DL2000 DNA Marker；Swimming lane 1,2：SaoAGene.

Figure 13 is the Western Blot qualification figures for purifying SaoA albumen.Swimming lane M：Albumen Marker；Swimming lane 1：Purifying SaoA albumen；Swimming lane 2：BL21(pET28a-SaoA) mycoprotein.

Figure 14 is asd⁺The plasmid pYA3493 for being not inserted into foreign gene structural representation.

Figure 15 is asd⁺InsertionSaoAThe structural representation of the plasmid pS-SaoA of gene.

Figure 16 is attenuated strain colonization ability comparison diagram in 6 week old BALB/c mouse livers.

Figure 17 is attenuated strain colonization ability comparison diagram in 6 week old BALB/c mouse spleens.

Figure 18 is attenuated strain colonization ability comparison diagram in 6 week old BALB/c mouse enteron aisles send Yi Ershi lymph nodules.

Figure 19 is colonization ability comparison diagram of the attenuated strain in 21d BALB/c mouse livers.

Figure 20 is colonization ability comparison diagram of the attenuated strain in 21d BALB/c mouse spleens.

Figure 21 is attenuated strain colonization ability comparison diagram in 21d BALB/c mouse enteron aisles send Yi Ershi lymph nodules.

Figure 22 is pS-SaoAPlasmid is in rSC0012 (pS-SaoA) the middle identification electrophoretogram for passing 10-50 for PCR results.Swimming Road M：DL10000 DNA marker；Swimming lane 1～5：Respectively rSC0012 (pS-SaoA) the 10th～50 generation.

Figure 23 is that pS-SaoA plasmids pass identification electrophoresis of the 10-50 for digestion result result in rSC0012 (pS-SaoA) Figure.Swimming lane M：DL10000 DNA marker；Swimming lane 1～5：10th～50 generation of respectively rSC0012 (pS-SaoA).

Figure 24 is the IgG figures of the anti-SaoA of attenuated strain immunity 6 week old BALB/c mouses induction.

Figure 25 is the anti-salmonella attenuated strain outer membrane protein OMPs of attenuated strain immunity 6 week old BALB/c mouses induction IgG schemes.

Figure 26 is the anti-SaoA IgA level views of attenuated strain immunity 6 week old BALB/c mouses induction.

Figure 27 is attenuated strain immunity 6 week old BALB/c mouses induction IFN-γ level view.

Figure 28 is attenuated strain immunity 6 week old BALB/c mouses induction IL-4 level views.

Figure 29 is the anti-SaoA IgG figures of attenuated strain immunity 21dBALB/c mouse induction.

Figure 30 is the IgG figures of the anti-salmonella attenuated strain OMPs of attenuated strain immunity 21dBALB/c mouse induction.

Figure 31 is the figure of the anti-SaoA IgA of attenuated strain immunity 21dBALB/c mouse induction.

Figure 32 is the figure that attenuated strain immunity 21d BALB/c mouses induce IFN-γ level.

Figure 33 is the figure that attenuated strain immunity 21d BALB/c mouses induce IL-4 levels.

Specific embodiment

In order to illustrate technical scheme and technical purpose, below in conjunction with the accompanying drawings and specific embodiment is to the present invention It is described further.

First, build attenuation Salmonella choleraesuls rSC0012.

1st, buildfurInsert in the promoter of virulence genearaC P_BADThe suicide vector of structure（ΔP_fur::TT araCP_BAD fur）：

The complete genome sequence of Salmonella choleraesuls is searched in Genbank, Salmonella choleraesuls are foundfurGene and its Upstream promoter sequence,furThe left and right sides design homology arm primer sequence of gene promoter, deletesfurGene promoter area 238 nucleotides, be inserted into transcription terminator（TT）WitharaC P_BADActivation promoter sequence 1335bp, which is deleted and inserts The system for entering is：furUpstream region of genefldAPartial sequence, deletionfurThe sequence on right side, insertion after the 238bp of gene promoter area Transcription terminator（TT）WitharaC P_BADActivation promoter sequence 1335bp, deletionfurGene promoter 238bp rear left lateral orders Row, full name are Δ P_fur::TT araCP_BAD fur（P represents promoter, and TT represents transcription terminator）（As shown in Figure 1.

Comprise the following steps that：

With Salmonella choleraesuls C78-3 as template, obtained with primer P1 and P2 Jing PCR amplificationsfldAHomology arm area, is named as Fragment 1 (330 bp).

With Salmonella choleraesuls C78-3 as template, deleted with primer P3 and P4 Jing PCR amplificationsfurGene promoter After 238 bp nucleotides of sub-district remainingfurHomology arm in gene, is named as fragment 2 (356 bp).

With Salmonella choleraesuls C78-3 as template, TT is obtained with primer P5 and P6 Jing PCR amplificationsaraC P_BADStructure Sequence, is named as fragment 3.

Take 22.8 L sterile purified waters（SW）, 0.6 L upstream primers, 0.6 L downstream primers, 1 L templates and 25 L Supermix constitute the PCR reaction systems that cumulative volume is 50 L, and reaction condition is：94 DEG C of denaturations 5min；94 DEG C of denaturation 30s, annealing temperature are 58 DEG C of 1min, 72 DEG C of extension 2min, and totally 30 circulate；72 DEG C of extension 10min；4 DEG C of preservations.

Subsequently, fragment 1 is connected with 3 Jing flush ends of fragment, then connection product is connected to into pGEM-TEasyVector clones Carrier（Promega companies）；After by connection product digestion, then it is connected with 2 Jing flush ends of fragment；Connection product is then connected to PGEM-TEasyVector cloning vectors, produce Δ P_fur::TT araC P_BAD furStructure sequence, the sequencing of Jing Takara companies, Proof has obtained correct Δ P_fur::TT araC P_BAD furStructure positive plasmid sequence.

Above-mentioned positive plasmid Jing SphI and Xmal digestions, digestion products are connected to chloramphenicol and sucrose selection markers Suicide vector pRE112（Given by Dr.Curtiss Roy III, Arizona State University）In, acquisition Plasmid is referred to as pS005；By digestion and the dual identification of sequencing, will be containing correct Δ P_fur::TT araC P_BAD furStructure Suicide vector plasmid pS005 is converted into Escherichia coli χ 7213 by electricity, is obtainedfurInsert in the promoter of virulence genearaC P_BADThe suicide vector of structure, as shown in Fig. 2 being named as χ 7213 (pS005), is stored in -20 DEG C of environment.

The nucleotide sequence difference of primer P1, P2, P3, P4, P5 and P6 is as follows：

P1：5’-ACATGCATGCTGTGACTGGGATGACTTCTTCCCG- 3’.

P2：5’-TGCGAGCTCGTGTAAATCTTTCGAAGAGCCAA- 3’.

P3：5’-AAGCTCGAGAGTCATGCGGAATCTGTCCTG- 3’.

P4：5’-TCCCCCGGGCACTTTTCCGCAATCAAGGCAG- 3’.

P5：5’-CCTGGTACCTAGGCCTCTAGATAAATAAAAGCAGTTTACAACTCCTAGAATTGT- 3’.

P6：5’-AGAGGTACCCTCGAGGCTAGCCCAAAAAAACGGG- 3’.

2nd, build rSC0008（ΔmanAAnd ΔrelA::araC P_BAD lacITT）And its identification of phenotype：

Insertion mutation Δ is distinguished in Salmonella choleraesuls C78-3manAAnd ΔrelA::araC P_BAD lacITT, is referred to as subtracting Malicious Salmonella choleraesuls rSC0008（Ji Z, Shang J, Li Y, Wang S, Shi H. Live attenuated Salmonella enterica serovar Choleraesuis vaccine vector displaying regulated delayed attenuation and regulated delayed antigen synthesis to confer protection against Streptococcus suis in mice. Vaccine. 2015 Sep 11;33(38): 4858-67）.WhereinmanAAfter gene delection, in the metabolic process of salmonella, fructose-1, 6-diphosphate generates 6- phosphomannoses During lacked phosphomannose isomerase,manAGene delection bacterium cannot synthesize the side chain of LPS O- antigens, in LPS Middle O- antigens will become smooth band；But when cultivating in vitro, after artificial addition mannose, with ΔmanAMutation Bacterium can synthesize LPS O- antigens, as shown in Figure 3：ΔmanAO antigens are lost when gene-deleted strain is without mannose.

In ΔrelA::araC P_BADIn the structure of lacI TT mutation, by arabinose controllacIThe expression of gene. I.e. in the presence of having arabinose,lacI gene is expressed, and the lacI albumen of expression may refrain from mutant salmonella strain carrying Prokaryotic expression carrier expresses foreign protein；Conversely, work as in the animal body that there is no arabinose,lacIGene can not be by Foreign protein just can be more efficiently expressed in expression, the prokaryotic expression carrier that mutant salmonella strain is carried.Therefore in culture mutation During strain 0008 first generation of χ, 0.2% arabinose and 0.2% mannose are added；From the beginning of the second culture, arabinose is just not added with And mannose, such 10 generation of continuous passage culture.With the increase for passing on algebraically, in bacterium, the content of arabinose gradually subtracts Few, into the amount just constantly reduction of albumen, lacI gene expressions are shown in that Fig. 4 arabinoses regulate and control the expression of LacI albumen.

3rd, build containing Δ P_fur::TT araC P_BAD furThe rSC0009 mutant strains of mutation（C78-3ΔmanA, ΔrelA::araC P_BAD lacITT, Δ P_fur::TT araC P_BAD fur）：

In recipient bacterium rSC0008 (C78-3 ΔsmanA, ΔrelA::araC P_BAD lacITT obtained in being introduced into step 1.1 in) Containing Δ P_fur::TT araC P_BAD furThe suicide vector χ 7213 (pS005) of structure, builds rSC0009 mutant strains：

Comprise the following steps that：

1）Donor bacterium and the combination of recipient bacterium：

The preparation of acceptor bacterium solution：RSC0008 is added in 1mL LB culture mediums（C78-3ΔmanA, ΔrelA::araC P_BAD lacITT）, 37 DEG C are cultivated 10-12 hours, obtain acceptor bacterium solution.

