CN106480019A - The detection in people NUDT2 and PCDH8 gene methylation site and application - Google Patents

The detection in people NUDT2 and PCDH8 gene methylation site and application Download PDF

Info

Publication number
CN106480019A
CN106480019A CN201510546489.7A CN201510546489A CN106480019A CN 106480019 A CN106480019 A CN 106480019A CN 201510546489 A CN201510546489 A CN 201510546489A CN 106480019 A CN106480019 A CN 106480019A
Authority
CN
China
Prior art keywords
site
gene
methylation
hepatocarcinoma
pcdh8
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201510546489.7A
Other languages
Chinese (zh)
Other versions
CN106480019B (en
Inventor
杨小丽
张悦宁
刘坤
李佳桐
张成东
林志弟
肖非凡
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201510546489.7A priority Critical patent/CN106480019B/en
Publication of CN106480019A publication Critical patent/CN106480019A/en
Application granted granted Critical
Publication of CN106480019B publication Critical patent/CN106480019B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses the related people NUDT2 of hepatocarcinoma and PCDH8 gene methylation site and application, feature is to detect the methylation level of NUDT2 gene specific site cg04322134 and PCDH8 gene locis cg20366906 using a kind of pyrosequencing standard measure, devise exclusive primer for each site, include upstream and downstream pcr amplification primer thing and Pyrosequencing primer, wherein one amplimer band biotin labeling respectively.The present invention can carry out fast and accurately detection by quantitative to the methylation level of NUDT2 gene and PCDH8 gene specific site, and finds that two site methylation level significantly change in hepatocellular carcinoma patients.

