CN106480174B - It is a kind of for the genetic molecule labeling method of pig disease resistant breeding and application - Google Patents
It is a kind of for the genetic molecule labeling method of pig disease resistant breeding and application Download PDFInfo
- Publication number
- CN106480174B CN106480174B CN201610825036.2A CN201610825036A CN106480174B CN 106480174 B CN106480174 B CN 106480174B CN 201610825036 A CN201610825036 A CN 201610825036A CN 106480174 B CN106480174 B CN 106480174B
- Authority
- CN
- China
- Prior art keywords
- pig
- breeding
- upstream
- dna
- genetic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a kind of for the genetic molecule labeling method of pig disease resistant breeding and application.The present invention is the molecule labelling method and application for using Large White FUT2 genetic transcription initiation codon -84bp polymorphic site as breeding for disease resistance.The method for detecting the molecular labeling includes the extraction of the pig genomic DNA of sample to be tested and the PCR amplification of FUT2 genetic transcription upstream from start codon sequence, the pcr amplification product of translation initiation codon upstream sequence is through sscp analysis, it is then the advantageous individual of breeding for disease resistance when individual pig to be tested genotype is TT type (occur the 2nd and the 3rd band in 3 bands).The present invention provides effective molecular labeling permanently to improve Large White weanling pig E. coli resistance and Some Economic Traits from heredodiathesis.Assisted Selection is marked when with the genetic marker to Large White boar breeding, carry out breeding for disease resistance, the ability that the anti-Escherichia coli of weanling pig are infected can be improved, fundamentally reduce the disease incidence of diarrhoeal diseases, while the newborn piglet number and number pigs weaned of boar can be improved.
Description
Technical field
The invention belongs to pig genetics and breeding and Molecular Marker Assisted Selection Technology fields, and in particular to one kind is disease-resistant for pig
The genetic molecule labeling method of breeding and application.
Background technique
Grice diarrhoea and oedema are the most common a kind of diseases of large-scale pig farm, bring huge economic damage to pig breeding industry
It loses.Enterotoxigenic escherichia coil (Enterotoxigenic Escherichia coli, ETEC 18) is nascent and wean is young
The most common and most important pathogen of diarrhea of pigs disease, wherein F18 Escherichia coli (E.coli F18) are that most universal, harm occurs again
One of maximum Escherichia coli cause of disease.Studies have shown that can E.coli F18, which cause a disease, directly depends on Small Intestine of Piglets mucosal epithelium
Whether there is or not receptors corresponding with its adhesin for cell brush border.
The researchs such as Snoeck find that α-(1,2) fucosyl transferase 1 (FUT1 gene coding) is E.coli F18 by the bodily form
At key enzyme, catalysis H-2 blood group antigens be that receptor forms main glucide.The researchs such as Meijerink are further
It was found that there are the mutational sites G/A at FUT1 gene M 307, the important genetic marker of E.coli F18 can be used as.But
Coddens etc. passes through thin-layered chromatography (TLC), negative ion mass spectrum, proton according to this genetic marker of 307 site of FUT1 gene M
The technologies such as NMR spectrum, the ABH blood group antigens for participating in regulation to FUT1 enzyme are verified, and find E.coli F18 receptor
For FUT2 gene coding α-(1,2) fucosyl transferase 2 be catalyzed 1 type H antigen, and not FUT1 gene coding α-(1,
2) the 2 type H antigens that fucosyl transferase 1 is catalyzed.In addition, the early periods such as Bao Wenbin use chip of expression spectrum, ball series-sheath is found
Glycolipid biosynthesis pathway may have important regulating and controlling effect to Soviet Union's too pig weanling pig E.coli F18 resistance, and preliminary true
Determining FUT2 gene is the key gene in ball series-glycosyl sphingolipid biosynthesis pathway.
Summary of the invention
It is an object of the invention to provide a kind of for the genetic molecule labeling method of pig disease resistant breeding and application.It is specific to use greatly
Molecule labelling method and application of the white pig FUT2 genetic transcription initiation codon -84bp polymorphic site as breeding for disease resistance.
Realizing the technical solution of the object of the invention is:
A kind of genetic molecule labeling method for pig disease resistant breeding, comprising the following steps:
1) screening and determination of pig FUT2 genetic mutation site
Extract the ear tissue DNA of sample to be tested；Using the sample gene to be tested group DNA comprising FUT2 gene as template, carry out
PCR amplification, the DNA profiling of PCR amplification use hybrid dna, and every 5 individual DNA samples construct altogether 10 as 1 pond DNA
The pond DNA is as amplification template, upstream and downstream primer sequence are as follows:
Upstream primer are as follows: 5 '-CACAGCCATGCAAGACAAGG-3 '
Downstream primer are as follows: 5 '-AAAGAAGAATGGGGAGCCGA-3 '；
Sequencing result carries out Blast comparison, and discovery does not have variation position in the code area of FUT2 gene amplification fragment
Point, but there are 1 SNP sites at Gene A TG upstream from start codon -84bp；
2) it is marked using FUT2 Gene A TG upstream from start codon -84bp to pig core group complete detection genotype
Extracting genomic DNA to each individual sample pig is that template carries out PCR amplification, and amplified fragments include that ATG starting is close
The PCR primer of numeral upstream 195bp sequence, target fragment length 203bp, upstream and downstream primer sequence are as follows:
Upstream primer are as follows: 5 '-AGGGGAAACACACCCTCAAAA-3 '
Downstream primer are as follows: 5 '-GGGAGAACAGGGAGCGGTTA-3 '；
3) amplified production is analyzed with SSCP method, and primer extension product is selected to occur the among 3 bands the 2nd and the 3rd
The sample of this 2 band is the advantageous individual in breeding for disease resistance；
4) analysis and resistance mark are associated between FUT2 gene -84bp (C → T) mutation and F18 E. coli resistance
The determination of note.
Wherein, sample to be tested selects Large White, and each individual takes ear tissue sample about 1.0g, is put into the centrifuge tube of 1.5mL
It is interior, set -20 DEG C of storages.Genomic DNA is extracted using conventional phenol-chloroform method, it is micro with NanoDrop-1000 after ultrapure water dissolution
Nucleic acid analyzer measures its concentration and purity, is diluted to 100mg/ μ L with ultrapure water according to its concentration, -20 DEG C save backup.
The PCR amplification system: 10.0 μ L of genome hybrid dna (100ng/ μ L) 1.0 μ L, PCR Master-Mix, on
Each 1.0 μ L of downstream primer (10pmol/L) F1/R1, adds ddH2O complements to 20 μ L；Condition are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of changes
Property 30s, 63 DEG C of annealing 30s, 72 DEG C of extension 50s, 35 circulation, 72 DEG C of extension 10min, last 4 DEG C save backup.
The present invention is that Large White weanling pig E. coli resistance and part economy are permanently improved from heredodiathesis
Character provides effective molecular marker breeding means.
Advantages of the present invention is embodied in:
1) present invention provides more an efficiently and accurately, letter for the molecular marker assisted selection of Large White breeding for disease resistance work
The molecular genetic marker of easy row provides one kind to the resistivity and Some Economic Traits of colibacillosis to improve piglet
Effective molecular marker breeding means.Assisted Selection is marked with E. coli resistance of the genetic marker to pig, it can be effective
The piglet diarrhoea problem in actual production is alleviated on ground, while the Some Economic Traits of pig can be improved.
2) molecule breeding is carried out using the genetic marker, not only accelerates breeding process, but also the immune of Large White is answered
Answering ability and general premunition does not have any detrimental effect.
3) detection method of the invention is easy to operate, and expense is more cheap, and accuracy is high, and can realize the direct of automation
Detection, the present invention will play a great role in the breeding for disease resistance of Large White.
Detailed description of the invention
Fig. 1 is FUT2 genetic transcription upstream from start codon sequence PCR-SSCP banding pattern.
Fig. 2 is that peak figure is sequenced in FUT2 genetic transcription upstream from start codon series jump.
Fig. 3 is that the susceptible type of Escherichia coli determines result (A: reference culture 107/86；B:rE.coli1534；C:
PnirBMisL-fedF (photo uses oil mirror camera lens, is shot with 1000 times of magnification ratios)).
Fig. 4 is that E. coli resistance type determines result (A: reference culture 107/86；B:rE.coli1534；C:
The Disability (photo uses oil mirror camera lens, is shot with 1000 times of magnification ratios) of pnirBMisL-fedF).
Specific embodiment
For a better understanding of the present invention, technical solution of the present invention is illustrated below by specific embodiment.
The screening and determination of 1 Large White FUT2 genetic mutation site of embodiment
All Large Whites (242) come from Changzhou health and happiness Farming Ltd. (national live pig core breeding station).Per each and every one
Body takes ear tissue sample about 1.0g, is put into the centrifuge tube of 1.5mL, sets -20 DEG C of storages.Base is extracted using conventional phenol-chloroform method
Because of a group DNA, its concentration and purity are measured with NanoDrop-1000 trace dna analyzer after ultrapure water dissolution, according to its concentration
It is diluted to 100mg/ μ L with ultrapure water, -20 DEG C save backup.According to GenBank announce pig FUT2 gene order (accession number:
U70881.2) (5 ' → 3 ') design primer F:F1:CACAGCCATGCAAGACAAGG/R:AAAGAAGAATGGGGAGCCGA.PCR
The DNA profiling of amplification uses hybrid dna, and every 5 individual DNA samples construct altogether 10 ponds DNA as expansion as 1 pond DNA
Increase template.PCR amplification system: 10.0 μ L of genome hybrid dna (100ng/ μ L) 1.0 μ L, PCR Master-Mix, upstream and downstream
Each 1.0 μ L of primer (10pmol/L) F1/R1, adds ddH2O complements to 20 μ L；Condition are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation
30s, 63 DEG C of annealing 30s, 72 DEG C of extension 50s, 35 circulations, 72 DEG C of extension 10min, last 4 DEG C save backup.PCR amplification produces
After object is detected through 1% agarose gel electrophoresis, it is double to be routed directly to Shanghai Sangon Biological Engineering Technology And Service Co., Ltd's progress
Blast comparison is carried out to sequencing analysis, and according to sequencing result, discovery is not deposited in the code area of FUT2 gene amplification fragment
In variant sites, but there are 1 SNP sites at Gene A TG upstream from start codon -84bp.
Embodiment 2 is marked using FUT2 Gene A TG upstream from start codon -84bp to Large White core group complete detection base
Because of type.
The PCR primer that amplified fragments include ATG initiation codon upstream 195bp sequence is designed, Primer is utilized
Premier5.0 software carries out design of primers.Amplimer, F:5 '-AGGGGAAACACACCCTCAAAA-3 ' (SEQ ID
NO.1)；R:5 '-GGGAGAACAGGGAGCGGTTA-3 ' (SEQ ID NO.2), target fragment length 203bp.Primer is by Shanghai
The synthesis of Sheng Gong bioengineering Co., Ltd.
PCR amplification is carried out by template of the genomic DNA of extraction.PCR amplification system: genome hybrid dna (100ng/ μ
L each 1.0 μ L of) 1.0 μ L, PCR Master-Mix, 10.0 μ L, upstream and downstream primer (10pmol/L) F1/R1, adds ddH2O is complemented to
20μL；Condition are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 30s, 63 DEG C of annealing 30s, 72 DEG C of extension 50s, 35 recycle, and 72 DEG C
Extend 10min, last 4 DEG C save backup.
SSCP detection: 3 μ LPCR products are taken to mix with 8 μ L denaturants, then 98 DEG C of denaturation 15min, ice bath 15min take 10
μ L is added in polyacrylamide gel (Acr:Bis=29:1) by the denaturation aggregate sample of ice bath, 120V electrophoresis 11h.Benefit
Use 0.1%AgNO3Silver staining is carried out, is then developed the color using 1.5%NaOH.
According to PCR-SSCP testing result, chooses different genotype individual and the raw work biotechnology service in Shanghai is transferred to have
Limit company ABI PRISM 377DNA automatic sequencer carries out bidirectional sequencing analysis.
PCR-SSCP as a result, it has been found that, detect 3 kinds of genotype, be respectively defined as TT, CT, CC (occur 3 bands be CT
Type, the 1st and the 3rd this 2 band occurred among 3 bands is CC type, the 2nd and the 3rd this 2 band among 3 bands occurs and is
TT type) (Fig. 1), determine that there are C → T to be mutated (Fig. 2) in ATG initiation codon upstream -84bp really through direct Sequencing.
The genotype frequency that FUT2 gene purpose mutational site is calculated according to Hardy-Weinberg equilibrium law, is as a result shown in
Table 1, CC genotype is preponderant genotype in Large White group, and genotype frequency reaches 0.653；Allele C is advantage equipotential
Gene, gene frequency 0.773.Through the comptibility test of card side, which deviates Hardy-Weinberg equilibrium state.
1 Large White FUT2 gene -84bp (C → T) mutated-genotype of table and gene frequency distribution
Note: χ2Indicate whether different genotype distribution meets Hardy's Weinberg equilibrium: χ20.05 (1)=3.84, χ20.01
(1)=6.63
The adhesion assay of 3 Small Intestine of Piglets epithelial cell of embodiment determines individual Escherichia coli F18 bacterial strain resistance/neurological susceptibility
Before and after weaned piglet, and most easy infection Escherichia coli F18 bacterial strain and show age grades on the 35th of symptom of diarrhea
Section, which is butchered, takes duodenum, jejunum intestinal segment 15cm to be used for the preparation of intestinal epithelial cell,
It is micro- by Univ Pennsylvania USA's veterinary college to produce F18ab pili reference culture 107/86 (O139:K12:H1)
Biology laboratory give.Can induce expression F18ac pili operon containing fed full genome recombination coliform rE.coli1534 by
This laboratory constructs and saves, the recombination bacillus coli pnirBMisL- of energy surface secreting, expressing F18ab pili FedF subunit
FedF is also constructed by this laboratory.The bacterium of anaerobic induction is centrifuged repeatedly with PBS and is washed 3 times, adjustment bacterial concentration to about 1 ×
109CFU/ml.The recombinant bacterium bacterium solution 0.5ml for taking above-mentioned wild mushroom or inducing expression respectively, it is sweet to add final concentration of 1% wherein
Dew sugar mixes after 37 DEG C of effect 30min with 0.5ml intestinal epithelial cell, then at 37 DEG C of incubation 30min, 1000r/min centrifugations
5min, with taking 50 μ l drops to spontaneously dry after PBR solution suspension on clean slide, flame is fixed, and dyes 3-5min with methylene blue,
Oil mirror observes result.
The intestinal epithelial cell of weanling pig is as can be with expression F18ab pili reference culture 107/86, inducing expression
Adhesion (figure occurs for the recombination bacillus coli rE.coli1534 and recombination bacillus coli pnirBMisL-fedF of inducing expression
3), it is defined as Escherichia coli F18 bacterial strain responsive type；And as Small Intestine of Piglets epithelial cell sticks above-mentioned 3 plants of Escherichia coli
Attached ability is almost nil (Fig. 4), then is defined as resistance type.
The relationship analysis and resistance of 4 Large White FUT2 gene -84bp (C → T) of embodiment mutation and F18 E. coli resistance
The determination of label
Large White FUT2 gene -84bp (C → T) is mutated 3 kinds of genotype individuals Escherichia coli F18 bacterial strain resistance/neurological susceptibilities
It is analyzed, 3 kinds of genotype individuals Escherichia coli F18 bacterial strain resistance/neurological susceptibility frequencies are shown in Table 2；As it can be seen that big in TT genotype
The frequency of enterobacteria F18 bacterial strain resistance type individual is 88.5%, is higher than CT genotype (38.5%) and CC significant or extremely significantly
The individual of genotype (15.4%).Large White FUT2 gene -84bp (C → T) mutation T T genotype can be determined as anti-large intestine
The beneficial gene type of bacillus.
