CN106479989A - CectGPDH2 gene and its application - Google Patents
CectGPDH2 gene and its application Download PDFInfo
- Publication number
- CN106479989A CN106479989A CN201610818467.6A CN201610818467A CN106479989A CN 106479989 A CN106479989 A CN 106479989A CN 201610818467 A CN201610818467 A CN 201610818467A CN 106479989 A CN106479989 A CN 106479989A
- Authority
- CN
- China
- Prior art keywords
- gene
- cectgpdh2
- albumen
- plant
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8247—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01008—Glycerol-3-phosphate dehydrogenase (NAD+) (1.1.1.8)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Nutrition Science (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides a kind of CectGPDH2 gene and its purposes in terms of content of fatty acid is improved, the nucleotide sequence of the CectGPDH2 gene is as shown in SEQ ID NO.1.The gene source is in chlorella ellipsoidea (Chlorella ellipsoidea), 3 phosphate dehydrogenase of encoding glycerol, the enzyme take part in mitochondria G3P shuttle, electronics is provided for respiratory chain, it is the key enzyme of G3P synthesis, and connection one of glycometabolism and lipometabolic key enzyme, oil synthesis in plant body and energetic supersession are played an important role.The total fatty acid content of its seed can be significantly improved using the genetic transformation arabidopsis of the present invention and rape.The gene can be used to improve the oil content of plant cell, it can also be used to improve plant linoleic acid (C18:2) and eicosenoic acid (C20:1) content, has a good application prospect.
Description
Technical field
The present invention relates to a kind of glycerol-3-phosphoric desaturase gene CectGPDH2 and its application.In particular it relates to the base
Because of the acquisition of sequence and the structure of plant expression vector, and which can significantly improve model plant arabidopsis and oil crop seeds
The application of content of fatty acid.
Background technology
At present, consuming excessively and growing energy demand with traditional energy, energy problem is increasingly serious, can replace
Research and development for the energy becomes the focus of global focus of attention.Biodiesel mainly with the oil crops such as soybean, Jatropha curcas,
The microalgae of discarded food waste grease, animal fat and genetic engineering modified mistake is processed into liquid fuel as raw material, is
The high-quality novel renewable energy of conventional petroleum fuels can be substituted.And microalgae is high due to oil content, it is easy to cultivate, unit soil
Grease yield is far above other oil crops, it is considered to be one of most potential energy resources.
Micro-algae propagation ability is strong, low to growing environmental requirement, it is easy to cultivate, and photosynthetic efficiency is high, and oil content is high, but mesh
In front microalgae grease metabolic pathway, the research of key gene is also relatively fewer.Chlorella (Chlorella) is in microalgae
Class, belongs to Chlorophyta Chlorella, is the spherical monoplast green alga of photoautotrophy type, diameter about 3-8 micron.Bead algae propagation energy
Power is very strong, and containing abundant nutrient, such as protein, grease, polyunsaturated fatty acid, vitamin, mineral matter, food are fine
Dimension, nucleic acid and chlorophyll etc., also contain various bioactivators, such as glycoprotein, polysaccharide.Chlorella is that a few can use
Microalgae in large-scale culture.
In eucaryote (such as chlorella), the major storage form of grease is triacylglycerol (TAG), by glycerine -3- phosphorus
Sour (G3P) and acyl coenzyme A synthesize for precursor.Glycerol-3-phosphate dehydrogenase (Glycerol-3-phosphate
Dehydrogenase, GPDH) it is catalyzed the dihydroxyacetone phosphate (Dihydroxyacetone that produce in glycolytic cycle
Phosphate, DHAP) phase co-conversion between G3P, product G3P is the important source material for synthesizing TAG, and therefore, GPDH is connection
Glycometabolism and lipometabolic key enzyme.