Description

The detection in people NUDT2 and PCDH8 gene methylation site and application
Technical field
This research is related to people NUDT2 (Nudix (Nucleoside Diphosphate Linked Moiety X)-Type Motif2, nucleoside diphosphate coupling part X-type motif 2) gene and PCDH8 (Protocadherin-8, the change of the quantitative information that methylates in hepatocarcinoma for protocalcium mucoprotein 8) gene specific DNA (DNA (deoxyribonucleic acid)) methylation sites, specifically refers to apply pyrosequencing techniques to find that NUDT2 gene specific DNA methylation site (cg04322134) methylation in hepatocarcinoma reduces;PCDH8 gene specific DNA methylation site (cg20366906) methylation in hepatocarcinoma raises.These are the pathogeny exploring hepatocarcinoma, find and diagnose or the potential mark of therapy-related provides support.
Background technology
Hepatocarcinoma is the malignant tumor that in global range, fatality rate is number three, and is also the cancer " killer " that China occupies second.At present to the treatment of hepatocarcinoma mainly to perform the operation, based on chemicotherapy, in combination with other treatment methods such as immunization therapy, the traditional Chinese medical science;But because the pathogenesis for hepatocarcinoma are still not clear and lack effective therapy target, the patient effect on driving birds is not good of middle and late stage, survival rate is low.Research shows, liver cancer genesis and development is the process of an epigenetic regulation.DNA methylation is one of focus of current epigenetics research, it refers in dnmt rna (DNA methyltransferase, DNMT, under) mediating, with SAM as methyl donor, methyl group is transferred to the process in some bases of DNA.DNA methylation is considered as a tumorigenic major reason extremely.The research methylated change of liver cancer related gene specific position, contributes to understanding the pathogeny of hepatocarcinoma, the prevention and treatment for hepatocarcinoma provide effective action target spot.
NUDT2 gene carries positioned at No. 9 chromosome long arm 1 areas 3, belongs to MutT/Nudix superfamily, encodes a kind of hydrolase protein, can obtain ATP and AMP to maintain the level of intracellular Ap4A by asymmetric hydrolysiss Ap4A.Ap4A is widely present in vivo in the various biology of nature, participates in multiple important biological functions, is the second message,second messenger of LysRS-Ap4A-MITF signal path.The prognosis of NUDT2 gene unconventionality and Partial tumors has a dependency, but its DNA specific position methylate and the relation of hepatocarcinoma has no report at present both at home and abroad.
PCDH8 gene carries positioned at long-armed 14 areas 3 of human chromosome 13, belong to calcium and stick plain gene superfamily, its encoding proteins structure includes the extracellular space of 6 repetitions, and 1 transmembrane region and 1 intracellular region play an important role at aspects such as the growth of cell, differentiation, cytoskeleton formation and intercellular signal transductions.Research in recent years shows, PCDH 8 gene is a kind of antioncogene, and its gene promoter zone methylation abnormal expression is closely related with the generation development of tumor.Lin YL etc. reports, PCDH8 promoter zone methylation is extremely with bladder cancer malignization and prognosis compared with difference correlation.Zhang D etc. finds, PCDH8 promoter region hyper-methylation related to gastric cancer it may be possible to a potential molecular diagnostic markers thing.The research display such as He D, there is also PCDH8 promoter zone methylation abnormal in nasopharyngeal carcinoma.At present, the abnormal relation with hepatocarcinoma of this gene promoter zone methylation has no report.
Content of the invention
The invention provides the methylation level in a kind of pyrosequencing standard measure detection people's NUDT2 gene and PCDH8 gene specific site and specific primer, can accurately detect the methylation level of specific DNA sites in people's Hepatocellular Carcinoma using this primer.
Pyrosequencing standard measure detects the primer of people's NUDT2 gene and PCDH8 gene specific site methylation level, including PCR (polymerase chain reaction) primer and the sequencing primer that methylates.Wherein, the PCR upstream primer sequence of described NUDT2 gene is:5 '-AGAAGGTTTTGGGATTTAAGAGTTTA-3 ', downstream primer sequence is:Biotin-5 '-TCCCCATATCTCTACCTTTTCTTC-3 ', the sequencing primer sequence that methylates is:5’-GAGTTTAGTTTTTTAAAGTGAG-3’;The PCR upstream primer sequence of PCDH8 gene is:5 '-TGTTGGGTGTTTTTAGTGGT-3 ', downstream primer sequence is:Biotin-5 '-CACTACCAAACCTAACCACACAACC-3 ', the sequencing primer sequence that methylates is:5’-ATTTTGGTAGAGGATTTGTATATG-3’.
The difference that the present invention is methylated between chip examination primary hepatoma and methylome in corresponding cancer beside organism using Illumina infinium humanmethylation27 beadchip, find in the genomic DNA of primary hepatoma, the methylation level of NUDT2 gene promoter area one site (this site is cg04322134 in the above-mentioned numbering methylating in chip) is significantly lower than the other group of cancer;And the methylation level of one site (cg20366906) in PCDH8 gene promoter area is apparently higher than the other group of cancer.
In order to avoid the sieve of the chip that methylates surveys result error, and ensure that sieve surveys the accuracy of result, the present invention is detected to the methylation level of two sites (cg04322134, cg20366906) using pyrosequencing.Detection method comprises the steps:
1. extract the genomic DNA of Hepatocellular Carcinoma and cancer beside organism respectively, respectively bisulfite conversion is carried out to the genomic DNA of all samples, unmethylated cytosine is changed into uracil, and methylated cytosine is constant;
2. with the human gene group DNA after bisulfite conversion as template, for the PCR primer described in the upstream and downstream sequential design of site (cg04322134, cg20366906) and sequencing primer.
3., with the human gene group DNA after bisulfite conversion as template, carry out pyrosequencing, the methylation level in analysis (cg04322134, cg20366906) site using described PCR primer and sequencing primer.
After testing, in primary hepatoma group, the methylation level in cg04322134 site is significantly lower than the cancer beside organism of same Specimen origin, the methylation level in cg20366906 site is apparently higher than the cancer beside organism of same Specimen origin, consistent with the sieve survey result of the chip that methylates.Show that cg04322134 and cg20366906 site is the specific position in NUDT2 and PCDH8 gene respectively.
Compared with the prior art, beneficial effects of the present invention are:Present invention finds the specific DNA methylation sites with primary hepatoma crowd's related gene, and for this specific position design pyrosequencing PCR primer and sequencing primer, fast and accurately detection by quantitative can be carried out to methylating of this specific position by pyrosequencing.
Brief description
Figure 1For NUDT2 gene pyrosequencing resultFigure, wherein inframe stylolitic part manifests methylated site and the percentage ratio that methylates;1 is cancerous tissue, and 2 is cancer beside organism.
Figure 2For PCDH8 gene pyrosequencing resultFigure, wherein inframe stylolitic part manifests methylated site and the percentage ratio that methylates;1 is cancerous tissue, and 2 is cancer beside organism.
Specific embodiment
With reference toAccompanying drawingWith specific embodiment, the present invention is described in further detail.
1. specific position analysis
Methylated the difference between chip examination primary hepatoma and methylome in corresponding cancer beside organism with Infinium HumanMethylation27 BeadChip, find in the genomic DNA of primary hepatoma, the methylation level in NUDT2 gene promoter area one site (this site is cg04322134 in the above-mentioned numbering methylating in chip) is significantly lower than the other group of cancer, and the methylation level of one site (cg20366906) in PCDH8 gene promoter area is significantly lower than the other group of cancer.
The sequence that NUDT2 gene specific site is located is (SEQ ID No.1):
CACCTACTTTCCTATCTTTCATCCCCATATCTCTGCCTTTTCTTCAGCAATTATCTTGAA[CG]CCACTTCTCTCACTTTGGGAGACTAAACTCTTGAGTCCCAAAGCCTTCTTGCTTTTGAAC
The sequence that PCDH8 gene specific site is located is (SEQ ID No.5):
ACGGTCATCGGGACCCTGGCCGAGGACCTGCATATGAAAGTATCGGGTGACACAAGCTTC[CG]CCTGATGAAGCAATTCAACAGCTCTCTGCTCCGGGTGCGCGAAGGCGACGGGCAGCTGAC
For detecting the accuracy of this screening results, design relative specific primer, using pyrosequencing method, the specificity of this specific position is verified.
2. human gene group DNA extracts
1) gather cancerous tissue and the cancer beside organism of 42 hepatocellular carcinoma patients, extract the genomic DNA of each sample, operation is carried out according to German QIAGEN QIAamp DNA mini kit (Cat.No.51304) description.
2) the genomic DNA sample obtaining is entered with row agarose gel electrophoresis analysis.
3) bisulfite conversion
Carry out bisulfite conversion using German QIAGEN company conversion reagent box Epitect Bisulfite Kit (Cat.No.59104), step is carried out according to this kit specification.
4. design of primers
Genomic DNA after to convert through bisulfite, as template, using QIAGEN company PyroMark Assay Design2.0 software design pyrosequencing PCR primer and sequencing primer, and is synthesized by Shanghai Sheng Gong biological engineering company limited.
5. pyrosequencing
1) PCR amplification
With the genomic DNA after bisulfite conversion as template, enter performing PCR reaction using following condition, system is as follows:
Reaction condition:94℃2min;
94 DEG C of 30sec, 60 DEG C of 1min, 68 DEG C of 1min (50 circulations);
68℃10min.
After the completion of reaction, PCR primer is carried out with 2% agarose gel electrophoresiies, the specificity of checking product and accuracy.
2) pyrosequencing
On German QIAGEN PyroMark Q96ID platform, carry out pyrosequencing, concrete steps are carried out by instrument description.
3) DNA methylation testing result
The result that methylates shows:The methylation level of cg04322134 site cancer group is significantly lower than the other group of cancer, and this site cancer group methylates average level for 16.52 ± 8.21, and the other group of cancer methylates average level for 24.16 ± 3.18 (p < 0.01);The cancer group methylation level in cg20366906 site methylates average level for 43.23 ± 13.17 apparently higher than the other group of cancer, this site cancer group, and the other group of cancer methylates average level for 22.42 ± 4.29 (p < 0.01).SequencingFigureSee respectivelyFigure 1 2.
4) conclusion:Result of study finds in primary hepatoma, and the methylation level in NUDT2 gene cg04322134 site is significantly lower than the other group of cancer, and the methylation level in PCDH8 gene cg20366906 site is apparently higher than the other group of cancer.Therefore, the present invention is directed to the pyrosequencing PCR primer of site cg04322134 and cg20366906 design and sequencing primer can be used for the methylation level in two sites in primary hepatoma and carries out detection by quantitative.

Claims (6)

1. the related people NUDT2 of hepatocarcinoma (Nudix (Nucleoside Diphosphate Linked Moiety X)- Type Motif 2, nucleoside diphosphate coupling part X-type motif 2) gene methylation site, its feature It is:Methylate between chip examination primary hepatoma and methylome in corresponding cancer beside organism Difference, find in the DNA of primary hepatoma, a site of NUDT2 gene The methylation level of cg04322134 is significantly lower than the other group of cancer, and difference has significance, this specificity position Putting the nucleotide sequence being located is: CACCTACTTTCCTATCTTTCATCCCCATATCTCTGCCTTTTCTTCAGCAA TTATCTTGAACGCCACTTCTCTCACTTTGGGAGACTAAACTCTTGAGT CCCAAAGCCTTCTTGCTTTTGAAC;At underscore, base is the definite of methylation sites Position, this site is away from 620 bases of transcriptional start site.
2. the related NUDT2 gene methylation site of hepatocarcinoma described in claim 1 and application it is characterised in that: Pyrosequencing standard measure detects people NUDT2 gene-specific methylation site cg04322134, special The primer of different in nature methylation sites includes PCR primer and the sequencing primer that methylates, wherein, described PCR upstream primer sequence is:5 '-AGAAGGTTTTGGGATTTAAGAGTTTA-3 ', under Swimming primer sequence is:Biotin-5 '-TCCCCATATCTCTACCTTTTCTTC-3 ', methylates Sequencing primer sequence is:5’-GAGTTTAGTTTTTTAAAGTGAG-3’.
3. the related NUDT2 gene methylation site of hepatocarcinoma described in claim 1 and application it is characterised in that: Application pyrosequencing is in the detection of NUDT2 gene cg04322134 site methylation, primary There is significant difference with corresponding cancer beside organism in property hepatocarcinoma;This site methylates journey in hepatocarcinoma Degree significantly reduces;This site methylate quantitative information change into understand hepatocarcinoma pathogeny, find There is provided to the tumor prevention having potential clinical meaning and therapy target and support.
4. people PCDH8 (Protocadherin-8, protocalcium mucoprotein 8) gene methylation site it is characterised in that: The difference methylating between chip examination primary hepatoma and methylome in corresponding cancer beside organism, Find in the DNA of primary hepatoma, a site cg20366906 of PCDH8 gene Methylation level bright higher than the other group of cancer, difference has significance, the nucleic acid that this specific position is located Sequence is: ACGGTCATCGGGACCCTGGCCGAGGACCTGCATATGAAAGTATCGGG TGACACAAGCTTCCGCCTGATGAAGCAATTCAACAGCTCTCTGCTCC GGGTGCGCGAAGGCGACGGGCAGCTGAC;This site is away from transcriptional start site 393 Individual base.
5. the related PCDH8 gene methylation site of hepatocarcinoma described in claim 4 and application it is characterised in that: Pyrosequencing standard measure detects people PCDH8 gene-specific methylation site cg20366906, special The primer of different in nature methylation sites includes PCR primer and the sequencing primer that methylates, wherein, described PCR upstream primer sequence is:5 '-TGTTGGGTGTTTTTAGTGGT-3 ', downstream primer sequence It is classified as:Biotin-5 '-CACTACCAAACCTAACCACACAACC-3 ', the sequencing that methylates is drawn Thing sequence is:5’-ATTTTGGTAGAGGATTTGTATATG-3’.
6. the related PCDH8 gene methylation site of hepatocarcinoma described in claim 4 and application it is characterised in that: Application pyrosequencing detects to PCDH8 gene cg20366906 methylation, constitutional There is significant difference with corresponding cancer beside organism in hepatocarcinoma;This site methyl in primary hepatocarcinoma Change degree significantly raises.This site methylate quantitative information change into understand hepatocarcinoma pathogeny, Search out the tumor prevention of potential clinical meaning and therapy target provides and supports.
CN201510546489.7A 2015-09-01 2015-09-01 The detection and application in people's NUDT2 and PCDH8 gene methylation site Active CN106480019B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510546489.7A CN106480019B (en) 2015-09-01 2015-09-01 The detection and application in people's NUDT2 and PCDH8 gene methylation site

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510546489.7A CN106480019B (en) 2015-09-01 2015-09-01 The detection and application in people's NUDT2 and PCDH8 gene methylation site

Publications (2)

Publication Number Publication Date
CN106480019A true CN106480019A (en) 2017-03-08
CN106480019B CN106480019B (en) 2019-05-17

Family

ID=58235258

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510546489.7A Active CN106480019B (en) 2015-09-01 2015-09-01 The detection and application in people's NUDT2 and PCDH8 gene methylation site

Country Status (1)

Country Link
CN (1) CN106480019B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113981099A (en) * 2021-12-09 2022-01-28 杨小丽 Detection method and application of human AURKB and TM4SF20 gene methylation sites
WO2023052411A1 (en) * 2021-09-30 2023-04-06 Université De Genève Treatment of nudt2 mutation
CN116064797A (en) * 2022-08-29 2023-05-05 广州达健生物科技有限公司 Endometrial cancer gene methylation level detection reagent and application thereof
EP4047102A4 (en) * 2019-10-14 2024-04-17 Gencurix Inc. Composition for diagnosing liver cancer by using cpg methylation changes in specific genes, and use thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012162139A1 (en) * 2011-05-20 2012-11-29 The Regents Of The University Of California Method to estimate age of individual based on epigenetic markers in biological sample

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012162139A1 (en) * 2011-05-20 2012-11-29 The Regents Of The University Of California Method to estimate age of individual based on epigenetic markers in biological sample

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
CHRISTINA THIRLWELL等: "Genome-wide DNA methylation analysis of archival formalin-fixed paraffin-embedded tissue using the Illumina Infinium HumanMethylation27 BeadChip", 《METHODS》 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4047102A4 (en) * 2019-10-14 2024-04-17 Gencurix Inc. Composition for diagnosing liver cancer by using cpg methylation changes in specific genes, and use thereof
WO2023052411A1 (en) * 2021-09-30 2023-04-06 Université De Genève Treatment of nudt2 mutation
CN113981099A (en) * 2021-12-09 2022-01-28 杨小丽 Detection method and application of human AURKB and TM4SF20 gene methylation sites
CN113981099B (en) * 2021-12-09 2023-12-29 杨小丽 Detection method and application of methylation sites of human AURKB and TM4SF20 genes
CN116064797A (en) * 2022-08-29 2023-05-05 广州达健生物科技有限公司 Endometrial cancer gene methylation level detection reagent and application thereof
CN116064797B (en) * 2022-08-29 2023-10-20 广州达健生物科技有限公司 Endometrial cancer gene methylation level detection reagent and application thereof

Also Published As

Publication number Publication date
CN106480019B (en) 2019-05-17

Similar Documents

Publication Publication Date Title
CN108866192A (en) Tumor marker STAMP-EP1 based on methylation modification
Hu et al. RNA over-editing of BLCAP contributes to hepatocarcinogenesis identified by whole-genome and transcriptome sequencing
ES2510842T3 (en) Gene associated with liver cancer, and method for determining the risk of acquiring liver cancer
CN109554476A (en) Tumor marker STAMP-EP3 based on methylation modification
CN106011292A (en) Kit for detecting methylation of lung cancer-associated gene SHOX2 (short stature homebox2)
CN110257525A (en) There is the marker and application thereof of conspicuousness to diagnosing tumor
KR20150067151A (en) Method for screening cancer
CN108866191A (en) Tumor marker STAMP-EP2 based on methylation modification
CN106480019A (en) The detection in people NUDT2 and PCDH8 gene methylation site and application
CN109456968A (en) Tumor marker STAMP-EP5 based on methylation modification
JP6395131B2 (en) Method for acquiring information on lung cancer, and marker and kit for acquiring information on lung cancer
CN109371138A (en) Tumor marker STAMP-EP4 based on methylation modification
CN109652541A (en) Tumor marker STAMP-EP6 based on methylation modification
CN108913777A (en) The relevant marker of the DNA methylation of diagnosing tumour and its application
CN113528669A (en) Method for revealing action mechanism of miRNA on liver cancer by Small RNA sequencing technology
CN109971860A (en) Tumor marker STAMP-EP8 and its application based on methylation modification
CN106544403A (en) Can be used to detect kit and the application of TM4SF1 and NPY gene specific methylation sites
Bhat et al. DNA methylation detection at single base resolution using targeted next generation bisulfite sequencing and cross validation using capillary sequencing
CN106544406B (en) The primer of quantitative detection SLC2A14 and STON2 gene specific site methylation level and application
CN110055330A (en) Tumor marker STAMP-EP9 and its application based on methylation modification
CN109988844A (en) Tumor marker STAMP-EP7 and its application based on methylation modification
CN110117660A (en) It can be used for the marker STAMP-EP11 and its detection reagent of tumour identification
US8372587B2 (en) Proliferative disease detection method
CN106480169B (en) The detection and application in people's AQP10 and SOX17 gene methylation site
CN113981099B (en) Detection method and application of methylation sites of human AURKB and TM4SF20 genes

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant