CN106519022A - Recombinant bovine lactoferricin derived peptide, and preparation method and applications thereof - Google Patents
Recombinant bovine lactoferricin derived peptide, and preparation method and applications thereof Download PDFInfo
- Publication number
- CN106519022A CN106519022A CN201611007504.1A CN201611007504A CN106519022A CN 106519022 A CN106519022 A CN 106519022A CN 201611007504 A CN201611007504 A CN 201611007504A CN 106519022 A CN106519022 A CN 106519022A
- Authority
- CN
- China
- Prior art keywords
- derived peptide
- recombinant
- lactoferricin
- lfcinbd
- peptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/79—Transferrins, e.g. lactoferrins, ovotransferrins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Abstract
The invention provides a recombinant bovine lactoferricin derived peptide. The amino acid sequence of the recombinant bovine lactoferricin derived peptide is disclosed in SEQ ID NO:1. The antibacterial activity of the recombinant bovine lactoferricin derived peptide is obviously higher than that of bovine lactoferricin, and the recombinant bovine lactoferricin derived peptide possesses excellent inhibition effect on staphylococcus, and is promising in market prospect.
Description
Technical field
The invention belongs to genetic engineering field, and in particular to a kind of recombined Lactoferricin B derived peptide and preparation method thereof
And purposes.
Background technology
It is 25 amino acid residues positioned at bovine lactoferrin (LfB) N- tip lengths that Bovine lactoferricin (LfcinB) is
(amino acid sequence is cationic antibacterial peptide：FKCRRWQWRMKKLGAPSITCVRRAF), produced by Pepsin degradation, had
Different physiological roles, such as broad spectrum antibacterial, antiviral, antitumor, immunological regulation etc., and LfcinB is not likely to produce the resistance to the action of a drug,
Have broad application prospects in fields such as food, medicine, animal feeds.
From the 20th century 80, nineties so far, Bovine lactoferricin is always the focus of researchers' concern, and researcher attempts
By the bacteriostatic activity for improving LfcinB, to obtain new antibiotic substitute.Using means be mostly that LfcinB is heterologous
Expression is active to improve which.Also having in addition carry out structure optimization to LfcinB and ground with obtaining active preferably LfcinB derived peptides
Study carefully, only because the replacement of any one amino acid may all change the space structure of LfcinB peptide chains, so as to change its property
Matter, or even reduce its activity.How to obtain the LfcinB derived peptides with high bacteriostatic activity by structure of modification is to be badly in need of at present
The problem of solution.
The content of the invention
It is an object of the invention to provide a kind of recombined Lactoferricin B derived peptide (LfcinBD) and preparation method thereof and
Purposes.
The invention provides a kind of recombined Lactoferricin B derived peptide, its amino acid sequence such as SEQ ID NO：1 institute
Show.
SEQ ID NO：The amino acid sequence of 1 Bovine lactoferricin derived peptide, sequence is：
FKCRRWQWRWKKLGAPSITCVRRAF。
Present invention also offers a kind of nucleotide sequence of Bovine lactoferricin derived peptide, it encodes SEQ ID NO：1 institute
The amino acid sequence for showing.
Wherein, its sequence such as SEQ ID NO：Shown in 2.
SEQ ID NO：The nucleotide sequence of 2 Bovine lactoferricin derived peptides, sequence is：TTC AAG TGC AGA AGA
TGG CAG TGG AGA TGGAAG AAG TTG GGT GCT CCA TCT ATC ACC TGC GTT AGA AGA GCT
TTC。
Present invention also offers a kind of recombinant vector, it includes above-mentioned nucleotide sequence.
Wherein, described recombinant vector is restructuring pPIC9K plasmids.
Present invention also offers a kind of recombinant bacterium, it includes above-mentioned recombinant vector.
Wherein, described recombinant bacterium is recombinant yeast；
Preferably, the recombinant yeast is restructuring Pichia yeast GS115.
Present invention also offers a kind of method for preparing above-mentioned recombined Lactoferricin B derived peptide, comprises the steps of：
A, above-mentioned recombinant bacterium is taken, be inoculated on BMGY culture mediums, 30 DEG C, 200r/min shaken cultivations to OD600 are 2.5
When, centrifugation takes precipitation；
B, add BMGY culture mediums in the precipitation of step a, it is resuspended, methyl alcohol is added, and methyl alcohol is dense eventually in keeping culture medium
Spend for 0.5-2% (V/V), Fiber differentiation 72 hours；
C, centrifugation, collect supernatant, isolate and purify, you can.
Present invention also offers purposes of the above-mentioned recombined Lactoferricin B derived peptide in bacteriostatic agent is prepared.
Wherein, the bacteriostatic agent is the staphylococcic preparation of suppression；Further, the staphylococcus is golden yellow grape
Coccus.
The present invention is tied to LfcinBD using bioinformatics tools, antibacterial peptide database and Protein analysis software etc.
Structure optimization design, and new antibacterial peptide LfcinBD gene orders, the sequence quilt are synthesized according to Pichia pastoris preference codon characteristic
Carrier for expression of eukaryon pPIC9K construction recombination plasmids are cloned into, are expressed in electricity conversion Pichia pastoris GS115, screening is contained
The positive Pichia yeast of LfcinBD genes, optimizes positive transformant fermentation condition, obtains the high efficient expression of the derived peptide.
Recombined Lactoferricin B derived peptide (LfcinBD) energy in Pichia pastoris that the present invention is obtained through Optimizing Reconstruction
Enough effective expressions, the fermented supernatant fluid through isolating and purifying have very strong bacteriostasis, bacteriostatic activity to staphylococcus aureus
The Bovine lactoferricin mother's peptide being significantly better than under equal fermentation condition, good market prospects.
Obviously, the above of the invention, according to the ordinary technical knowledge and customary means of this area, without departing from
Under the premise of the above-mentioned basic fundamental thought of the present invention, the modification of other various ways can also be made, is replaced or is changed.
The specific embodiment of form, remakes further specifically to the above of the present invention by the following examples
It is bright.But this scope for being interpreted as above-mentioned theme of the invention should not be only limitted to Examples below.It is all based on the above of the present invention
The technology realized belongs to the scope of the present invention.
Description of the drawings
Fig. 1 is antibacterial peptide Bovine lactoferricin derived peptide LfcinBD gene chemical synthesis sequence chart.
Fig. 2 is plasmid vector pPIC9K physical maps.
Structure flow charts of the Fig. 3 for antibacterial peptide Bovine lactoferricin derived peptide LfcinBD yeast recombinant expression carrier.
Fig. 4 is identified for the PCR of recombinant plasmid vector pPIC9K-LfcinBD, in figure：M is DNA Marker；1st, 2 is with sky
Amplified productions of the plasmid vector pPIC9K for template；3rd, 4 is the amplified production of pPIC9K-LfcinBD recombinant vectors.
Fig. 5 is the PCR identifications of restructuring yeast transformant genome, and M is DNA Marker；1 is empty yeast strain GS115 bases
Because of a group pcr amplification product, 2 to convert the Yeast genome pcr amplification product of empty plasmid pPIC9K, and 3-12 is restructuring yeast strains
Genomic PCR amplification product.
Fig. 6 is bacteriostatic experiment result of antibacterial peptide Bovine lactoferricin derived peptide LfcinBD to staphylococcus aureus, is schemed
In：Figure center positive control is the bacteriostatic activity of 10 μ L 100mg/mL ampicillin Amp；Numbering 29,30 is negative control,
The bacteriostatic activity of GS115 empty bacterium strain fermented supernatant fluids, after remaining numbering is positive pichia pastoris engineered strain induction 72h, sends out
The bacteriostatic activity of the Bovine lactoferricin derived peptide expressed in ferment supernatant.
SDS-PAGE testing results of the Fig. 7 for antibacterial peptide Bovine lactoferricin derived peptide LfcinBD.In figure：M is albumen
Marker；1 is LfcinB fermented supernatant fluids；2 is LfcinBD fermented supernatant fluids.
Fig. 8 is antibacterial peptide Bovine lactoferricin derived peptide LfcinBD and female peptide Bovine lactoferricin LfcinB to golden yellow
Staphylococcic bacteriostatic activity comparing result, in figure：1st, 2 is the bacteriostatic activity of LfcinB fermented supernatant fluids, and 3,4 is LfcinBD
The bacteriostatic activity of fermented supernatant fluid.
Specific embodiment
It is described further with embodiment below, but the present invention is not limited to these embodiments.
Experiment reagent used by the present invention is as follows：Plasmid Midi Kit are purchased from QIAGEN；DNA Purification
Kit is purchased from Invitrogen；TIANamp Yeast DNA Kit pastoris genomic dnas extracts kit is purchased from TIANGEN；Ammonia
Parasiticin, LB culture mediums, agarose, EcoR I and Not I restriction enzymes, 10X Buffer, TangoTM, 6X DNA
Loading Buffer, 100bP and 1k bpDNA Ladder, dd water, SanPrep pillar DNA glue reclaim kit,
SanPrep pillar DNA extraction agent boxes, EcoR I and Not I restriction enzymes；T4 DNA ligases；2X Taq
PCR buffer；Plasmid vector pPIC9K；Ammonia section penicillin A mp, Ezup pillar pastoris genomic dna extraction agent box, it is biological
Plain (Biotin), 2X Taq PCR Master Mix (PCR reaction reagents), Sac I restriction enzymes are purchased from raw work (Shanghai)
Biological Co., Ltd；Without amino yeast nitrogen (YNB) purchased from Beijing Baeyer enlightening biotech firm；Yeast extract (Yeast extract),
Peptone (C Peptone) is purchased from OXOID companies；Glucose, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, D-sorbite, agar powder,
The biochemical reagents such as methyl alcohol, 75% ethanol, glacial acetic acid are purchased from East China Hua Bo Co., Ltds.
Experimental facilities is as follows：
Superclean bench (SuZhou Antai Air Tech Co., Ltd., S W-CJ are serial)
Constant-temperature table (Shanghai Fuma Experiment Equipment Co., Ltd., QYC200 types)
Stainless steel pressure steam sterilizer (Shanghai Sanshen Medical Instrument Co., Ltd., portable)
PH meters (one support benefit Instrument Ltd. of Shanghai plum Teller, FE-200 are serial)
Magnetic stirring apparatus (Shanghai Sanshen Medical Instrument Co., Ltd., YX208A are serial)
Mold incubator (Shanghai Yiheng Scientific Instruments Co., Ltd, BPMJ-250E are serial)
Water bath with thermostatic control incubator (Taicang Qiang Le experimental facilities Co., Ltd, LSHZ-300 are serial)
Small-sized high speed centrifugal machine (German Eppendorf Products Co., Ltd, 54188 types of Eppendorf)
DNA level electrophoresis apparatus (Bio-Rad life medical products Co., Ltd, 1645050 types)
Albumen vertical electrophoresis apparatus (Bio-Rad life medical products Co., Ltd, GY-107722 types)
Table-type high-speed refrigerated centrifuge (Hunan Hunan instrument, H1850R)
Electric conversion instrument Gene-Pulser Xcell (U.S. Bio-Rad life medical products Co., Ltd)
Protein electrophoresis instrument Mini-PROTEAN.3Cell) (U.S. Bio-Rad life medical products Co., Ltd.
It is the preparation of 1 Bovine lactoferricin derived peptide LfcinBD recombinant bacterium of the present invention of embodiment and the expression of LfcinBD, pure
Change
Step is as follows：
1. the synthesis of derivative peptide gene LfcinBD of Bovine lactoferricin
According to the characteristic of Pichia pastoris preference codon, the derivative peptide gene of antibacterial peptide Bovine lactoferricin is optimized and is set
Meter, and in the end of gene 3 ' and 5 ' addition I sequence of EcoR I and Not, the gene chemical synthesis sequence is as shown in figure 1, sequence is by biotech firm
Synthesis.
2. the structure of recombinant expression carrier pPIC9K-LfcinBD
By derivative peptide gene LfcinBD and Expression vector pPIC9K (pPIC9K physical maps are as shown in Figure 2) I Hes of Jing EcoR
After I double digestions of Not, derivative peptide gene LfcinBD and plasmid pPIC9K are attached with T4DNA ligases, build pPIC9K-
LfcinBD recombinant plasmids, as shown in figure 3, by recombinant plasmid transformed bacillus coli DH 5 alpha.
Transformant is selected on the LB solid mediums containing ampicillin, extracting recombinant plasmid dna carries out 5 ' AOX I
I primer PCRs of the AOX of primer/3 ' are expanded,
Wherein：I primer sequences of `AOX are as follows：
I primers of 5`AOX (SEQ ID NO：3):5`—CGACTGGTTCCAATTGACAAGC—3`；
I primers of 3`AOX (SEQ ID NO：4):5`—GCAAATGGCATTCTGACATCC—3`；
Amplification is as shown in Figure 4.
Derivative peptide gene LfcinBD is determined further across sequencing identification completely the same with implementation sequence.
3. I linearization for enzyme restriction of Sac of recombinant expression carrier pPIC9K-LfcinBD
Correct recombinant vector pPIC9K-LfcinBD is sequenced Jing after I linearization for enzyme restriction of Sac, is 3M with 1/10 volumetric concentration
SAS and the absolute ethyl alcohol of 2.5 times of volumes precipitate linearizing recombinant DNA, 10000r/min centrifugation 15min are discarded
Supernatant, washs precipitation with 70% ethanol, and 10000r/min centrifugation 3min, room temperature place a moment to dry precipitation.Finally plus
Enter the deionized water dissolving DNA precipitations of 10 μ L, convert Pichia pastoris immediately or save backup in -20 DEG C.
4. electricity converts Pichia pastoris GS115 cell
The recombinant plasmid pPIC9K-LfcinBD competence yeast cells of 80 μ L fresh preparation linearizing with 10 μ L is mixed
Proceed to after closing uniformly in the electric revolving cup of ice precooling, 1500V is electroporated, take the appropriate bacterium solution and be coated with MD flat boards, in 30 DEG C of constant temperature
Culture is until bacterium colony grows.Picking single bacterium colony is coated G418 concentration and is respectively 0.5,1.0,1.5,2.0,2.5,3.0mg/mL
On YPD flat boards, to screen high copy transformant, the amplification of 5 ' AOX, I AOX of primer/3 ', I primer PCRs is carried out to transformant single bacterium colony,
As a result as shown in figure 5, recombinant expression carrier is successfully proceeded in Pichia pastoris GS115 bacterial strain, successfully obtain Bovine lactoferricin and spread out
Raw peptide (LfcinBD) recombinant bacterium.
5. the measure of derived peptide LfcinBD antibiotic property
The transformant single bacterium colony that the positive is accredited as from picking PCR on YPD flat boards of the G418 concentration for 2.0mg/mL is inoculated in
In 25mL glycerol complex medium BMGY nutrient solutions, 30 DEG C, 200r/min shaken cultivations to OD600 are centrifuged for 2.5,3000g, are abandoned
Supernatant, adds the resuspended thalline of 25mL BMMY fluid nutrient mediums, 0.5% methanol induction culture 72h, 12000rpm centrifugation 10min to receive
Collection fermented supernatant fluid, detects for bacteriostatic activity.
From one bacterium colony of picking on the staphylococcus aureus fresh culture cultivated, 10mL LB nutrient solutions are inoculated in
In, 37 DEG C, 200r/min is cultivated to OD560=0.3-0.5.Liquid-transfering gun draws the above-mentioned fresh bacterium solutions of 10 μ L, adds the LB of sterilizing
In solid medium, mixing is poured in culture dish.Punched with card punch after to be solidified, per the tunning of 10 μ L of hole point sample,
With 10 μ L, the ampicillin of 100mg/mL does positive control, does negative control with empty yeast GS115 strain fermentation supernatants.
37 DEG C of overnight incubations in constant incubator are placed in, the bacteriostatic activity of fermented supernatant fluid is observed.As a result as shown in fig. 6, showing that this spreads out
Raw peptide has good bacteriostatic activity.
6. the SDS-PAGE detections of derived peptide LfcinBD
The zymocyte liquid of derived peptide LfcinBD is taken, 12000rpm centrifugation 10min collect supernatant, supernatant Jing TCA precipitations
Afterwards, SDS-PAGE detects the effective expression of target protein derived peptide LfcinBD.
Wherein, TCA settling steps are as follows：
1) the reverse mixings of 100 μ L 100%TCA are added in 900 μ L fermented supernatant fluids, ice bath is overnight；
2) at 4 DEG C of next day, 12000rpm centrifugations 15min, abandons supernatant；
3) it is resuspended to be deposited in the ice-cold pyruvic acid of 500 μ L, gently mix；
4) 12000rpm centrifugations 5min, abandons supernatant, adds 500 μ L acetone, and repeated centrifugation is once；
5) it is drying precipitated.
SDS-PAGE detections are as follows：
1) Jing after TCA concentrations, albumen precipitation is dissolved in 12 μ L water fermented supernatant fluid；
2) 20 μ L sample-loading buffers are added, 95 DEG C are boiled 4min；
3) of short duration centrifugation, takes 30 μ L loading 12%SDS-PAGE glue (5% concentration glue)；
4) 80V constant pressures electrophoresis, applies voltages to 120V into after separation gel after dyestuff and continues electrophoresis；
5) dyestuff arrives at separation gel bottom, and deenergization removes separation gel；
6) dyeing 2h is carried out to which with Coomassie brilliant blue dye liquor；
7) dye liquor is changed and is reclaimed, is decolourized overnight with methyl alcohol/acetic acid destainer；
8) take a picture or preserve.
As a result substantially there is band to manifest as shown in fig. 7, being displayed near estimated 3.2KDa, indicate target protein and derive
The effective expression of peptide LfcinBD.Prove that antibiotic property derives from LfcinBD.
7. derived peptide LfcinBD is isolated and purified
The affine column separating purification LfcinBD of Ni-Agarose can be directly selected.
With Beijing CoWin Bioscience Co., Ltd. 6 × His-Tagged Protein purification Kit
(CW0894S), illustrate to obtain the derived peptide of purifying according to product description.
Beneficial effects of the present invention are illustrated below by way of test example：
The bacteriostatic activity contrasting detection of 1 antibacterial peptide Bovine lactoferricin derived peptide LfcinBD of test example
To verify whether recombined Lactoferricin B derived peptide LfcinBD is obtained relative to the bacteriostatic activity of female peptide LfcinB
Improve, by female peptide and derived peptide Yeast engineering bacterium strain under equal fermentation condition, 0.5%-2% methanol induction culture 72h, sample
Jing 12000rpm are collected by centrifugation supernatant, frozen in -70 DEG C, carry out the detection of bacteriostatic activity.
From one bacterium colony of picking on the staphylococcus aureus fresh culture cultivated, 10mL LB nutrient solutions are inoculated in
In, 37 DEG C, 200r/min is cultivated to OD560=0.3-0.5.Liquid-transfering gun is drawn the above-mentioned fresh bacterium solutions of 10 μ L and adds the LB of sterilizing solid
In body culture medium, mixing is poured in culture dish.Punched with card punch after to be solidified, per 10 μ L of hole point sample, sample is respectively mother
Peptide or derived peptide Yeast engineering bacterium strain, 0.5%-2% methanol induction culture 72h, the supernatant that 12000rpm is collected by centrifugation.It is placed in
37 DEG C of overnight incubations in constant incubator, the bacteriostatic activity for observing fermented supernatant fluid (suppress the work of staphylococcus aureus growth
Property).
As a result it is as shown in Figure 8.
As seen from Figure 8, culture dish diameter 9cm, inhibition zone (3, No. 4) the diameter difference that LfcinBD fermented supernatant fluids are produced
For 2.4cm, 2.4cm；And inhibition zone (the 1, No. 2) diameter that LfcinB fermented supernatant fluids are produced is respectively 1.4cm, 1.6cm；According to
The antibacterial gross area is calculated, and 3, No. 4 average areas are 4.52cm2, and 1, No. 2 average areas are 1.77cm2, 3, No. 4 average antibacterial faces
Product is 2.55 times of 1, No. 2 average areas, illustrates Bovine lactoferricin derived peptide LfcinBD relative to the antibacterial of female peptide LfcinB
Activity is significantly improved.
To sum up, the present invention successfully constructs LfcinBD genetic engineering bacteriums using engineered mode, and expression is obtained
Recombined Lactoferricin B derived peptide.The Bovine lactoferricin derived peptide bacteriostatic activity is strong, good market prospects.
SEQUENCE LISTING
<110>Chengdu University of Traditional Chinese Medicine
<120>A kind of recombined Lactoferricin B derived peptide and its production and use
<130> GY041-16P1505
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 25
<212> PRT
<213>The amino acid sequence of Bovine lactoferricin derived peptide
<400> 1
Phe Lys Cys Arg Arg Trp Gln Trp Arg Trp Lys Lys Leu Gly Ala Pro
1 5 10 15
Ser Ile Thr Cys Val Arg Arg Ala Phe
20 25
<210> 2
<211> 75
<212> DNA
<213>The nucleotide sequence of Bovine lactoferricin derived peptide
<400> 2
ttcaagtgca gaagatggca gtggagatgg aagaagttgg gtgctccatc tatcacctgc 60
gttagaagag ctttc 75
<210> 3
<211> 22
<212> DNA
<213>The upstream primer of AOX I
<400> 3
cgactggttc caattgacaa gc 22
<210> 4
<211> 21
<212> DNA
<213>The downstream primer of AOX I
<400> 4
gcaaatggca ttctgacatc c 21
Claims (10)
1. a kind of recombined Lactoferricin B derived peptide, it is characterised in that：Its amino acid sequence such as SEQ ID NO：Shown in 1.
2. a kind of nucleotide sequence of Bovine lactoferricin derived peptide, it is characterised in that：It encodes SEQ ID NO：Ammonia shown in 1
Base acid sequence.
3. nucleotide sequence according to claim 2, it is characterised in that：Its sequence such as SEQ ID NO：Shown in 2.
4. a kind of recombinant vector, it is characterised in that：It includes the nucleotide sequence shown in Claims 2 or 3.
5. recombinant vector according to claim 4, it is characterised in that：Described recombinant vector is restructuring pPIC9K plasmids.
6. a kind of recombinant bacterium, it is characterised in that：It includes the recombinant vector described in claim 4 or 5.
7. recombinant bacterium according to claim 6, it is characterised in that：Described recombinant bacterium is recombinant yeast；
Preferably, the recombinant yeast is restructuring Pichia yeast GS115.
8. a kind of method for preparing recombined Lactoferricin B derived peptide described in claim 1, it is characterised in that：Comprising following step
Suddenly：
A, recombinant bacterium described in claim 6 or 7 is taken, be inoculated on BMGY culture mediums, 30 DEG C, 200r/min shaken cultivations are extremely
When OD600 is 2.5, centrifugation takes precipitation；
B, add BMGY culture mediums in the precipitation of step a, it is resuspended, methyl alcohol is added, and methyl alcohol is final concentration of in keeping culture medium
0.5-2% (V/V), Fiber differentiation 72 hours；
C, centrifugation, collect supernatant, isolate and purify, you can.
9. purposes of the recombined Lactoferricin B derived peptide in bacteriostatic agent is prepared described in claim 1.
10. purposes according to claim 9, it is characterised in that：The bacteriostatic agent is the staphylococcic preparation of suppression；Enter one
Step ground, the staphylococcus are staphylococcus aureus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611007504.1A CN106519022A (en) | 2016-11-16 | 2016-11-16 | Recombinant bovine lactoferricin derived peptide, and preparation method and applications thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611007504.1A CN106519022A (en) | 2016-11-16 | 2016-11-16 | Recombinant bovine lactoferricin derived peptide, and preparation method and applications thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106519022A true CN106519022A (en) | 2017-03-22 |
Family
ID=58353326
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611007504.1A Pending CN106519022A (en) | 2016-11-16 | 2016-11-16 | Recombinant bovine lactoferricin derived peptide, and preparation method and applications thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106519022A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110028575A (en) * | 2019-04-18 | 2019-07-19 | 成都中医药大学 | A kind of preparation method of micromolecular collagen |
| CN114790237A (en) * | 2022-05-31 | 2022-07-26 | 合肥工业大学 | Antibacterial peptide and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102993296A (en) * | 2011-09-14 | 2013-03-27 | 广州格拉姆生物科技有限公司 | Bovine lactoferricin and preparation method thereof |
-
2016
- 2016-11-16 CN CN201611007504.1A patent/CN106519022A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102993296A (en) * | 2011-09-14 | 2013-03-27 | 广州格拉姆生物科技有限公司 | Bovine lactoferricin and preparation method thereof |
Non-Patent Citations (3)
| Title |
|---|
| MORTEN B. STRØM 等: "Important structural features of 15-residue lactoferricin derivatives and methods for improvement of antimicrobial activity", 《BIOCHEM. CELL BIOL.》 * |
| 易俊波 等: "抗菌肽牛乳铁多肽素(LfcinB)在毕赤酵母中的表达及活性鉴定", 《微生物学通报》 * |
| 郭东华 等: "牛乳铁蛋白肽基因(LfcinB)的合成及其在大肠杆菌中的表达", 《农业生物技术学报》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110028575A (en) * | 2019-04-18 | 2019-07-19 | 成都中医药大学 | A kind of preparation method of micromolecular collagen |
| CN110028575B (en) * | 2019-04-18 | 2022-12-30 | 成都中医药大学 | Preparation method of micromolecular collagen |
| CN114790237A (en) * | 2022-05-31 | 2022-07-26 | 合肥工业大学 | Antibacterial peptide and application thereof |
| CN114790237B (en) * | 2022-05-31 | 2024-04-05 | 合肥工业大学 | Antibacterial peptide and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101492661B (en) | Clone, expression of beta-glucosidase gene, and preparation for gentian oligose | |
| CN107502585A (en) | One plant of bacillus licheniformis engineering bacteria for efficiently synthesizing poly- γ glutamic acid | |
| CN111575310B (en) | Recombinant saccharomyces cerevisiae expressing caveolin and application thereof | |
| WO2006017960A1 (en) | A detoxifizyme having activity of transforming aflatoxin and the gene encodes thereof | |
| CN109652427A (en) | A kind of strawberry FaABCC1 transporter gene and its application | |
| CN113388625B (en) | Sugarcane top rot effect factor Fs _00548 gene and application thereof | |
| CN108085308A (en) | A kind of recombination engineering that can improve thermostable lipase yield and its construction method and application | |
| CN104788568A (en) | Pichia pastoris genetic engineering hybrid antibacterial peptide CC29 and preparing method thereof | |
| CN106519022A (en) | Recombinant bovine lactoferricin derived peptide, and preparation method and applications thereof | |
| CN115029353A (en) | Pichia pastoris for efficiently secreting and expressing recombinant human III-type collagen alpha 1 chain and fermentation process thereof | |
| CN107955067A (en) | Participate in two myb transcription factors and its application of peach flavonols biosynthetic controlling | |
| CN101450961B (en) | Artificial synthetic porcine interferon and method for preparing porcine interferon | |
| CN101638665B (en) | Construction and usage of lactobacillus single-plasmid Nisin inducible expression vector | |
| CN110791508A (en) | Codon-optimized pediocin gene, expression vector and recombinant engineering strain | |
| CN107151674A (en) | Novel antimicrobial peptide DLP4 preparation method | |
| CN105384828B (en) | Long-acting interferon-α and its remodeling method | |
| CN102898512B (en) | Recombinant plectasin as well as preparation method and application of recombinant plectasin | |
| CN107815459B (en) | Pleurotus ostreatus manganese peroxidase gene and application thereof | |
| CN110468143A (en) | The preparation method and application of antibacterial peptide NZX | |
| CN107267547A (en) | Novel antimicrobial peptide DLP2 preparation method | |
| CN115109131A (en) | Application of polyclonal antibody in preparation of microsporidian identification reagent | |
| CN108795891A (en) | A kind of glucose oxidase CnGODA and its gene and application | |
| CN102344900A (en) | Engineering bacterium for expressing antihypertensive peptide and method for preparing antihypertensive peptide | |
| CN102277327B (en) | Colon bacillus for over-expressing RimL and application on preparing N-extrasin alpha acetylate | |
| CN110527690A (en) | A kind of heat resistant type tannase and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170322 |