G3P is that starch has been stored usually as photosynthetic end-product by phosphoglycerol, in plant
Come, the main source of glycerine be by amylolytic glucose being sent into glycolytic cycle, glycolysis intermediate product being converted
For glycerine.And in microalgae, the microalgae of some species can produce substantial amounts of glycerine while starch is accumulated, as photosynthesis
End-product store.Therefore, in microalgae, mainly there are two different glycerine route of synthesis, the first utilizes light cooperation
With glycerine is directly synthesized, another is by decomposition reserve substance, starch and sucrose decomposition is become fructose-1, 6-diphosphate, is changed afterwards
For DHAP, then be catalyzed by glycerol-3-phosphate dehydrogenase, G3P is generated, glycerine is generated finally by dephosphorylation.From microalgae
In view of position of the GPDH in oil synthesis metabolism, the reaction for being changed into G3P by DHAP is catalyzed by GPDH is that glycerine synthesizes
The committed step of approach, GPDH take part in mitochondria G3P shuttle, be respiratory chain provide electronics, be G3P synthesis key enzyme it
One, and G3P is the important source material of TAG and phosphatide synthesis, and GPDH is connected to glycometabolism and lipid metaboli, to grease in plant body
Synthesis and energetic supersession play an important role.
According to GPDH, position is different in the cell, is classified as three types isodynamic enzyme cytoplasm type GPDH
(ctGPDH), chloroplaset type GPDH (cpGPDH) and Mitochondrial form GPDH (mGPDH).The preference catalysis in the cell of every kind of isodynamic enzyme
The positive reaction of phase co-conversion or back reaction between DHAP and G3P, coenzyme type are different (using FAD or NADH/NADPH as auxiliary
Enzyme), by different condition abduction delivering (osmotic stress, heat shock, oleic acid stress etc.), and have now been found that in different plant species
GPDH isodynamic enzyme quantity is different.
Cytoplasm type glycerol-3-phosphate dehydrogenase (Cytosolic glycerol-3-phosphate
Dehydrogenase, ctGPDH) (EC1.1.1.8) be a glycerol-3-phosphate dehydrogenase with NADH as coenzyme, positioned at thin
In kytoplasm, the reaction that major catalytic DHAP changes to G3P.CtGPDH and mitochondria glycerol-3-phosphate dehydrogenase
(Mitochondrial glycerol-3-phosphate dehydrogenase, mGPDH) take part in mitochondria G3P together and wear
Shuttle.CtGPDH is catalyzed DHAP in kytoplasm and is changed into G3P, NADH and is changed into NAD+, subsequent G3P is transported to adventitia in mitochondria
Between, it is changed into DHAP under the catalysis of mGPDH, while wearing ground chain to electronics to contribute two electronics, subsequent DHAP passes through line grain
External film is returned in kytoplasm.
Have been reported that and show that green tea catechin has inhibitory action to the activity of GPDH.CtGPDH is considered as synthesizing in cell glycerine
With play a major role in triacylglycerol accumulation approach.Research shows, by the yeast under the control of rape seed specificity promoter
CtGPDH proceeds to rape, and transgenic line glycerol content is up to four times of wild type, and seed total fatty acid content highest is improved
40%, 81.4 ± 10mg/g fresh weight (the pollination seed of latter 30 days) is reached, aliphatic acid composition does not have significant change, and ripe kind
Son is planted cane sugar content and is declined, but protein content does not have significant change.But total fat content of mature seed and TFA
Content does not provide data.Under the osmotic stress of certain limit concentration, the expression of cell ctGPDH can be caused to increase, and then
Cause Glycerol accumulation.
Not yet there is the ctGPDH gene from plant oil content in plants can be greatly improved and improves plant at present
Linoleic acid (C18:2) and eicosenoic acid (C20:1) report of content.
Content of the invention
It is an object of the invention to provide a kind of glycerol-3-phosphoric desaturase gene CectGPDH2 and its application.
Present invention firstly provides from the CectGPDH2 albumen of chlorella ellipsoidea (Chlorella ellipsoidea), its
For
A albumen that the amino acid sequence of () shown in SEQ ID NO.2 constitutes；Or
(b) by the amino acid sequence of SEQ ID NO.2 through one or several amino acid residues replacement and/or disappearance
And/or the albumen of protein function of the interpolation derived from SEQ ID NO.2 and shown in holding SEQ ID NO.2；
The invention provides encoding the gene of CectGPDH2 albumen, its nucleotides sequence is classified as：
I) nucleotide sequence shown in SEQ ID NO.2；Or
Ii) nucleotide sequence shown in SEQ ID NO.2 be substituted, lack and/or increase one or more nucleotides and
The nucleotide sequence of expression identical function albumen；Or
Iii) under strict conditions with sequence hybridization shown in SEQ ID NO.2 and express identical function protein nucleotides
Sequence, the stringent condition be in 0.1 × SSPE containing 0.1%SDS or 0.1 × SSC solution containing 0.1%SDS, at 65 DEG C
Lower hybridization, and film is washed with the solution；Or
Iv) and i), ii) or nucleotide sequence iii) there is more than 90% homology and express identical function protein
Nucleotide sequence.
The invention provides the biomaterial containing said gene, the biomaterial is recombinant expression carrier, expression cassette,
Recombinant bacterium or host cell.
The recombinant expression carrier that can use existing plant expression vector construction to contain CectGPDH2 gene.The plant table
Reaching carrier includes double base agrobacterium vector and can be used for carrier of plant micropellet bombardment etc..Gene constructed heavy using CectGPDH2
During group expression vector, can be plus any enhancement mode, composing type, organizing specific type or induction before its transcription initiation nucleotides
Type promoter, they can be used alone or be used in combination with other plant promoters；Additionally, using CectGPDH2 gene structure
When recombinant expression carrier is built, enhancer is it is also possible to use, including translational enhancer or transcriptional enhancer, these enhancer regions are permissible
It is ATG initiation codon or neighboring region initiation codon etc., but must be identical with the reading frame of coded sequence, whole to ensure
The correct translation of sequence.The source of the translation control signal and initiation codon is extensive, can be natural, it is also possible to
It is synthesis.Translation initiation region can come from transcription initiation region or structural gene.For the ease of to transgenic plant cells
Or plant is identified and screened, plant expression vector used can be processed, such as be added in expression in plant and can produce face
The gene of the enzyme of color change or luminophor, the antibiotic marker thing with resistance or anti-chemical reagent marker gene etc..
From the security consideration of genetically modified plants, any selected marker can be not added with, be directly turned as phenotypic screen with flowering time
Change plant.
The invention provides CectGPDH2 albumen or its encoding gene or the biomaterial containing the encoding gene are being improved
Application in cell Linoleic acid content.
The invention provides CectGPDH2 albumen or its encoding gene or the biomaterial containing the encoding gene are being improved
Application in cell in eicosenoic acid content.
The invention provides CectGPDH2 albumen or its encoding gene or the biomaterial containing the encoding gene are being improved
Application in cell in total fatty acid content.
In above-mentioned application, the cell is yeast cells, plant cell or alga cells.
Further, the yeast is saccharomyces cerevisiae；The algae is chlorella；The plant be rape, arabidopsis, to
Day certain herbaceous plants with big flowers, soybean, tomato, castor-oil plant, sesame or peanut.
Further, the saccharomyces cerevisiae is uracil-deficient type saccharomyces cerevisiae INVSC1；The chlorella is oval
Chlorella (Chlorella ellipsoidea)；The plant is preferably rape and arabidopsis.
The invention provides prepared by CectGPDH2 albumen or its encoding gene or the biomaterial containing the encoding gene
Application in genetically modified plants.
The chlorella ellipsoidea GPDH gene that the present invention is provided, can be applicable to improve yeast, plant using gene engineering method
Or algae fat content.
The invention provides CectGPDH2 albumen or its encoding gene or the biomaterial containing the encoding gene are in production
Application in edible oil or biodiesel.
The invention provides CectGPDH2 albumen or its encoding gene or the biomaterial containing the encoding gene are in plant
Application in germ plasm resource improvement.
Present invention discover that proceeding to the CectGPDH2 gene from chlorella ellipsoidea after model plant arabidopsis, can show
Write the content for improving main fatty acid component in seed.Six kinds of main fatty acid groups of 3 strain seeds of transgenic arabidopsis
In point, palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1) and leukotrienes (C18:3) changes of contents is not notable, sub-
Oleic acid (C18:2) content has been respectively increased about 20.26%, 15.52% and 20.26%, eicosenoic acid (C20:1) content is carried respectively
High about 35.35%, 13.48% and 27.62%.The total fatty acid content of transgenic arabidopsis seed has also been respectively increased about
26.31%th, 13.47% and 20.69%.Study in arabidopsis seed and show, turn CectGPDH2 gene strain seed and compare
Group (wildtype Arabidopsis thaliana seed) is compared, and total fatty acid content significantly improves about 26.31%, 13.47% and respectively
20.69%, and the content of its part main fatty acid component is also obviously improved, wherein palmitic acid (C16:0), stearic acid
(C18:0), oleic acid (C18:1) and leukotrienes (C18:3) changes of contents is not notable, linoleic acid (C18:2) significantly improve respectively
About 20.26%, 15.52% and 20.26%, eicosenoic acid (C20:1) about 35.35%, 13.48% and 27.62% are improve.Single
It is rare that individual gene causes that the content of TFA and variant aliphatic acid reaches so far.
It has also been found that proceeding to the CectGPDH2 gene from chlorella ellipsoidea after oil crops rape, can show
Write the content for improving main fatty acid component in seed.Total fatty acid content highest improves 22.3%.Its Linoleic acid (C18:
2) content has averagely been respectively increased about 23.51%, eicosenoic acid (C20:1) content has averagely been respectively increased about 37.15%.Therefore
The gene pairs improvement oil crops have preferable application prospect.
Description of the drawings
Fig. 1 is the structure figure of the plant expression vector of the gene of CectGPDH2 containing chlorella ellipsoidea.
Each fatty acid component content and total fatty acid content in the transgenic arabidopsis seed that Fig. 2 is determined for GC-MS method
Comparison diagram, WT are control, and CectGPDH-1, CectGPDH-2 and CectGPDH-3 are the arabidopsis seed for turning CectGPDH gene
Determination of fatty acid.
Specific embodiment
Following examples are used for the present invention to be described, but are not limited to the scope of the present invention.If not specializing, embodiment
All according to conventional laboratory conditions, such as Sambrook equimolecular Cloning: A Laboratory Manual (Sambrook J＆Russell DW,
Molecular Cloning:A Laboratory Manual, 2001), or the condition according to manufacturer's specification suggestion.With
Quantitative experiment in lower embodiment, is respectively provided with three times and repeats experiment, results averaged.
The acquisition of 1 chlorella ellipsoidea CectGPDH gene cDNA total length of embodiment
Take culture exponential phase chlorella ellipsoidea (the coming from Inst. of Hydrobiology, Chinese Academy of Sciences) algae of 3-4 days
Liquid, is placed in liquid nitrogen after frond is collected by centrifugation and is fully ground.With reference to Ai Delai EASYspin RNA extracts kit specification and
Takara DNase I specification carries out Total RNAs extraction and purifying.Reverse transcription is carried out with the primer of band polyT cDNA is obtained, and
Carry out RT-PCR (TOYOBO ReverTra Ace- α kit is shown in concrete operations).
The synthetic reaction condition of cDNA is as follows：
With RNase Free H2It is 20 μ L that O is mended to cumulative volume.Carry out by following program after flicking mixing brief centrifugation inverse
Responsive transcription：30 DEG C of 10min, 42 DEG C of 30min, 99 DEG C of 5min, 4 DEG C of 5min.
Take in right amount above-mentioned reverse transcription product with ATGCGCTGGTCCAAGGTG and TCACCTCTCTTCTATTTGAGG as a pair
Primer enters performing PCR amplification.
PCR reaction condition is as follows：95℃5min；94 DEG C of 30s, 53 DEG C of 30s, 72 DEG C 3min, 30-35 circulation；72℃
10min, 4 DEG C of preservations.
Glue reclaim purpose fragment (CectGPDH2, about 1kb) is cut after PCR primer electrophoresis (1% Ago-Gel concentration), even
Enter pCAMBIA2301 carrier (purchased from CAMBIA company), sequence verification obtains full-length cDNA (the SEQ ID of CectGPDH2
NO.1).The amino acid sequence of its encoding proteins is as shown in SEQ ID NO.2.
The structure of plant expression vector of the embodiment 2 containing CectGPDH2 gene
From CAMBIA company plant expression vector pCAMBIA2301 as CeGPDH gene plant expression vector.By
The suitable promoter in direction and terminator are not started near pCAMBIA2301 vector multiple cloning site area, therefore from band
(using pUC18 carrier as skeleton, laboratory is self-built, ammonia used as intermediate carrier the carrier pT305R of promoter and terminator
Benzyl chloramphenicol resistance), CeGPDH2 gene is connected to the MCS area between the promoter-terminator on pT305R, reselection
Promoter upstream and terminator downstream restriction enzyme site cut the complete sequence with promoter-CectGPDH- terminator, should
Sequence is inserted into pCAMBIA2301 vector multiple cloning site area, builds and completes CeGPDH-2301 plant expression vector, its carrier
Figure is shown in Fig. 1.
3 plant expression vector CeGPDH-2301 of embodiment converts Agrobacterium
Fresh for 50 μ L Agrobacterium competent cell is placed on ice, plus DNA obtained in 1 μ g embodiment 2 is CeGPDH-
2301 plant expression vectors, place 30min on ice after mixing.Proceeded to after quick-frozen 1min rapidly in liquid nitrogen in 37 DEG C of water-baths and place
5min.The YEP fluid nutrient medium of 1mL antibiotic-free is added, 28 DEG C, 230rpm cultivates 2-4h.3,000rpm centrifugation 2min is collected
Thalline, stays the resuspended thalline of 100 μ L liquid, coats YEP solid medium (containing 50 30 μ L/ of μ L/100mL, rif of kan
On 100mL), 28 DEG C of culture 24-48h.
After 24-48h, the picking colony from culture medium flat plate, carry out bacterium colony PCR checking.Finally to being verified as positive bacterium
Drop into capable preservation.
Expression of embodiment 4CectGPDH2 in arabidopsis
Arabidopsis is proceeded to CectGPDH2 gene by agriculture bacillus mediated utilization vacuumizing method.Infect the previous day pour permeable,
Remove blooming flower and the silique for having grown up to.The CectGPDH2 agrobacterium strains glycerol tube that turns of embodiment 3 is inoculated in by 1%
In 5mL YEP culture medium (containing 50 30 μ L/100mL of μ L/100mL, rif of kan), 28 DEG C are placed in, 200rpm shaken overnight.Take
Incubated overnight bacterium solution is according to 1:50 ratio is inoculated in 100mL YEP resistance fluid nutrient medium, is placed in 28 DEG C, and 200rpm shakes
Cultivate to OD600=1-2.5,000rpm centrifugation 5min collects thallines, thalline are resuspended in 250mL and are infected in buffer solution
(0.015%Silwet L-77,5% sucrose, 10mMMgCl2).Arabidopsis is inverted in after the vial equipped with bacterium solution and is placed in very
In slack tank, adjust vacuum pump pressure and 10min is vacuumized for 200Mbar.
In T0 generation, infects rear arabidopsis seed and is placed in 4 DEG C of immersions breaking dormancy on the 2nd, after soaking 30min in 20% disinfectant
With rinsed with sterile water 3 times, it is seeded on S0 (1/2MS) culture medium containing antibiotic (300 μ g/L of Kan50 μ g/L, Carb).22
DEG C long-day cultivates two weeks or so visible seedling, and now resistant plant is dark green, and cotyledon is complete；And unconverted plant is in Huang
Color or canescence, cotyledon shrinkage.In selecting resistant plant to transplant to the Nutrition Soil for adding vermiculite, until harvest individual plant T1 generation planting
Son.PCR identification and GUS dyeing filter out positive plant, repeat screening process until obtaining T5 for positive pure and mild seed, after being used for
Continuous aliphatic acid is extracted and detection.
The extraction of 5 arabidopsis Fatty Acids in Seeds of embodiment and detection
1. the extraction of arabidopsis Fatty Acids in Seeds obtained in embodiment 4
The arabidopsis seed for weighing 30mg drying is fully ground, and adds 3mL 7.5%KOH-CH3OH, plus 15-20 μ L
d17:0 (purchased from sigma company, concentration 27mg/mL), 70 DEG C of water-bath 3-5h；Add 2mL HCl to be acidified to its pH value and reach 2.0；Plus
Enter 2mL 14%BF3-CH3OH (purchased from Aldtich company) solution, 70 DEG C of water-bath 1.5h；Add 1mL0.9%NaCl solution, 4mL
N-hexane is extracted once, N2Dry up；300 μ L ethyl acetate dissolve.Every time each sample is parallel does two parts for the experiment, repeats three altogether
Secondary.
2. end-product GC-MS detection and analysis experiment
GC/MS instrument used is TurboMass (PerkinElmer company)；GC condition：Chromatographic column：BPX-70,30m ×
0.25mm×0.25um.Column temperature：120 DEG C, gasify 230 DEG C of room temperature.Take 1 μ L end-product loading, split ratio 10:1.
3.GC-MS interpretation of result
Research shows, turns CectGPDH2 gene arabidopsis strain compared with control group (wildtype Arabidopsis thaliana), its seed
Total fatty acid content significantly improves about 26.31%, 13.47% and 20.69%, and the content of part main fatty acid component
It is significantly improved, wherein palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1) and leukotrienes (C18:3) changes of contents
Not notable, linoleic acid (C18:2) about 20.26%, 15.52% and 20.26%, eicosenoic acid (C20 are improve:1) improve about
35.35%th, 13.48% and 27.62%.In the arabidopsis seed that GC-MS is determined, each fatty acid component and assay result are shown in
Fig. 2.
Embodiment 6Floral-dip method conversion rape (westar)
The cabbage type rape plant of initial bloom stage is selected to process, front l d field is poured permeable.Remove main inflorescence and each branch flower
The top bud of sequence, while removing the flower for opening, only retaining the bud for soon opening is used for converting.
The embodiment 3 for containing target gene CeGPDH2 with 28 DEG C of incubated overnight of culture medium of the fresh YEP+kan of 10ml is made
The Agrobacterium of the CeGPDH-2301 plant expression vector for obtaining is to next day 10：00, then take 5ml and proceed to the fresh YEP+kan of 100ml
Culture medium, incubated overnight 22h.2 500rpm are centrifuged Agrobacterium bacterium solution, and after abandoning supernatant, (MS is basic to convert Bufer with 100ml
Culture medium+sucrose 5%+Silwet-77, pH5.8) resuspended to OD600Brassica napus inflorescence is impregnated after=1.0.In 10d, interval l d is continuous
Process 5 times.Paper bag in rear enclosure is impregnated.Paper bag is removed after impregnation process 24h until harvesting seed.
The screening of 7 transgene rape of embodiment
To the rape T1 of embodiment 6 that obtains after impregnation process for seed through 75% alcohol surface sterilization 30s, 0.1%
HgCl2Sterilization 10min, is layered on screening and culturing medium good in advance, through 7～15d screening and culturing, by the green seedling of normal growth
The 2nd resistance screening (7～15d) is carried out, the resistant plant after the 2nd time is screened carries out the 3rd resistance screening (7～15d), the
2 times, the 3rd time screening and culturing medium is：Ms+Kan(150mg/L).Green seedling after third time is screened proceeds to flowerpot, and hot-house culture is extremely
Seed is harvested.The seed of results is carried out screening of future generation, the transgene rape seed for choosing for the 3rd generation altogether carries out fatty acid composition
Measure with content.
The extraction of 8 rape seed aliphatic acid of embodiment and detection
1. the extraction of transgene rape Fatty Acids in Seeds：Extracting method is with embodiment 5.
2. end-product GC-MS detection and analysis experiment：Detection method is with embodiment 5.
3.GC-MS interpretation of result
Research shows, turns CectGPDH2 vector for transgenic rape strain T01, T02 and T03 and control group (wild type westar) phase
Than the total fatty acid content of its seed significantly improves about 20.4%-28.32%, and the content of part main fatty acid component
It is also obviously improved, its Linoleic acid (C18:2) about 19.01%-29.74%, eicosenoic acid (C20 are improve:1) improve about
32.35%-37.18%.Other fatty acid components do not observe significant changes.Therefore CectGPDH2 gene pairs improvement oil plant is made
Thing, improves crop oil production effect is significant, with preferable application prospect.
Although, above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.
Claims (10)
1.CectGPDH2 albumen, which is
A albumen that the amino acid sequence of () shown in SEQ ID NO.2 constitutes；Or
(b) by the amino acid sequence of SEQ ID NO.2 through the replacement of one or several amino acid residues and/or disappearance and/or
Add derived from SEQ ID NO.2 and keep the albumen of the protein function shown in SEQ ID NO.2.
2. the gene of CectGPDH2 albumen described in claim 1 is encoded, and its nucleotides sequence is classified as：
I) nucleotide sequence shown in SEQ ID NO.2；Or
Ii) nucleotide sequence shown in SEQ ID NO.2 is substituted, lacks and/or increases one or more nucleotides and expression
The nucleotide sequence of identical function albumen；Or
Iii) under strict conditions with sequence hybridization shown in SEQ ID NO.2 and express identical function protein nucleotides sequence
Row, the stringent condition be in 0.1 × SSPE containing 0.1%SDS or 0.1 × SSC solution containing 0.1%SDS, at 65 DEG C
Hybridization, and film is washed with the solution；Or
Iv) and i), ii) or nucleotide sequence iii) there is more than 90% homology and express the nucleosides of identical function protein
Acid sequence.
3. the biomaterial containing gene described in claim 2, the biomaterial are recombinant expression carrier, expression cassette, restructuring
Bacterium or host cell.
4. the CectGPDH2 albumen described in claim 1 or the gene described in claim 2 or the biology described in claim 3
Application of the material in cell Linoleic acid content is improved.
5. the CectGPDH2 albumen described in claim 1 or the gene described in claim 2 or the biology described in claim 3
Application of the material in cell is improved in eicosenoic acid content.
6. the CectGPDH2 albumen described in claim 1 or the gene described in claim 2 or the biology described in claim 3
Application of the material in cell is improved in total fatty acid content.
7. the application as described in claim 4-6 is arbitrary, it is characterised in that the cell is yeast cells, plant cell or algae
Class cell.
8. application as claimed in claim 7, it is characterised in that the yeast is saccharomyces cerevisiae；The algae is chlorella；Institute
Plant is stated for rape, arabidopsis, sunflower, soybean, tomato, castor-oil plant, sesame or peanut.
9. the CectGPDH2 albumen described in claim 1 or the gene described in claim 2 or the biology described in claim 3
Application of the material in prepare transgenosis plant.