The preparation of donor bacterium：In the 2,6- diaminopimelic acids containing 50mg/mL（2,6-diaminopimelic acid, DAP）, the chloramphenicol of 25mg/mL（Chloramphenicol, Cm）1mL LB nutrient solutions in add suicide vector χ 7213 （pS005）37 DEG C of culture 10-12 hours, obtain donor bacterium solution.

Then acceptor bacterium solution and donor bacterium solution are mixed, makes recipient bacterium and donor bacterium occur to combine, obtain the bacterium colony for combining.

2）ΔP_fur::TT araC P_BAD furThe screening of gene-deleted strain：

Combining bacterium colony draws single bacterium colony on the LB solid culture plates containing chloramphenicol；The single bacterium colony for taking growth is cultivated in 1mL LB Cultivate in liquid, 37 DEG C of shaking cultures are muddy to bacterial concentration；Each bacterium solution is diluted to 10 according to 10 times^-3, coat containing 5% sucrose LB solid culture plates on turn out single bacterium colony, and be named as rSC0009 mutant strains.

3）rSC0009(C78-3ΔmanA, ΔrelA::araC P_BAD lacITT, Δ P_fur::TT araC P_BAD fur) The PCR identifications of mutant strain：

The bacterium colony that will be grown on the LB solid culture plates of 5% sucrose, consolidates with the LB containing chloramphenicol on LB solid culture plates respectively Body culture lining out；To grow on LB solid culture plates, but do not grow on the LB solid culture plates containing chloramphenicol Bacterium colony, enters performing PCR identification, Δ P with primer P1 and P4_fur::TT araC P_BAD furThe PCR fragment size of gene-deleted strain positive bacteria is 2015 bp, the PCR fragment size of negative bacterium is 919 bp.PCR qualification results are as shown in Figure 5：The visible positive on swimming lane 1～5 As a result, illustrate rSC0009 mutant strains have been obtained.

4th, build Salmonella choleraesuls attenuated strain rSC0012.

In rSC0009 mutant strains（ΔmanA ΔrelA::araC P_BAD lacI TT ΔP_fur::TT araCP_BAD fur） Middle introducing ΔasdMutation, comprises the following steps that：

1）Donor bacterium and the combination of recipient bacterium：

The preparation of acceptor bacterium solution：Recipient bacterium rSC0009 is added in 1mL LB culture mediums（C78-3ΔmanA, ΔrelA::araC P_BAD lacITT, Δ P_fur::TT araCP_BAD fur）, 37 DEG C are cultivated 10-12 hours, obtain acceptor bacterium solution.

The preparation of donor bacterium solution：In the 2,6- diaminopimelic acids containing 50 mg/mL（2,6-diaminopimelic Acid, DAP）, the chloramphenicol of 25mg/mL（Chloramphenicol, Cm）1mL LB nutrient solutions in add χ 7213（pS004） (ΔasdSuicide vector, built by this laboratory, concrete grammar is shown in Ji Z, Shang J, Li Y, Wang S, Shi H. Live attenuated Salmonella enterica serovar Choleraesuis vaccine vector displaying regulated delayed attenuation and regulated delayed antigen synthesis to confer protection against Streptococcus suis in mice. Vaccine. 2015 Sep 11;33(38):4858-67), 37 DEG C of culture 10-12 hours, obtain donor bacterium solution.

Acceptor bacterium solution and donor bacterium solution are mixed, is made recipient bacterium and donor bacterium occur to combine, is obtained the bacterium colony for combining.

2）ΔasdThe screening of gene-deleted strain：

Combining bacterium colony draws single bacterium colony on the LB solid culture plates containing chloramphenicol and DAP；The single bacterium colony for taking growth is containing Cultivate in the 1mL LB nutrient solutions of DAP, 37 DEG C of shaking cultures are muddy to bacterial concentration；Each bacterium solution is diluted to 10 according to 10 times^-3, Coat single bacterium colony is turned out on the LB solid culture plates containing 5% sucrose.

3）Salmonella choleraesuls attenuated strain rSC0012 (C78-3 ΔsmanA, ΔrelA::araC P_BAD lacITT, Δ P_fur::TT araC P_BAD Fur,Δasd) mutant strain PCR identification：

The bacterium colony that will be grown on the LB solid culture plates of 5% sucrose and DAP, respectively in LB solid culture plates, the LB containing DAP Solid culture plate, and the LB solid culture lining outs containing DAP and chloramphenicol simultaneously；The training of LB solids will obtained containing DAP only Grow on foster plate, but the bacterium not grown on the LB solid culture plates containing DAP and chloramphenicol in LB solid culture plates, simultaneously Fall, use primer P7（5’-TGCTCTAGA TGTGCATGGCAATCGCCCAAC-3’）And P8（5’-TCCCCCGGG TATCTGCGTCGTCCTACCTTC-3’）Enter performing PCR identification, ΔasdPCR fragment size 633bp of positive bacteria, negative bacterium PCR fragment size is 1719bp.As shown in Figure 6.

By rSC0009（ΔmanA ΔrelA::araC P_BAD lacI TT ΔP_fur::TT araCP_BAD fur）+Δasd Mutant strain is named as attenuation Salmonella choleraesuls rSC0012.

Attenuation Salmonella choleraesuls rSC0012 is deposited in positioned at city of BeiJing, China Chaoyang District North Star West Road 1 institute 3 China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC), preservation day be on June 20th, 2016, preservation Numbering is CGMCC NO.12644, and the Classification And Nomenclature of the biomaterial is：Salmonella choleraesuls are attenuated, Latin name is:Salmonella choleraesuis。

2nd, structure is containedfurThe attenuation Salmonella choleraesuls rSC0012 of gene promoter modification carries out phenotype mirror It is fixed：

1st, the mutation in PCR identifications rSC0012 attenuation Salmonella choleraesuls：

By primer P9（ΔmanA）And P10（ΔmanA）To the Δ in rSC0012 strainsmanAIt is mutated into performing PCR and expands.

By primer P11（ΔrelA）And P12（ΔrelA）To the Δ in rSC0012 strainsrelA::araC P_BAD lacI TT It is mutated into performing PCR and expands.

By primer P13（ΔP_fur）And P14（ΔP_fur）To the Δ P in rSC0012 strains_fur::TT araCP_BAD furBe mutated into Performing PCR is expanded.

By primer P15（ΔasdA）And P16（ΔasdA）To the Δ in rSC0012 strainsasdAIt is mutated into performing PCR and expands.

Each primer sequence sees below above：

P9（ΔmanA）：5’-GGGGAGCTCCGCTGGTAGTTTTGATAACTTAA-3’.

P10（ΔmanA）：5’- GGGGGTACCTACGGCGACGGACACATGTTCGCT-3’.

P11（ΔrelA）：5’- CCCAAGCTTGAGCTCGAGGGCGTTCCGGCGCTGGTAGAA-3’.

P12（ΔrelA）：5’- CGGGTACCCCAGATATTTTCCAGATCTTCAC-3’.

P13（ΔP_fur）：5’- ACATGCATGCTGTGACTGGGATGACTTCTTCCCG-3’.

P14（ΔP_fur）：5’- TCCCCCGGGCACTTTTCCGCAATCAAGGCAG-3’.

P15（ΔasdA）：5’- TGCTCTAGATGTGCATGGCAATCGCCCAAC-3’.

P16（ΔasdA）：5’- TCCCCCGGGTATCTGCGTCGTCCTACCTTC-3’.

Wherein, the reaction system of the PCR of each mutant fragments and condition difference are as follows：

1）ΔmanA The cumulative volume of PCR amplification system is 25 L, including：15.7µL SW、2.5µL 10x buffer、3ul MgCl₂、1µL dNTP（2.5mM), 0.3 L primer P9,0.3 L primer P10,2 L templates and 0.2 L Taq DNA polymerization Enzyme；Its reaction condition is：95 DEG C of denaturations 2min；95 DEG C of denaturation 30s, annealing temperature are 58 DEG C of 1min, and 72 DEG C extend 1min, Totally 25 circulations；72 DEG C of extension 10min；4 DEG C of preservations.

2）ΔrelA::araC P_BAD lacI The cumulative volume of TT PCR amplification systems is 25 L, including：15.7µL SW、 2.5µL 10x buffer、3µL MgCl₂、1µL dNTP（2.5mM), 0.3 L primer P11,0.3 L primer P12,2 L moulds Plate and 0.2 L Taq archaeal dna polymerases.Its reaction condition is：95 DEG C of denaturations 2min；95 DEG C of denaturation 30s, annealing temperature is 60 DEG C 2 min, 72 DEG C of extension 3min, totally 30 circulations；72 DEG C of extension 10min；4 DEG C of preservations.

3）ΔP_fur::TT araCP_BAD furThe cumulative volume of PCR amplification system is 25 L, including：15.7µL SW、2.5 µL 10x buffer、3µL MgCl₂、1µL dNTP（2.5mM), 0.3 L primer P13,0.3 L primer P14,2 L templates With 0.2 L Taq archaeal dna polymerases.Its reaction condition is：95 DEG C of denaturations 5min；94 DEG C of denaturation 30s, annealing temperature are 58 DEG C 1min, 72 DEG C of extension 2min, totally 30 circulations；72 DEG C of extension 10min；4 DEG C of preservations.

4）ΔasdA The cumulative volume of PCR amplification system is 25 L, including：15.7µL SW、2.5µL 10x buffer、 3µL MgCl₂、1µL dNTP（2.5mM), 0.3 L primer P15,0.3 L primer P16,2 L templates and with 0.2 L Taq Archaeal dna polymerase.Its reaction condition is：94 DEG C of denaturations 5min；94 DEG C of denaturation 30s, annealing temperature are 58 DEG C of 1min, and 72 DEG C are prolonged 1min is stretched, totally 30 circulations；72 DEG C of extension 10min；4 DEG C of preservations.