23 kinds of genotype individuals Escherichia coli F18 bacterial strain resistance/neurological susceptibility frequency meters of table
The measurement of 5 pig important economical trait of embodiment
80 piglets are randomly selected in 35 age in days of weaned piglet, vena cava anterior blood sampling 5ml utilizes pig multiple cytokine to examine
Test agent box (Procarta Immunoassay Kits) (Affymetrix, USA) is important to part in above-mentioned sample serum thin
Intracellular cytokine (IL-2, IL-4, IL-6, IL-10, IL-12, IFN-α, IFN-β, IFN-γ) level is measured, concrete operations step
Suddenly it is carried out in strict accordance with specification.
Great Bai Suprapubic arch sling 200 of 6 tires of farrowing or more are randomly selected, the reproductive performance and growth of each sow are arranged
Energy data, the impact analysis for subsequent hereditary variation to Some Economic Traits.In 185-195 age in days, B ultrasound living body measurement great Bai
Eye muscle thickness, the thickness of backfat (thickness of backfat on the left of sow at the 10th rib) of pig, weigh in.Record reproductive performance in detail is relatively stable
The 3rd~5 tire number born alive, number pigs weaned, born weight, weight of weaning litter." 100kg weight age in days " and " 100kg living body back
Fat thickness " corrects as follows respectively: age in days-(actual measurement weight -100)/CF1, CF1=is (real when 100kg weight age in days=measurement
Survey weight/measurement age in days) × 1.715 (sows)；The 100kg thickness of backfat=actual measurement the thickness of backfat × CF2, in which: CF2=A/ { A+ [B
× (actual measurement weight -100)] }, the A value and B value of large white sow are respectively 13.706,0.119.Every economy of 3 parity is referred to
Mark data statistics processing is averaged, the analysis data as economic characters.
6 Large White FUT2 gene -84bp (C → T) of embodiment mutation and its relationship analysis between important economical trait
Based on 8 kinds of cellular immunity factors between the genotype individuals of 3 kinds of the site FUT2 gene -84bp (C → T) in peripheral blood
It is horizontal significant difference (table 3) is not present, show the site for immune response ability and general premunition without conspicuousness
Influence.
The important immune factor in part is horizontal between table 3FUT2 gene different genotype individual
This test picks 200 (CC:130, CT:46 and TT:24) Suprapubic arch sling determination part point economy altogether
Shape data.The results are shown in Table 4 for analysis, and on newborn piglet number and number pigs weaned index, TT > CT > CC genotype is presented
Trend, and the newborn piglet number and number pigs weaned of TT genotype individuals are significantly higher than CC genotype (P < 0.05)；Birth weight,
It corrects in the indexs such as 100Kg weight age in days, eye muscle thickness and the correction 100Kg thickness of backfat, 3 kinds of genotypic differences are not significant.Show TT
Genotype is also advantageous that genotype for important reproductive trait newborn piglet number and number pigs weaned, this may be with TT base
Because type has stronger premunition related.
Part important economical trait between table 4FUT2 gene different genotype individual
Note: the numerical value that upper right indicates different letters represents significant difference (P < 0.05).
SEQ ID No:1
<110>Yangzhou University
<120>a kind of for the genetic molecule labeling method of pig disease resistant breeding and application
<130>
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> DNA
<213>artificial sequence
<400> 1
aggggaaaca caccctcaaa a 21
SEQ ID No:2
<210> 2
<211> 20
<212> DNA
<213>artificial sequence
<400> 2
gggagaacag ggagcggtta 20
Claims (4)
1. a kind of genetic molecule labeling method for the anti-colibacillosis breeding of pig, which comprises the following steps:
1) the ear tissue DNA of sample to be tested is extracted；
2) it is marked using -84 bp of FUT2 Gene A TG upstream from start codon to pig core group complete detection genotype
PCR amplification is carried out by template of the DNA of extraction, amplified fragments include SNP at -84 bp of ATG initiation codon upstream
Point, 195 bp of expanding fragment length, upstream and downstream primer sequence are as follows:
Upstream primer are as follows: 5 '-AGGGGAAACACACCCTCAAAA-3 '
Downstream primer are as follows: 5 '-GGGAGAACAGGGAGCGGTTA-3 '；
3) amplified production is analyzed with SSCP method: as shown in Figure of description Fig. 1 label 1,3 bands occur is CT type,
As shown in Fig. 1 label 2,3, the 1st and the 3rd this 2 band occurred among 3 bands is CC type, as shown in Fig. 1 label 4, occurs 3
The the 2nd and the 3rd this 2 band among band is TT type, selects the sample of TT type for the advantageous individual in breeding for disease resistance.
2. genetic molecule labeling method according to claim 1, which is characterized in that sample to be tested selects Large White, each
Individual takes about 1.0 g of ear tissue sample, is put into the centrifuge tube of 1.5 mL, sets -20 DEG C of storages；It is mentioned using conventional phenol-chloroform method
Genomic DNA is taken, its concentration and purity are measured with NanoDrop-1000 trace dna analyzer after ultrapure water dissolution, according to it
Concentration is diluted to 100 mg/ μ L with ultrapure water, and -20 DEG C save backup.
3. genetic molecule labeling method according to claim 1, which is characterized in that the PCR amplification system: genome is mixed
Conjunction DNA concentration is 100 ng/ μ 10.0 μ L of L, 1.0 μ L, PCR Master-Mix, and upstream and downstream primer F1/R1 concentration is 10
Each 1.0 μ L of pmol/L, adds ddH2O complements to 20 μ L；Condition are as follows: 95 DEG C of 5 min of initial denaturation, 95 DEG C of 30 s of denaturation, 63 DEG C are moved back
30 s of fire, 72 DEG C of 50 s of extension, 35 circulations, 72 DEG C of 10 min of extension, last 4 DEG C save backup.
4. genetic molecule labeling method as claimed in any one of claims 1-3 is marked in the anti-colibacillosis breeding process of pig
Remember the application of assisted Selection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610825036.2A CN106480174B (en) | 2016-09-14 | 2016-09-14 | It is a kind of for the genetic molecule labeling method of pig disease resistant breeding and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610825036.2A CN106480174B (en) | 2016-09-14 | 2016-09-14 | It is a kind of for the genetic molecule labeling method of pig disease resistant breeding and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106480174A CN106480174A (en) | 2017-03-08 |
| CN106480174B true CN106480174B (en) | 2019-04-16 |
Family
ID=58273776
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610825036.2A Active CN106480174B (en) | 2016-09-14 | 2016-09-14 | It is a kind of for the genetic molecule labeling method of pig disease resistant breeding and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106480174B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108707675B (en) * | 2018-06-05 | 2022-02-25 | 安徽省农业科学院畜牧兽医研究所 | Molecular marking method for pig growth traits |
| CN108841922A (en) * | 2018-06-09 | 2018-11-20 | 新疆农垦科学院 | A method of screening animal disease resistant breeding |
| CN109971840A (en) * | 2019-04-11 | 2019-07-05 | 扬州大学 | It is a kind of for the genetic molecule labeling method of pig disease resistant breeding and application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000016641A1 (en) * | 1998-09-18 | 2000-03-30 | Biotechnology Research And Development Corporation | Interactions between genotype and diet in swine that prevent e coli associated intestinal disease |
| CN1314953A (en) * | 1997-05-20 | 2001-09-26 | 生物技术研究及发展公司 | Method and compositions to identify swine genetically resistant to F18 E. coli associated diseases |
| CN101724705A (en) * | 2010-01-19 | 2010-06-09 | 扬州大学 | Molecular detection kit for detecting resistance of pig Escherichia coli F18 and application thereof |
| CN101792798A (en) * | 2010-01-19 | 2010-08-04 | 扬州大学 | Method for breeding new variety of Sutai ETEC F18+ and disease resistant pigs |
-
2016
- 2016-09-14 CN CN201610825036.2A patent/CN106480174B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1314953A (en) * | 1997-05-20 | 2001-09-26 | 生物技术研究及发展公司 | Method and compositions to identify swine genetically resistant to F18 E. coli associated diseases |
| WO2000016641A1 (en) * | 1998-09-18 | 2000-03-30 | Biotechnology Research And Development Corporation | Interactions between genotype and diet in swine that prevent e coli associated intestinal disease |
| CN101724705A (en) * | 2010-01-19 | 2010-06-09 | 扬州大学 | Molecular detection kit for detecting resistance of pig Escherichia coli F18 and application thereof |