10. the CectGPDH2 albumen described in claim 1 or the gene described in claim 2 or the biology described in claim 3
Application of the material in production edible oil or biodiesel.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610818467.6A CN106479989A (en) | 2016-09-12 | 2016-09-12 | CectGPDH2 gene and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610818467.6A CN106479989A (en) | 2016-09-12 | 2016-09-12 | CectGPDH2 gene and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106479989A true CN106479989A (en) | 2017-03-08 |
Family
ID=58273523
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610818467.6A Pending CN106479989A (en) | 2016-09-12 | 2016-09-12 | CectGPDH2 gene and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106479989A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108034666A (en) * | 2017-12-25 | 2018-05-15 | 大连民族大学 | Sea-buckthorn GPD1 genes |
| CN108165566A (en) * | 2017-12-25 | 2018-06-15 | 大连民族大学 | The construction method of sea-buckthorn GPD1 genes |
| CN110564759A (en) * | 2019-08-09 | 2019-12-13 | 中国科学院遗传与发育生物学研究所 | Application of increasing content of fatty acid in leguminous plants in promoting root nodule formation |
-
2016
- 2016-09-12 CN CN201610818467.6A patent/CN106479989A/en active Pending
Non-Patent Citations (1)
| Title |
|---|
| 李帅: "椭圆小球藻甘油-3-磷酸脱氢酶基因（GPDH）的克隆与功能验证", 《中国科学院大学硕士学位论文》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108034666A (en) * | 2017-12-25 | 2018-05-15 | 大连民族大学 | Sea-buckthorn GPD1 genes |
| CN108165566A (en) * | 2017-12-25 | 2018-06-15 | 大连民族大学 | The construction method of sea-buckthorn GPD1 genes |
| CN108034666B (en) * | 2017-12-25 | 2021-01-12 | 大连民族大学 | Seabuckthorn GPD1 gene |
| CN110564759A (en) * | 2019-08-09 | 2019-12-13 | 中国科学院遗传与发育生物学研究所 | Application of increasing content of fatty acid in leguminous plants in promoting root nodule formation |
| CN110564759B (en) * | 2019-08-09 | 2021-08-27 | 中国科学院遗传与发育生物学研究所 | Application of increasing content of fatty acid in leguminous plants in promoting root nodule formation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107723294B (en) | Saccharum officinarum transport protein ShSWEET2 gene and application thereof | |
| CN106479989A (en) | CectGPDH2 gene and its application | |
| CN103882054A (en) | Method for transient expression of introducing exogenous gene into chrysanthemum or related species | |
| CN106011169A (en) | Agrobacterium-mediated spirodela polyrhiza stable transformation system establishment method | |
| CN104046636A (en) | Codon vegetalization-transformed PMI gene and applications thereof | |
| CN108101973B (en) | Chlorella ellipsoidea NF-YC gene and application thereof | |
| CN110358776A (en) | A kind of Rhizoctonia solani Kuhn pathogenic related gene and its application | |
| KR101679130B1 (en) | Composition for increasing seed size and content of storage lipid in seed, comprising bass2 protein or coding gene thereof | |
| CN107723295B (en) | Saccharum officinarum transport protein ShSWEET1 gene and application thereof | |
| CN107446928A (en) | One cauliflower allelotaxis regulates and controls miRNA sequence and its application | |
| CN103602688B (en) | Helianthus tuberosus L. Na<+>/H<+> reverse transport protein genes HtNHX1 and HtNHX2 and use thereof | |
| CN106929518B (en) | A kind of rubber tree HbAG genes and its application | |
| CN102732553B (en) | Improve the gene engineering method and material of plant products | |
| CN102260709B (en) | Use of key gene OsLSD2 associated with formation of rice aerenchyma | |
| CN107794278A (en) | A kind of quick transgenic method of comospore poplar based on hygromycin selection | |
| CN104357415B (en) | Cem GPDH (Glycerol-3-phosphate dehydrogenase) gene and application thereof | |
| CN103966220B (en) | The root-specific promoter of synthetic and application thereof | |
| CN106520723A (en) | Protein VvMas and encoding gene, and application thereof in improvement of salt tolerance of plants | |
| CN102295691B (en) | BCCP2 gene and application on enhancing lipid content of plant and algae thereof | |
| CN104988175A (en) | Application of tomato HsfAla gene to improving plant autophagosome activity and drought resistance | |
| CN102260686B (en) | Method for improving content of total grease, linoleic acid or alpha-linolenic acid in chlorella | |
| CN105713078A (en) | Application of drought-tolerance-related protein in regulating drought tolerance of plants | |
| Das Bhowmik et al. | Sugarcane biotechnology: tapping unlimited potential | |
| CN104877021A (en) | Rapeseed transcription factor BnFUS3 related to plant fatty acid and fat metabolism and coding gene and application thereof | |
| CN107936098B (en) | Chlorella ellipsoidea NF-YA gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170308 |