Fig. 7 reflects the result of the PCR fragment of 4 mutation, it is seen that：The PCR fragment size of 4 on bacterial strain mutation with Expected result is complied fully with.

2nd, the phenotypic evaluation of rSC0012 mutant strains：

1）ΔmanAThe phenotypic evaluation of mutation：

By wild type Salmonella choleraesuls C78-3（Purchased from China Institute of Veterinary Drug Control）, Chinese Salmonella choleraesuls standard attenuated vaccine strain C500（Purchased from China Institute of Veterinary Drug Control）As control；If adding in rSC0012 and being added without mannose（mannose）Group, carries out Silver stain Experiment.Due to ΔmanA causes the LPS-O antigenic side chains of mutant strain to lack, and LPS glue is presented slickness (such as swimming lane C institutes in Fig. 8 Show).And after adding mannose in the medium, mutant strain can normally synthesize LPS-O antigens, LPS glue recovers band (such as Fig. 8 Shown in middle swimming lane D).And the LPS glue of control group C78-3, C500 all presents band, and the band of C78-3 is darker.Fig. 8 Show, swimming lane A is C78-3 strains, and swimming lane B is C500 strains（RSC0018 low virulent strains）, swimming lane C is the rSC0012 for not adding mannose Strain, swimming lane D are the LPS silver staining chromatic graphs of the rSC001 strains for adding mannose.

2）ΔrelA::araC P_BAD lacI The phenotypic evaluation of TT mutation：

In ΔrelA::araC P_BAD lacIIn the structure of TT mutation, it is by arabinose controllacIThe expression of gene.I.e. when In the presence of having arabinose,lacIGene is expressed, and the lacI albumen of expression may refrain from the protokaryon of mutant salmonella strain carrying Expression vector expresses foreign protein；Conversely, work as in the animal body that there is no arabinose,lacIGene can not be by table Reach, the prokaryotic expression carrier that mutant salmonella strain is carried just can more efficiently express foreign protein.Therefore this experiment needs prominent Become bacterial strain and carry the cooperation that can express foreign protein prokaryotic expression carrier, therefore rSC0012 (pS-SaoA) is used as checking ΔrelA::araC P_BAD lacI The bacterial strain of TT phenotypes.

RSC0012 (pS-SaoA) is with the dilution of arabinose concentrations, the foreign protein of prokaryotic vector pS-SaoA expression SaoA gradually increases.Concrete grammar is as follows：

RSC0012 (pS-SaoA) single bacterium colonies are taken in 2mL NB culture mediums, in 37 DEG C of constant-temperature table 220rpm shaken cultivations, with Incubation time 12h is a generation, by bacterium solution by volume 1:100 inoculation 5mL NB culture medium leaflet cultures.When the first generation is cultivated, Add 0.2 % arabinoses in the NB culture mediums without arabinose under normal circumstances, and start not add from the second culture With arabinose, 10 generation of such blind passage.After the groping of protein expression optimum condition, picking is often for single bacterium colony in containing LB liquid Body culture medium, in 37 DEG C of constant incubator quiescent cultures overnight；By 1:50 inoculation 50mL contain the LB Liquid Cultures of kanamycins Base (contains 25 g/mL Kan), cultivates to bacterium solution OD in 37 DEG C of 220 rpm of constant-temperature table₆₀₀For 0.6～1.0,1% IPTG is added Induction 4h, 4 DEG C of 6000rpm are centrifuged 8min, supernatant discarded, plus the resuspended precipitations of 4mL PBS, and 4 DEG C are collected by centrifugation thalline and sink again Form sediment, add 4mL PBS, Jing supersonic cells cracking instrument cracking bacterial cell (working time 1s, working clearance 3s) are until solution It is bright, collect supernatant precipitation after centrifugation respectively.Jing SDS-PAGE detect protein band size；It is anti-with rabbit-anti SaoA serum as one Solution, the goat anti-rabbit igg of HRP marks is two corresponding anti-solution, detects the situation of SaoA protein expressions with Western Blot methods.

In ΔrelA::araC P_BAD lacIIn TT,lacIThe expression of gene is controlled by arabinose.If culture There is arabinose in condition, bacterial strain will be expressedlacIGene, and prokaryotic expression carrier entrained by mutant salmonella strain is outer The expression of source protein is then suppressed.If conversely, condition of culture is in animal body（Here no arabinose）,lacIBase Because being expressed, the foreign protein of entrained prokaryotic expression carrier can be just expressed in mutant salmonella strain.

With the increase of blind passage algebraically, the content of the arabinose for being added in culture medium first is gradually decreased,lacIGene Expression be suppressed, mutant salmonella strain carry prokaryotic expression carrier exogenous antigen SaoA albumen expression just gradually Increase.As shown in Figure 9, wherein swimming lane 1～5 is respectively rSC0012 (pS-SaoA) in NB to the experimental result of Western Blot In 1～5 generation of blind passage in nutrient solution, as seen from Figure 9, with the increase of blind passage algebraically, the expression of SaoA albumen (35 kD) gradually increases Plus.

3）ΔP_fur::TT araC P_BAD furThe phenotypic evaluation of mutation：

furGene is the controlling gene that salmonella carries out metabolism to iron.In experimental designfurAdd in the promoter of gene EnteraraC P_BADGene（Regulated and controled by arabinose）, makefurAlbumen expressed by gene is regulated and controled by arabinose.Therefore It is rightfurThe phenotypic evaluation of gene delection can also use above rSC0012 mutant strain phenotypic evaluation in ΔrelA::araC P_BAD lacI The method of the phenotypic evaluation of TT mutation, i.e., add in cultivating the NB culture mediums of first generation rSC0012 bacterial strain in vitro Arabinose, subsequent continuous passage culture, is all not added with arabinose.With the division of bacterial strain, in culture medium available Ah Draw the sugared concentration of uncle to be gradually reduced, and with culture medium arabinose concentrations be gradually reduced, in bacterial strainfurExpressed by gene Albumen is also just gradually decreased, until disappearance.In Figure 10, the respectively rSC0012 (pS-SaoA) of swimming lane 1～5 is blind in NB nutrient solutions Arabinose when reaching for 1～5 generation regulates and controls the band of expression of Fur albumen, as shown in Figure 10, the increasing of strain passage number of times therewith Many, the concentration of arabinose is gradually decreased, and the expression of Fur albumen is also gradually decreased.

4）ΔasdA Phenotypic evaluation：

Picking rSC0012 single bacterium colonies are inoculated with 5mL LB fluid nutrient mediums and the LB fluid nutrient mediums containing DAP respectively (containing 50 g/mL DAP, in), in 37 DEG C of constant-temperature table 220rpm shaken cultivations overnight, observe the life that the bacterium is cultivated in two kinds of Different Nutrition conditions Long status.

Diaminopimelic acid (DAP) is the main component of gram-negative bacteria cell wall.asdThe aspartic acid of gene code Dehydrogenase is the necessary enzyme in DAP biosynthesis pathways.So ΔasdThe growth of mutant strain depends on extra under culture conditions Addition DAP.As a result show, rSC0012 bacterial strains can be with normal growth in the LB fluid nutrient mediums containing DAP（See right in Figure 11 Side trial jar）, and cannot grow in common LB fluid nutrient mediums（See left side trial jar in Figure 11）.

3rd, the SaoA for selecting most of Streptococcus suis serological type strains to have（Surface antigen one) albumen work For the heterologous antigen of attenuated strain, the Salmonella choleraesuls vaccine candidate strain of the regulatable delay attenuation to building in this research Correlation properties（Such as：Virulence（LD₅₀）, colonization ability and stability etc.）Evaluated, the prevention and control with which as swine disease provide new Thinking.

1st, the Salmonella choleraesuls attenuated strain rSC0012 balances-lethal systems of delivering Streptococcus suis SaoA albumen are built：

1）Streptococcus suis 2-typesaoAGene cloning and expression：

Streptococcus suis 2-type is the important epidemic disease of pig, be detect the application in build delay disappearancefurGene hog cholera Salmonella The Immune efficiency of bacterium, selects streptococcus suis 2-type SaoA albumen as the heterologous antigen of attenuation Salmonella choleraesuls delivering.JingSaoA-F（ATGGATCGCAACCTGATGGAAGAC）、SaoA-R（GGGTCGAGCATTGCTACCTTAGAG）Primer PCR, passes through Glue reclaim, the process of BamHI and SalI double digestions, are connected in T4 and carried with the prokaryotic expression for also passing through double digestion process under enzyme effect Body pET-28a is connected, and chemical transformation is converted into expression bacterial strain BL21, obtains BL21 (pET28a-SaoA) bacterial strain.By enzyme Cutting the positive bacterial strain of identification send Nanjing Jin Sirui to be sequenced.As a result understand, after digestion, obtain the piece of the carrier pET28a of 5639bp The SaoA fragments of section and 777bp, length is 789bp, and the gene order obtained after sequencing sees below：

ggatcccaac ctgatggggg acaggctact tcaaaggcgg ttaatgtcaa aataccagca 60

gtagtacgac tatttggtcg tgagcttcta gaaaatgaat ttaaatttga gcttagagaa 120

gcgaatggcg aggaactccc tgtccttgat acagctcaaa atacaaaaga gggtcaagtt 180

agatttaaaa atctatcatt cgataagcct ggcaaatact ggtatacaat ttcagaagta 240

aaagatgagc ttggtggtat tgagtatgat tcgaaatata ttgtagcaaa aataactgta 300

gaagatcgaa acgggcaatt acaggcaatg atcgaattta ttgataatga caatgtcttt 360

aacaatttct atacacctgc tccagctgct gctagtcttt cgataaaaaa agtcctcgag 420

ggacgtacct taaacaccgg tgaattcgaa tttgttttaa aaaatgaaaa aggcgatgaa 480

atcgaaaagg taagcaatca agcagatggt tctgtaaact ttagtgccct aacatttaca 540

aaagagggaa cctataccta cactgtttca gaagttgatg gtggacttgg cgatattatc 600

tatgacaaat cagatattaa ggccactgtt actgtgaaag ataacaatca cggacaacta 660

gtctcaacag tgacttatga aaatagcgat caaatcttcg agaatatttt gaatcctggg 720

aagttaatag cgccaaccac ggatagcgtt attactgata atgaagtctc taaggaagca 780

ctggtcgac 。

By the gene order obtained after the SaoA sequencing fragments of above digestion products 777bp and the SaoA of standard Streptococcus suis Sequence compares, it was demonstrated that the SaoA sequences of the 777bp of digestion are completely correct.

SaoA protein expressions result in detection BL21 (pET28a-SaoA) is as shown in Figure 13：BL21(pET28a-SaoA) It is capable of the SaoA protein fragments of effective expression external source insertion, stripe size is 35kD）, it is consistent with expection.

2）The structure of Salmonella choleraesuls attenuated strain rSC0012 balance-lethal systems：

To avoid using the plasmid vector containing resistant gene, it is ensured that the plasmid vector in attenuation salmonella is steady in host's body Qualitative, the attenuation Salmonella choleraesuls carrier rSC0012 that we build in this patent is missing fromasdGene（asd^-）, This is in order that asd^- Carrier and asd⁺ Prokaryotic expression carrier（pYA3493）Form complementary.I.e.：Work as disappearanceasdGene Bacterial strain can be by adding diaminopimelic acid when cultivating in vitro（Diaminopimelic acid, DAP）, make up due to lacking LoseasdThe defect that bacterium can not grow after gene.But due to no diaminopimelic acid in animal body, disappearanceasdGene Salmonella cannot survive in animal body, and prokaryotic expression carrier pYA3493 be asd⁺ Plasmid, in pYA3493 PS-SaoA after the SaoA genes of insertion streptococcus suis 2-type is also asd⁺ Plasmid（As shown in Figure 14 and Figure 15）；Then will PYA3493 or pS-SaoA are transformed into asd^-Attenuation salmonella rSC0012 in, asd⁺ Plasmid and asd^-Bacterium with regard to shape Into complementation, so that disappearanceasdWhile the salmonella of gene can survive in animal body, it is to avoid because using resistant gene Plasmid vector and cause the resistance of carrier bacterium.

Therefore this enforcement is first by mutant strain rSC0012（C78-3 ΔmanA ΔrelA::araC P_BAD lacI TT ΔP_fur::TT araCP_BAD fur Δasd）It is fabricated to competence.Comprise the concrete steps that：Picking single bacterium colony rSC0012 is with containing The LB nutrient solution overnight incubations of the 2mL of 50mg/mL DAP；Next day presses 1:The bacterium solution of incubated overnight is seeded to 20 by 100 ratios The LB nutrient solutions of mL continue culture, shaken cultivation to OD₆₀₀≈ 0.6,10 min of ice bath, 4 DEG C, 1500rpm centrifugation 10min collections Bacterium, precipitum are washed 3 times with 10% glycerine of ice bath precooling, and 10% glycerine with 25 l precoolings is resuspended, the as sense of rSC0012 By state cell.After obtaining the competent cell of rSC0012, with Calcium Chloride Method, the plasmid pYA3493 of 1 μ L is taken（By Dr.Curiss Roy III give, Arizona State University）Or pS-SaoA is converted into the competent cell of rSC0012； Converted product is coated into overnight incubation on the LB solid culture plates containing 0.2% arabinose and 0.2% mannose（Do not contain DAP）；Take the single bacterium colony for growing and continue culture extraction plasmid（PYA3493 or pS-SaoA）, Jing EcoRI single endonuclease digestions, acquisition The bacterial strain of 3113bp bands as carries the rSC0012, referred to as rSC0012 of plasmid pYA3493（pYA3493）；Or single endonuclease digestion The bacterial strain for obtaining 3890bp bands afterwards is the rSC0012 for carrying pS-SaoA, becomes rSC0012 (pS-SaoA)；rSC0012 （pYA3493）Or rSC0012 (pS-SaoA) can replicate life in the condition of culture for being not added with DAP or in the animal body for not having DAP It is long.

3）The structure of Salmonella choleraesuls attenuated strain rSC0011 or rSC0018 balance-lethal systems：

To be published in (Zhenying Jib, Jing Shangb, Yuan Li, Shifeng Wang, Huoying in 2015 Shi, Live attenuated Salmonella enterica serovar Choleraesuis vaccinevector displaying regulated delayed attenuation and regulateddelayed antigen synthesis to confer protection againstStreptococcus suis in mice, Vaccine 33 (2015) 4,858 4867) do not contain ΔsopB RSC0011 strains（ΔmanA、Δcrp::TT araC P_BAD、ΔrelA::araC P_BAD lacITT and ΔasdA）And rSC0018（C500ΔasdA）As the preparation of control attenuated strain：

The structure of Salmonella choleraesuls attenuated strain rSC0018 balance-lethal systems：

rSC0018（C500ΔasdA）Bacterial strain be this laboratory in the research of early stage, with Chinese Salmonella choleraesuls standard Attenuated vaccine strain C500 is template, introduces ΔasdAMutation, is named as rSC0018 strains.Then picking single bacterium colony rSC0018 is with containing There are the LB nutrient solution overnight incubations of the 2mL of 50mg/mL DAP；Next day presses 1:The bacterium solution of incubated overnight is seeded to 20 by 100 ratios The LB nutrient solutions of mL continue culture, shaken cultivation to OD600 ≈ 0.6,10 min of ice bath, 4 DEG C, 1500rpm centrifugation 10min collections Bacterium, precipitum are washed 3 times with 10% glycerine of ice bath precooling, and 10% glycerine with 25 l precoolings is resuspended, the as sense of rSC0018 By state cell.After obtaining the competent cell of rSC0018, with Calcium Chloride Method, the plasmid pYA3493 of 1 μ L is taken（By Dr.Curiss Roy III give, Arizona State University）Or pS-SaoA is converted into the competent cell of rSC0018； Converted product is coated into overnight incubation on the LB solid culture plates containing 0.2% arabinose and 0.2% mannose（Do not contain DAP）；Take the single bacterium colony for growing and continue culture extraction plasmid（PYA3493 or pS-SaoA）, Jing EcoRI single endonuclease digestions, acquisition The bacterial strain of 3113bp bands as carries the rSC0018, referred to as rSC0018 of plasmid pYA3493（pYA3493）；Or single endonuclease digestion The bacterial strain for obtaining 3890bp bands afterwards is the rSC0018 for carrying pS-SaoA, becomes rSC0018 (pS-SaoA)；rSC0018 （pYA3493）Or rSC0018 (pS-SaoA) can replicate life in the condition of culture for being not added with DAP or in the animal body for not having DAP It is long.

2nd, Salmonella choleraesuls attenuated strain rSC0012 (pS-SaoA) and street strain C78-3, attenuated strain rSC0011 (pS- SaoA), the virulence of attenuated vaccine strain rSC0018 (pS-SaoA) compares：

To determine the virulence of Salmonella choleraesuls attenuated strain rSC0012 (pS-SaoA), Salmonella choleraesuls street strain is taken C78-3, China now with Salmonella choleraesuls attenuated vaccine strain rSC0018 (pS-SaoA), containcrpThe attenuation of gene delection Strain rSC0011 and contains (pS-SaoA)furAttenuated strain rSC0012 (pS-SaoA) strain of gene delection carries out median lethal dose （LD₅₀）Measure and compare.

1）LD in 6 week old BALB/c mouse₅₀Measure：

It is embodied as, experimental strain is taken out from -70 DEG C of ultra low temperature freezers, aseptic line is incubated at LB solid culture flat boards On, 37 DEG C of quiescent cultures are overnight；Next day picking colony is placed in the LB nutrient solutions of 5mL, 37 DEG C of 18 h of quiescent culture；Take therein 2.5mL is placed in the LB nutrient solutions of 47.5mL；LB nutrient solutions for cultivating mutant strain add 0.2% arabinose and 0.2% Mannose；Deng bacterial concentration reach OD values for 0.8～0.9 when, take out strain cultured solution, centrifugation, bacterial concentration is adjusted to 10¹⁰After CFU/ml, different diluted concentrations are diluted to again with PBS 10.

Carry out attacking poison with lumbar injection approach first.120 6 week old BALB/c mouse of female are randomly divided into 12 groups, per little 10 mouse of group.3 groups are used for the LD of street strain C78-3₅₀Measure, dilution factor is 10 respectively^-1, 10^-2With 10^-3；3 groups use In China now with the LD of attenuated vaccine strain rSC0018₅₀Measure, dilution factor is 10 respectively^-6, 10^-7With 10^-8；3 groups are used for The LD of Salmonella choleraesuls attenuated strain rSC0011 (pS-SaoA)₅₀Measure, dilution factor is 10 respectively^-6, 10^-7With 10^-8；3 Group is used for the LD of Salmonella choleraesuls attenuated strain rSC0012 (pS-SaoA)₅₀Measure, dilution factor is 10 respectively^-6, 10^-7 With 10^-8；Every mouse 100 μ L bacterial suspension lumbar injections, Continuous Observation 30 days, calculate the death toll of mouse.Experimental result Show the LD of street strain C78-3₅₀It is 2.2 × 10²；The LD of vaccine strain rSC0018₅₀It is 2.6 × 10⁷；Attenuated strain rSC0011 (pS-SaoA) LD₅₀It is 1.4 × 10⁷, the LD of attenuated strain rSC0012 (pS-SaoA)₅₀It is 1.1 × 10⁸（See the table below）.As a result Show, the LD of attenuated strain rSC0012 (pS-SaoA)₅₀5 × 10 are reduced than velogen strain C78-3⁵Times, than commercial China's Salmonella The LD of bacteria vaccine strain rSC0018₅₀It is low 4.2 times, than containing Δ P_crp::TT araC P_BAD crpThe attenuation salmonella of mutation The LD of rSC0011 (pS-SaoA)₅₀It is low 7.9 times.Prove that Salmonella choleraesuls attenuated strain rSC0012 (pS-SaoA) are more existing than China To be also attenuated with attenuated vaccine strain rSC0018 and rSC0011 (pS-SaoA).

LD is carried out by oral way₅₀Measure.70 6 week old BALB/c mouse of female are randomly divided into 7 groups, per group 10 mouse.3 groups are used for the LD of street strain C78-3₅₀Measure, dilution factor is 10 respectively^-3, 10^-4With 10^-5；And the existing use of China Attenuated vaccine strain rSC0018 (pS-SaoA), Salmonella choleraesuls attenuated strain rSC0011 (pS-SaoA) and hog cholera Salmonella Bacterium attenuated strain rSC0012 (pS-SaoA) uses 2 groups respectively, and dilution factor is 10^-8With 10^-9；Above each group its mouse oral clothes way Poison is attacked in footpath, attacks Continuous Observation 30 days after poison, the death mouse per day entry.As a result show, the LD of C78-3₅₀For 5.5 × 10⁴； RSC0018 (pS-SaoA), rSC0011 (pS-SaoA) and rSC0012 (pS-SaoA) are attacking toxic agent amount more than 10⁹When, mouse is all Survival.Illustrate that oral route this 3 plants of attenuated strains all can not lethal 6 week old BALB/c mouse（See the table below）.In following table, it is oral and The LD of intraperitoneal inoculation approach, rSC0012 (pS-SaoA) strains and rSC0011 (pS-SaoA) strain₅₀It is notable with C78-3 comparing differences （ **： p<0.01 ）；By intraperitoneal inoculation approach, the LD of rSC0012 (pS-SaoA) strain₅₀Than rSC0011 (pS-SaoA) strain LD₅₀7.8 times of attenuation, significant difference（##： p<0.01）.

2）LD in 21 age in days BALB/c mouse₅₀Measure：

It is embodied as, experimental strain is taken out from -70 DEG C of ultra low temperature freezers, aseptic line is incubated at LB solid culture flat boards On, 37 DEG C of quiescent cultures are overnight；Next day picking colony is placed in the LB nutrient solutions of 5mL, 37 DEG C of 18 h of quiescent culture；Take therein 2.5mL is placed in the LB nutrient solutions of 47.5mL；LB nutrient solutions for cultivating mutant strain add 0.2% arabinose and 0.2% Mannose；Deng bacterial concentration reach OD values for 0.8～0.9 when, take out strain cultured solution, centrifugation, bacterial concentration is adjusted to 10¹⁰After CFU/ml, different diluted concentrations are diluted to again with PBS 10.

The measure of LD50 is carried out by oral way.120 21 age in days BALB/c mouse of female are randomly divided into 9 groups, per little 10 mouse of group.3 groups are used for the LD of street strain C78-3₅₀Measure, dilution factor is 10 respectively^-3, 10^-4With 10^-5；And China is existing Use attenuated vaccine strain rSC0018, Salmonella choleraesuls attenuated strain rSC0011 (pS-SaoA) and Salmonella choleraesuls attenuation Strain rSC0012 (pS-SaoA) respectively use 3 groups, dilution factor is 10^-7、10^-8With 10^-9；Above each group its mouse oral clothes way Poison is attacked in footpath, attacks Continuous Observation 30 days after poison, the death mouse per day entry.As a result show, the LD of C78-3₅₀For 9.5 × 10²； RSC0018 (pS-SaoA) and rSC0012 (pS-SaoA) is attacking toxic agent amount more than 10⁹When, mouse all survives（See the table below）.Explanation Oral route this 2 plants of attenuated strains all can not lethal mouse, and the mouse that rSC0011 (pS-SaoA) is organized oral dose be 1.0 × 10⁹When mouse start rough coat occur, spaced-out symptom, but the 7d after poison is attacked, these symptoms disappear, and There is not any pathological symptom in the mouse that rSC0012 (pS-SaoA) is organized.Illustrate that rSC0012 (pS-SaoA) is bright to the virulence of young mouse It is aobvious to be less than rSC0011 (pS-SaoA) strain.

LD of the experimental strain in different age group BALB/c mouse₅₀Contrast table：

3rd, the colonization ability evaluation of Salmonella choleraesuls attenuated strain rSC0012：

Find in early-stage Study, containcrpGene postpones the attenuation Salmonella choleraesuls strain rSC0011 (pS- of disappearance SaoA) by oral administration 21 age in days piglet when, part piglet diet can be caused to decline, illustrate that the attenuation ability of rSC0011 is inadequate, therefore We devise gene regulation and postpone disappearance Salmonella choleraesuls virulence genefurAttenuated strain rSC0012, intend becoming Safer vaccine candidate strain.Therefore this enforcement compare containingfurThe attenuated strain rSC0012 of gene delection（pYA3493）, With containcrpThe attenuated strain rSC0011 of gene delection（pYA3493）, China commercialization attenuated vaccine strain rSC0018（pYA3493） （The control group of weak poison）Yi Ershi is sent to drench in the liver of 6 week old and 21d BALB/c mouses, spleen and enteron aisle with street strain C78-3 Ba little Jie（payer`s patches）Colonization ability.

1）Colonization abilities of the Salmonella choleraesuls attenuated strain rSC0012 in 6 week old BALB/c mouses：

Experimental strain is taken out from -70 DEG C of ultra low temperature freezers, aseptic line is incubated on LB solid culture flat boards, 37 DEG C stand training Support overnight；Next day picking colony is placed in the LB nutrient solutions of 5mL, 37 DEG C of 18 h of quiescent culture；Take 2.5mL therein to be placed in In the LB nutrient solutions of 47.5mL；LB nutrient solutions for cultivating mutant strain add 0.2% arabinose and 0.2% mannose；Deng Bacterial concentration reach OD values for 0.8～0.9 when, take out strain cultured solution, centrifugation, bacterial concentration is adjusted to into 10¹⁰CFU。

60 6 week old BALB/c mouses are randomly divided into 20 groups, per 3 mouse of group.5 groups are used for street strain C78-3 Field planting experiment；5 groups are used for the field planting of vaccine strain rSC0018 and test；5 groups are used to containcrpThe attenuated strain of gene delection rSC0011（pYA3493）Field planting experiment；5 groups are used to containfurThe attenuated strain rSC0012 of gene delection（pYA3493）'s Field planting experiment；Every Mouse oral 10⁹CFU/20ul bacterial suspensions；Per bacterial strain respectively after inoculation 3d, 7d, 14d, 21d and What 28d took liver, spleen and the enteron aisle of 3 mouse sends Yi Ershi lymph nodules（payer s patches）, it is weighed and aseptic Grinding, coats separation of bacterial in Mai Kangkai culture mediums, the amount of bacteria of computation organization.This experiment is repeated 3 times, and is as a result 3 realities The mean value tested.

Experimental result shows, as hog cholera street strain C78-3 is velogen strain, BALB/c mouse is oral 10⁹CFU's 3d after C78-3 just has large quantities of dead mouses, it is impossible to the field planting experiment of C78-3 goes on, after oral C78-3,3d exists Mouse liver, spleen and enteron aisle send the field planting bacterium amount of Yi Ershi lymph nodules to be significantly higher than rSC0018（pYA3493）, attenuated strain rSC0011（pYA3493）And rSC0012（pYA3493）Field planting bacterium amount（See Figure 16,17,18, $ $, p<0.01）；And vaccine strain rSC0018（pYA3493）, attenuated strain rSC0011（pYA3493）And rSC0012（pYA3493）Oral 10⁹After CFU bacterium amounts In the time of 28d, there is no death in mouse.

In liver, rSC0012（pYA3493）Only the 3d after poison is attacked can be separated to for strain, rSC0018（pYA3493）Strain exists After attacking poison, 3-7d can be separated to, but rSC0011（pYA3493）Strain is but that 3-21d can be separated to after poison is attacked, and In inoculation rSC0011（pYA3493）7-21d after strain, the bacterium amount which is separated to are significantly higher than rSC0012（pYA3493）Strain Field planting bacterium amount（See Figure 16, ##, p<0.01）；rSC0018（pYA3493）Strain is also significantly greater than in the field planting bacterium amount of 7d rSC0012（pYA3493）The field planting bacterium amount of strain（See Figure 16, * *, p<0.01）；Show the bacterial strain rSC0012's containing fur disappearances Virulence is significantly smaller than containing crp deletion mycopremna rSC0011.

In spleen, rSC0012（pYA3493）Strain 3-7d after poison is attacked can be separated to, rSC0018（pYA3493）Strain is only After poison is attacked, the 3rd d can be separated to, but rSC0011（pYA3493）Strain is but that 3-21d is separated to after poison is attacked, and Inoculation rSC0011（pYA3493）3-21d after strain, the bacterium amount which is separated to are significantly higher than rSC0012（pYA3493）Strain Field planting bacterium amount（See Figure 17, ##, p<0.01）；As a result show, the rSC0012 containing fur gene delections（pYA3493）Strain was to 6 weeks The invasive ability of age mouse spleen is significantly smaller than the rSC0011 containing crp gene delections（pYA3493）Strain, but it is better than chemistry Attenuated IBDVs rSC0018（pYA3493）Invasive ability.Show rSC0012（pYA3493）The virulence of strain is weaker than rSC0011 （pYA3493）Strain, is better than rSC0018（pYA3493）Strain.

Yi Ershi lymph nodules, the 3-28d after poison is attacked, rSC0012 are sent in enteron aisle（pYA3493）And rSC0011 （pYA3493）The colonization ability of strain does not have difference；But the 7th, 21d, 28d, rSC0012 after poison is attacked（pYA3493）With rSC0011（pYA3493）The colonization ability of strain is all significantly higher than chemical weakening strain rSC0018（pYA3493）The colonization ability of strain （See Figure 18, * *, P<0.01）；Show to send Yi Ershi lymph nodules, rSC0012 in enteron aisle（pYA3493）And rSC0011 （pYA3493）The colonization ability of strain is similar；And after infection the phase be all significantly stronger than chemical weakening strain rSC0018（pYA3493）Strain.

2）Colonization ability of Salmonella choleraesuls attenuated strain rSC0012 (pS-SaoA) in 21d BALB/c mouses：

Recovery and amplification field planting of the bacterial strain method with Salmonella choleraesuls attenuated strain rSC0012 in 6 week old BALB/c mouses Ability.

60 21 age in days BALB/c mouses are randomly divided into into 20 groups, per 3 mouse of group.5 groups are used for street strain The field planting experiment of C78-3；5 groups are used for the field planting of vaccine strain rSC0018 and test；5 groups are used for attenuated strain rSC0011 （pYA3493）Field planting experiment；5 groups are used for attenuated strain rSC0012（pYA3493）Field planting experiment.Every Mouse oral 10⁹ CFU/20μL（When dosage is 10⁹ During CFU/20 μ L, rSC0011 is inoculated with（pYA3493）Trembling occurs in group mouse, coarse etc. by hair Symptom）；Per bacterial strain respectively after inoculation 3d, 7d, 14d, 21d and 28d take liver, spleen and the enteron aisle of 3 mouse send her That brief summary（payer s patches）, weighed and aseptic grinding coats separation of bacterial in Mai Kangkai culture mediums.Experiment knot Fruit shows, as hog cholera street strain C78-3 is velogen strain, BALB/c mouse is oral 10⁹2d after the C78-3 of CFU is just Have large quantities of dead mouses, it is impossible to which the field planting of C78-3 experiment goes on, after oral C78-3 3d mouse liver, spleen and Enteron aisle sends the field planting bacterium amount of Yi Ershi lymph nodules to be significantly higher than rSC0018（pYA3493）, attenuated strain rSC0011（pYA3493） And rSC0012（pYA3493）Field planting bacterium amount（See Figure 19,20,21, $ $, p<0.01）；And vaccine strain rSC0018 （pYA3493）, attenuated strain rSC0011（pYA3493）And rSC0012（pYA3493）Oral 10⁹After CFU bacterium amounts 28d when In, there is no death in mouse.

In liver, rSC0012（pYA3493）Only after poison is attacked, 3-7d can be separated to； rSC0018（pYA3493）Strain exists After attacking poison, 3-14d is separated to；And rSC0011（pYA3493）3-21d of the strain after poison is attacked can be separated to bacterial strain, and divide From bacterium amount be all significantly higher than rSC0012（pYA3493）Strain（Figure 19, #, P<0.05;##, P<0.01）；Show rSC0012 （pYA3493）The virulence of strain is weaker than rSC0018（pYA3493）Strain (Figure 19, * *, P<0.01), more it is weaker than rSC0011 （pYA3493）Strain.

In spleen, rSC0012（pYA3493）And rSC0018（pYA3493）Strain is the same, and all only after poison is attacked, 3d can divide From arriving, the separation bacterium amount of the two does not have difference, and after attacking poison, 7-28d is just separated less than bacterial strain, and rSC0011（pYA3493）Strain 3-28d after poison is attacked can be separated to bacterial strain, and detached bacterium amount is significantly higher than rSC0012（pYA3493）Strain（Figure 20, ##, p< 0.01）；Show rSC0011（pYA3493）Strain is significantly stronger than rSC0012 to the invasive ability of 21d mouse（pYA3493）With rSC0018（pYA3493）Strain.

But in enteron aisle sends Yi Ershi lymph nodules, only 7d, rSC0011 after inoculation（pYA3493）The field planting of strain Ability is higher than rSC0012（pYA3493）（Figure 21, #, p<0.05）, remaining time period do not have difference；14-28d after inoculation, rSC0012（pYA3493）And rSC0011（pYA3493）The colonization ability of strain is all significantly higher than rSC0018（pYA3493）Strain（Figure 21, * *：P< 0.01）；Show, in the BALB/c mouse of 21d, to containfurGene-deleted strain send her in the mouse intestinal of 21d The invasive ability of Er Shi lymph nodules with containcrpGene-deleted strain rSC0011（pYA3493）Invasive ability it is similar, without aobvious Write difference.

4th, the stability of the attenuation salmonella choleraesuis strain carrier rSC0012 of submission heterologous antigen pS-SaoA：

Picking is inoculated in 2mL LB liquid through PCR, double digestion, sequencing identification right-on rSC0012 (pS-SaoA) single bacterium colony Body culture medium, in 37 DEG C of constant-temperature table shaken cultivations.It is a generation by culture 12h, by bacterium solution according to 1:The fresh LB of 100 inoculations Fluid nutrient medium, so continuously reached for 50 generations.Round 10 generation single bacterium colonies and enter performing PCR identification, as a result show the SaoA of 777 bp The positive band of gene（As shown in figure 22）.Plasmid is stripped to bacterial strain rSC0012 (pS-SaoA), is occurred Jing after double digestion Prokaryotic expression carrier pYA3493 and genes of interestSaoABand（777 bp）（As shown in figure 23）.Testing result shows, pS- SaoA recombinant plasmids can be stably passed in rSC0012.

4th, Salmonella choleraesuls attenuated strain rSC0012 (pS-SaoA) to carrying exogenous antigen carry out little in BALB/c Efficacy evaluation in mouse：

1st, carry Salmonella choleraesuls attenuated strain rSC0012 (pS-SaoA) the exempting from 6 week old BALB/c mouses of exogenous antigen Epidemic disease protective effect：

To detect the difference of rSC0012 and rSC0011, rSC0018 in delivering heterologous antigen inducing immunogenic ability, with 6 weeks Age BALB/c mouse compares rSC0012 (pS-SaoA), rSC0011 (pS-SaoA) and rSC0018 (pS-SaoA) as pig chain Coccus vaccine opposing street strain streptococcus suis 2-type（SS2）The protection sex differernce of attack.This experiment is repeated 2 times, and experimental result is 2 The synthesis of secondary result.

Picking experiment strain rSC0018 (pYA3493), rSC0018 (pS-SaoA), rSC0012 (pYA3493), rSC0012 (pS- SaoA), rSC0011 (pYA3493) and rSC0011 (pS-SaoA) are shaken in 37 DEG C in the LB fluid nutrient mediums of 5 mL Culture 8h, by volume 1:The 100 LB fluid nutrient mediums for being inoculated in 50mL, shaken cultivation is to bacterium solution on 37 DEG C of constant-temperature tables OD₆₀₀It is worth for 0.9 or so, thalline is collected by centrifugation, adds the resuspended precipitations of PBS, continuous 10 times of dilutions.Take the continuous 10 times of dilutions of 100 μ L Count to suitable dilution factor and on Mai Kangkai culture mediums, another part bacterium solution is used for immune mouse.

It is divided into 7 groups with 105 females, 6 week old BALB/c mouse, per group of 15 mouse.Wherein 1 group oral PBS is used as feminine gender Control group, in addition 6 groups of difference oral immunities 10⁹The vaccine strain rSC0018 (pYA3493) of CFU/20 μ L, rSC0018 (pS- SaoA), rSC0012 (pYA3493), rSC0012 (pS-SaoA), rSC0011 (pYA3493), rSC0011 (pS-SaoA) bacterium Liquid.Head exempts from rear 3 weeks booster immunizations once.The 7d after booster immunization, takes 5 mouse and slaughters, take mouse spleen, lungs system per group Into homogenate, centrifuging and taking supernatant, Jing double crush syndromes method detect the cell factor of anti-streptococcus suis SaoA albumen in above-mentioned sample IFN-γ and IL-4 contents；3 weeks after head exempts from, 5 weeks, respectively from venous blood collection under the jaw of mouse, by the blood collected in 4 Serum is obtained DEG C overnight；PBS washing vaginas are used simultaneously, collect vaginal mucosa flushing liquor.Serum and vagina are detected with indirect ELISA Antibody titer in mucous membrane flushing liquor；It is last 2 weeks after booster immunization to be injected with the trans-abdominal chamber of wild type SS2 and attack poison, each strain of detection Immunoprotection efficiency.

As a result show, except PBS control group (control), first immunisation and booster immunization rSC0011 (pS-SaoA), The serum antibody IgG of the anti-SaoA that the mouse that rSC0012 (pS-SaoA) is organized produces is significantly higher than immune rSC0018 (pS- SaoA) the serum antibody IgG of the anti-SaoA of strain（Such as Figure 24, * *, P ＜ 0.01）；The mouse of each immune group produces anti-hog cholera The IgG antibody of salmonella outer membrane protein OMPs, and after booster immunization, antibody horizontal is dramatically increased, each group no significant difference（Such as Shown in Figure 25）；It is anti-that the mouse that first immunisation and booster immunization rSC0011 (pS-SaoA), rSC0012 (pS-SaoA) are organized produces Mucosa-immune antibody I gA of SaoA is all significantly higher than the mucosa-immune antibody of the anti-SaoA of immune rSC0018 (pS-SaoA) strain IgA（Such as Figure 26, * *, P ＜ 0.01）；The 3rd week after head exempts from, the anti-SaoA that the mouse that immune rSC0012 (pS-SaoA) is organized produces Mucosa-immune antibody I gA be significantly higher than immune rSC0011 (pS-SaoA) strain anti-SaoA mucosa-immune antibody I gA（As schemed 26, * *, P ＜ 0.01）But, to after booster immunization 2 weeks, mouse and immunity rSC0011 that immune rSC0012 (pS-SaoA) is organized (pS-SaoA) mucosa-immune antibody I gA of the anti-SaoA that the mouse organized produces is not different（As shown in figure 26）.

Cytokines measurement result shows, rSC0011 (pS-SaoA) and rSC0012 (pS-SaoA) immune group lungs and In spleen, the concentration of cell factor IFN-γ and IL-4 is all remarkably higher than rSC0018 (pS-SaoA) immune group（Such as Figure 27,28 institutes Show, * *, P ＜ 0.01）.In rSC0011 (pS-SaoA) immune group lungs and spleen, IFN-γ level is all remarkably higher than rSC0012 (pS-SaoA)（Figure 27, *, P ＜ 0.05）, and IL-4 levels are notable in rSC0012 (pS-SaoA) immune group lungs and spleen Higher than rSC0011 (pS-SaoA) immune group（Figure 28, *, P ＜ 0.05；*, P ＜ 0.01）, show containing delay attenuationfurMutation Than containing delay attenuationcrpThe Salmonella choleraesuls attenuated carrier of mutation can induce more preferable humoral immunity level should Answer.

2 weeks after booster immunization, by lumbar injection, SS2 is carried out to experimental mouse attacks poison.As a result show, in rSC0011 (pS- SaoA) inoculation group, 5 × LD of Jing₅₀, or 15 × LD₅₀Streptococcus suis 2-type bacterium attack poison after, in the 96h after poison is attacked, There is the fur of some animals fluffy and disorderly, but subsequently recover normal, after 28 days, the survival rate of experiment mice is 100% to Continuous Observation（See Following table：Difference attacks protective efficacy comparison sheet of the vaccine to 6 week old BABL/C mouse under toxic agent amount）.At rSC0012 (pS-SaoA) Inoculation group, with 5 × LD₅₀SS2 attack poison after, Continuous Observation 28d, mouse show as health, and survival rate is 100%；And when with 15 × LD₅₀Streptococcus suis 2-type bacterium attack poison after, some animals spiritedness is dispirited, the 5d after poison is attacked, and has 2/20 dead mouse, mouse Survival rate is 90%；In rSC0018 (pS-SaoA) inoculation group, with 5 × LD₅₀SS2 attack poison after, the 3d after poison is attacked has 6/20 Dead mouse, Continuous Observation 28d, survival rate are 30%；And work as with 15 × LD₅₀SS2 attack poison after, mouse is One's spirits are drooping, is attacking 5d after poison, all dead mouses, mouse survival rate are 0%；And empty carrier group rSC0011（pYA3493）、rSC0012 （pYA3493）、rSC0018（pYA3493）And PBS control group, all dead mouses in 96 hours after poison is attacked.As a result show （It is shown in Table 4）, can the higher HI of inducing mouse generation after rSC0012 (pS-SaoA) booster immunization（IL-4）.

Difference attacks protective efficacy comparison sheet of the vaccine to 6 week old BABL/C mouse under toxic agent amount：

**：With the comparison of PBS immune groups and empty carrier immune group, significant difference.

2nd, Salmonella choleraesuls attenuated strain rSC0012 (pS-SaoA) of exogenous antigen are carried in 21d BALB/c mouses Immune protective experiment：

To detect that rSC0012, rSC0011 and rSC0018 deliver Streptococcus suis SaoA albumen in young mouse Immune inducing in vivo immunogenicity Difference, this enforcement compares and existed with rSC0012 (pS-SaoA), rSC0011 (pS-SaoA) and rSC0018 (pS-SaoA) strain Immune response in 21d mouse.This experiment is repeated 2 times, and experimental result is the synthesis of 2 results.

Specific implementation method is with Salmonella choleraesuls attenuated strain rSC0012 (pS-SaoA) of carrying exogenous antigen at 6 weeks The immune protective experiment of age BALB/c mouse, difference is the BALB/c mouse that animal used as test uses 21 ages in days.As a result show, remove PBS control group（control）, first immunisation and booster immunization rSC0011 (pS-SaoA), rSC0012 (pS-SaoA) are organized The serum antibody IgG of the anti-SaoA that mouse produces is significantly higher than the serum of the anti-SaoA of immune rSC0018 (pS-SaoA) strain and resists Body IgG（Figure 29, *, P ＜ 0.05；*, P ＜ 0.01）, and head exempts from the anti-of the mouse generation that rear rSC0012 (pS-SaoA) is organized The serum antibody IgG of SaoA is significantly higher than the serum antibody IgG of the anti-SaoA of immune rSC0011 (pS-SaoA) strain（Figure 29, *, P ＜ 0.05）；The mouse of each immune group produces the IgG antibody of anti-Salmonella choleraesuls outer membrane protein OMPs, and booster immunization Antibody horizontal is dramatically increased afterwards, each group no significant difference（Figure 30）；First immunisation and booster immunization rSC0011 (pS-SaoA), Mucosa-immune antibody I gA of the anti-SaoA that the mouse that rSC0012 (pS-SaoA) is organized produces all is significantly higher than immune rSC0018 (pS-SaoA) mucosa-immune antibody I gA of the anti-SaoA of strain（Figure 31, * *, P ＜ 0.01）；After first immunisation and booster immunization, exempt from Mucosa-immune antibody I gA of the anti-SaoA that the mouse that epidemic disease rSC0012 (pS-SaoA) is organized produces is all remarkably higher than immune rSC0011 (pS-SaoA) mucosa-immune antibody I gA of the anti-SaoA of strain（Figure 31, * *, P ＜ 0.01）, show in 21d BALB/c mouses, DisappearancefurThe Salmonella choleraesuls attenuated strain of gene is than disappearancecrpThe attenuated strain of gene can induce more powerful mucous membrane and exempt from Epidemic disease response.

Cytokines measurement result shows, rSC0011 (pS-SaoA) and rSC0012 (pS-SaoA) immune group lungs and In spleen, the concentration of cell factor IFN-γ and IL-4 is all remarkably higher than rSC0018 (pS-SaoA) immune group（Such as Figure 32, 33, * *, P ＜ 0.01）.In rSC0011 (pS-SaoA) immune group lungs and spleen IFN-γ level with immune rSC0012 (pS-SaoA) group is not significantly different from（See Figure 32）, and IL-4 levels in rSC0012 (pS-SaoA) immune group lungs and spleen It is all remarkably higher than rSC0011 (pS-SaoA) immune group（Figure 33, * *, P ＜ 0.01）, show, in 21d mouse, to subtract containing delay PoisonfurMutation is than containing delay attenuationcrpThe Salmonella choleraesuls attenuated carrier of mutation can induce more preferable body fluid and exempt from Epidemic disease level response.

2 weeks after booster immunization, by lumbar injection, SS2 is carried out to experimental mouse attacks poison.As a result show, in rSC0011 (pS-SaoA) inoculation group, 10 × LD of Jing₅₀, or 15 × LD₅₀SS2 bacterium attack poison after, in the 96h after poison is attacked, have part little The fur of mouse is fluffy and disorderly, but subsequently recovers normal, and after 28 days, the survival rate of experiment mice is 100% to Continuous Observation（See the table below：It is different Attack protective efficacy contrast table of the vaccine to 21 age in days BABL/C mouse under toxic agent amount）.In rSC0012 (pS-SaoA) inoculation group, use 10×LD₅₀SS2 attack poison after, Continuous Observation 28d, mouse show as health, and survival rate is 100%；And work as with 15 × LD₅₀Pig After 2 type bacterium of streptococcus attacks poison, some animals spiritedness is dispirited, the 5d after poison is attacked, and has 2/20 dead mouse, and mouse survival rate is 90%；And empty carrier group rSC0011（pYA3493）、rSC0012（pYA3493）Test and blank control group are 96 little after poison is attacked When interior all dead mouses.As a result show, with 10 × LD₅₀After the SS2 of dosage attacks poison, immune rSC0012 (pS-SaoA) with The protective efficacy that rSC0011 (pS-SaoA) is provided is identical；When after attacking toxic agent amount of SS2 of increasing, immune rSC0012 (pS-SaoA) The protective efficacy of offer to be slightly less than the protective efficacy that rSC0011 (pS-SaoA) is provided, but the two is not significantly different from.

Difference attacks protective efficacy contrast table of the vaccine to 21 age in days BABL/C mouse under toxic agent amount：

**：With the comparison of PBS immune groups and empty carrier immune group, significant difference.

In sum, the application is using the virulence gene for postponing attenuation Salmonella choleraesulsfurMethod, successfully obtain Obtained one plant of Salmonella choleraesuls attenuated strain rSC0012（C78-3 ΔmanA ΔrelA::araC P_BAD lacI TTΔ P_fur33::TT araC P_BAD fur ΔasdA）.Zoopery proves that the attenuated strain rSC0012 of the application is little in BALB/c LD on mouse₅₀Than attenuated strain rSC0011（ΔmanA, Δ P_crp::TT araCP_BAD crp, ΔrelA::araC P_BAD lacI TT, ΔasdA）It is low 7.9 times, it is lower than existing Salmonella choleraesuls attenuated vaccine type strain 4.2 times, and compare wild-type bacteria C78-3 is low by 5 × 10 for strain⁵Times；As a result show, under the attenuated strain of homologous genes background,furPostpone disappearance bacterial strain thancrpThe Strain Virulence for postponing disappearance is low 7.9 times.Show in the field planting experimental result of 6 week old BALB/c mouses, after inoculating strain Colonization ability of 28d, the rSC0012 strain in Yi Ershi lymph nodules are sent is not shown with the colonization ability of attenuated strain rSC0011 strains Write difference；And the field planting experimental result in 21d BALB/c mouses shows, the 7d after inoculating strain, rSC0012 strains are sending Ilyushin Colonization ability in lymph nodule is lower than attenuated strain rSC0011 strains 6 times, and the time that bacterium is removed in liver and spleen significantly carries It is front to 7d is inoculated with, on the contrary in inoculating strain 21d, be inoculated with rSC0011 strains 6 week old and 21d BALB/c mouses liver and spleen Salmonella can be separated in dirty；Prove arabinose regulation and controlfurThe virulence of the strain of gene delection be substantially less than Ah Draw uncle's sugar regulation and controlcrpThe virulence of the strain of gene delection.Animal protection experimental result shows, carries streptococcus suis 2-type SaoA albumenfurGene-deletion attenuated strain rSC0012 (pS-SaoA) strains the BALB/c mouse of 6 week old 21d lungs and In spleen, more preferable HI level can be induced, while very high protective efficacy can be obtained.

<110>Yangzhou University

<120>A kind of Salmonella choleraesuls attenuated carrier bacterium and its construction method based on fur genes

<160> 15

<210> 1

<211> 34

<212> DNA

<213>Artificial sequence

<400> 1

acatgcatgc tgtgactggg atgacttctt cccg

<210> 2

<211> 32

<212> DNA

<213>Artificial sequence

<400> 2

tgcgagctcg tgtaaatctt tcgaagagcc aa

<210> 3

<211> 30

<212> DNA

<213>Artificial sequence

<400> 3

aagctcgaga gtcatgcgga atctgtcctg

<210> 4

<211> 31

<212> DNA

<213>Artificial sequence

<400> 4

tcccccgggc acttttccgc aatcaaggca g

<210> 5

<211> 54

<212> DNA

<213>Artificial sequence

<400> 5

cctggtacct aggcctctag ataaataaaa gcagtttaca actcctagaa ttgt

<210> 6

<211> 34

<212> DNA

<213>Artificial sequence

<400> 6

agaggtaccc tcgaggctag cccaaaaaaa cggg

<210> 7

<211> 32

<212> DNA

<213>Artificial sequence

<400> 7

ggggagctcc gctggtagtt ttgataactt aa

<210> 8

<211> 33

<212> DNA

<213>Artificial sequence

<400> 8

gggggtacct acggcgacgg acacatgttc gct

<210> 9

<211> 39

<212> DNA

<213>Artificial sequence

<400> 9

cccaagcttg agctcgaggg cgttccggcg ctggtagaa

<210> 10

<211> 31

<212> DNA

<213>Artificial sequence

<400> 10

cgggtacccc agatattttc cagatcttca c

<210> 11

<211> 34

<212> DNA

<213>Artificial sequence

<400> 11

acatgcatgc tgtgactggg atgacttctt cccg

<210> 12

<211> 31

<212> DNA

<213>Artificial sequence

<400> 12

tcccccgggc acttttccgc aatcaaggca g

<210> 13

<211> 30

<212> DNA

<213>Artificial sequence

<400> 13

tgctctagat gtgcatggca atcgcccaac

<210> 14

<211> 30

<212> DNA

<213>Artificial sequence

<400> 14

tcccccgggt atctgcgtcg tcctaccttc

<210> 15

<211> 789

<212> DNA

<213>Artificial synthesized SaoA fragments

<400> 15

ggatcccaac ctgatggggg acaggctact tcaaaggcgg ttaatgtcaa aataccagca 60

gtagtacgac tatttggtcg tgagcttcta gaaaatgaat ttaaatttga gcttagagaa 120

gcgaatggcg aggaactccc tgtccttgat acagctcaaa atacaaaaga gggtcaagtt 180

agatttaaaa atctatcatt cgataagcct ggcaaatact ggtatacaat ttcagaagta 240

aaagatgagc ttggtggtat tgagtatgat tcgaaatata ttgtagcaaa aataactgta 300

gaagatcgaa acgggcaatt acaggcaatg atcgaattta ttgataatga caatgtcttt 360

aacaatttct atacacctgc tccagctgct gctagtcttt cgataaaaaa agtcctcgag 420

ggacgtacct taaacaccgg tgaattcgaa tttgttttaa aaaatgaaaa aggcgatgaa 480

atcgaaaagg taagcaatca agcagatggt tctgtaaact ttagtgccct aacatttaca 540

aaagagggaa cctataccta cactgtttca gaagttgatg gtggacttgg cgatattatc 600

tatgacaaat cagatattaa ggccactgtt actgtgaaag ataacaatca cggacaacta 660

gtctcaacag tgacttatga aaatagcgat caaatcttcg agaatatttt gaatcctggg 720

aagttaatag cgccaaccac ggatagcgtt attactgata atgaagtctc taaggaagca 780

ctggtcgac

<110>Yangzhou University

<120>A kind of Salmonella choleraesuls attenuated carrier bacterium and its construction method based on fur genes

<160> 15

<210> 1

<211> 34

<212> DNA

<213>Artificial sequence

<400> 1

acatgcatgc tgtgactggg atgacttctt cccg

<210> 2

<211> 32

<212> DNA

<213>Artificial sequence

<400> 2

tgcgagctcg tgtaaatctt tcgaagagcc aa

<210> 3

<211> 30

<212> DNA

<213>Artificial sequence

<400> 3

aagctcgaga gtcatgcgga atctgtcctg

<210> 4

<211> 31

<212> DNA

<213>Artificial sequence

<400> 4

tcccccgggc acttttccgc aatcaaggca g

<210> 5

<211> 54

<212> DNA

<213>Artificial sequence

<400> 5

cctggtacct aggcctctag ataaataaaa gcagtttaca actcctagaa ttgt

<210> 6

<211> 34

<212> DNA

<213>Artificial sequence

<400> 6

agaggtaccc tcgaggctag cccaaaaaaa cggg

<210> 7

<211> 32

<212> DNA

<213>Artificial sequence

<400> 7

ggggagctcc gctggtagtt ttgataactt aa

<210> 8

<211> 33

<212> DNA

<213>Artificial sequence

<400> 8

gggggtacct acggcgacgg acacatgttc gct

<210> 9

<211> 39

<212> DNA

<213>Artificial sequence

<400> 9

cccaagcttg agctcgaggg cgttccggcg ctggtagaa

<210> 10

<211> 31

<212> DNA

<213>Artificial sequence

<400> 10

cgggtacccc agatattttc cagatcttca c

<210> 11

<211> 34

<212> DNA

<213>Artificial sequence

<400> 11

acatgcatgc tgtgactggg atgacttctt cccg

<210> 12

<211> 31

<212> DNA

<213>Artificial sequence

<400> 12

tcccccgggc acttttccgc aatcaaggca g

<210> 13

<211> 30

<212> DNA

<213>Artificial sequence

<400> 13

tgctctagat gtgcatggca atcgcccaac

<210> 14

<211> 30

<212> DNA

<213>Artificial sequence

<400> 14

tcccccgggt atctgcgtcg tcctaccttc

<210> 15

<211> 789

<212> DNA

<213>Artificial synthesized SaoA fragments

<400> 15

ggatcccaac ctgatggggg acaggctact tcaaaggcgg ttaatgtcaa aataccagca 60

gtagtacgac tatttggtcg tgagcttcta gaaaatgaat ttaaatttga gcttagagaa 120

gcgaatggcg aggaactccc tgtccttgat acagctcaaa atacaaaaga gggtcaagtt 180

agatttaaaa atctatcatt cgataagcct ggcaaatact ggtatacaat ttcagaagta 240

aaagatgagc ttggtggtat tgagtatgat tcgaaatata ttgtagcaaa aataactgta 300

gaagatcgaa acgggcaatt acaggcaatg atcgaattta ttgataatga caatgtcttt 360

aacaatttct atacacctgc tccagctgct gctagtcttt cgataaaaaa agtcctcgag 420

ggacgtacct taaacaccgg tgaattcgaa tttgttttaa aaaatgaaaa aggcgatgaa 480

atcgaaaagg taagcaatca agcagatggt tctgtaaact ttagtgccct aacatttaca 540

aaagagggaa cctataccta cactgtttca gaagttgatg gtggacttgg cgatattatc 600

tatgacaaat cagatattaa ggccactgtt actgtgaaag ataacaatca cggacaacta 660

gtctcaacag tgacttatga aaatagcgat caaatcttcg agaatatttt gaatcctggg 720

aagttaatag cgccaaccac ggatagcgtt attactgata atgaagtctc taaggaagca 780

ctggtcgac

Claims (2)

1. a kind of Salmonella choleraesuls attenuated carrier bacterium based on fur genes, it is characterised in that the Salmonella choleraesuls Attenuated carrier bacterium is missing from ΔmanA、ΔP_fur::TT araC P_BAD fur、ΔrelA::araC P_BAD lacI TT and ΔasdA The C78-3 Salmonella choleraesuls of four kinds of genes.

2. as claimed in claim 1 based on fur genes Salmonella choleraesuls attenuated carrier bacterium construction method, its feature exists In comprising the following steps：

1）BuildfurInsert in the promoter of virulence genearaC P_BADThe suicide vector of structure：

To be attenuated Salmonella choleraesuls C78-3 as template, carried out using primer P1 and P2, P3 and P4 and P5 and P6 respectively After PCR amplifications, amplified production fragment 1, fragment 2 and fragment 3 are obtained, fragment 1 is connected with fragment 3 and fragment 2 successively, produced ΔP_fur::TT araC P_BAD fur Structure sequence；Again by Δ P_fur::TT araC P_BAD fur Structure sequence is connected to suicide and carries Body pRE112, obtains suicide vector plasmid；Then suicide vector plasmid is converted into Escherichia coli χ 7213, is obtainedfurVirulence Insert in the promoter of genearaC P_BADThe suicide vector of structure；

The nucleotide sequence difference of described primer P1, P2, P3, P4, P5 and P6 is as follows：

P1：5’-ACATGCATGCTGTGACTGGGATGACTTCTTCCCG- 3’；

P2：5’-TGCGAGCTCGTGTAAATCTTTCGAAGAGCCAA- 3’；

P3：5’-AAGCTCGAGAGTCATGCGGAATCTGTCCTG- 3’；

P4：5’-TCCCCCGGGCACTTTTCCGCAATCAAGGCAG- 3’；

P5：5’-CCTGGTACCTAGGCCTCTAGATAAATAAAAGCAGTTTACAACTCCTAGAATTGT- 3’；

P6：5’-AGAGGTACCCTCGAGGCTAGCCCAAAAAAACGGG- 3’；

2）Build attenuation Salmonella choleraesuls rSC0008：

Insertion mutation Δ is distinguished in Salmonella choleraesuls C78-3manAAnd ΔrelA::araC P_BAD lacITT, must be attenuated Salmonella choleraesuls rSC0008；

3）Build rSC0009 mutant strains：

Attenuation Salmonella choleraesuls rSC0008 is introduced into describedfurInsert in the promoter of virulence genearaC P_BADStructure Suicide vector, obtain rSC0009 mutant strains；

4）Build the Salmonella choleraesuls attenuated carrier bacterium based on fur genes：

Δ will be introduced in rSC0009 mutant strainsasd Mutator, obtains the Salmonella choleraesuls attenuated carrier based on fur genes Bacterium.