| CN101792798A (en) * | 2010-01-19 | 2010-08-04 | 扬州大学 | Method for breeding new variety of Sutai ETEC F18+ and disease resistant pigs |
Non-Patent Citations (3)
| Title |
|---|
| Association study of FUT2 (rs601338) with celiac disease and inflammatory bowel disease in the Finnish population;A. S. Parmar等;《Tissue Antigens》;20121018;第80卷;488-493 * |
| Two α(1,2) fucosyltransferase genes on porcine Chromosome 6q11 are closely linked to the blood group inhibitor (S) and Escherichia coli F18 receptor (ECF18R) loci;E. Meijerink等;《Mammalian Genome》;19971031;第8卷;736-741 * |
| 不同日龄苏太仔猪FUT2基因的组织表达谱和表达差异分析;夏日炜 等;《中国畜牧杂志》;20160515;第52卷(第9期);1-4 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106480174A (en) | 2017-03-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107475412B (en) | Molecular marker related to egg-laying traits of chickens and application of molecular marker in chicken breeding | |
| CN109371143B (en) | SNP molecular marker associated with pig growth traits | |
| CN106480174B (en) | It is a kind of for the genetic molecule labeling method of pig disease resistant breeding and application | |
| CN109694915B (en) | Molecular marker related to sheep tail fat weight and application thereof | |
| CN109694916B (en) | Molecular marker related to sheep feed conversion rate and application thereof | |
| CN105969882B (en) | One kind haplotype SNP marker relevant to channel catfish fast-growth and its detection method and application | |
| CN101792798A (en) | Method for breeding new variety of Sutai ETEC F18+ and disease resistant pigs | |
| CN108384859A (en) | With the relevant SNP marker of tail type character of broadtail type sheep and application | |
| CN105063021B (en) | The SNP marker related to label of pig fat deposition description and its application | |
| CN108913779A (en) | A kind of SNP marker and its application influencing daily gain in pigs character | |
| CN112899373B (en) | SNP (Single nucleotide polymorphism) marker related to milk fat percentage of southern Holstein cows in China and application thereof | |
| CN113862375A (en) | SNP (Single nucleotide polymorphism) marker of AANAT (ananas site-directed translation) and ASMT (antisense-fluorescent marker) genes of cattle and application thereof | |
| CN112176081B (en) | SNP molecular marker related to chicken coccidian decoquinate drug resistance and application thereof | |
| CN113549700A (en) | Molecular marker related to porcine intramuscular fat character and application of molecular marker in pig breeding | |
| CN112921101A (en) | Molecular marker related to sheep remaining feed intake and application thereof | |
| CN108998543B (en) | SNP molecular marker related to pig red blood cell number character | |
| CN113817841B (en) | SNP (Single nucleotide polymorphism) marker primer pair related to swine nipple number traits and application thereof | |
| CN110643716A (en) | Molecular marker related to sheep tail fat weight and application thereof | |
| CN106521000B (en) | Molecular marker related to piglet weaning weight and diarrhea resistance and application of molecular marker in pig breeding | |
| CN113736890B (en) | SNP molecular marker related to healthy number and living number rate and application thereof | |
| CN115109856A (en) | Molecular marker related to sheep stage body weight, detection method and application thereof | |
| CN108949763A (en) | Accurate mutation LamR gene and the application of swine fever virus infection can effectively be inhibited | |
| CN114959052A (en) | Molecular marker related to Hu sheep physique and application thereof | |
| CN110184302B (en) | Construction method of SIRT1 gene knockout IPEC-J2 cell line | |
| CN106282368B (en) | A kind of molecule labelling method and application for place of china pig variety E. coli resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |