CN106479910A - A kind of lactic acid producing bargen's streptococcuses and its separation method - Google Patents
A kind of lactic acid producing bargen's streptococcuses and its separation method Download PDFInfo
- Publication number
- CN106479910A CN106479910A CN201610473872.9A CN201610473872A CN106479910A CN 106479910 A CN106479910 A CN 106479910A CN 201610473872 A CN201610473872 A CN 201610473872A CN 106479910 A CN106479910 A CN 106479910A
- Authority
- CN
- China
- Prior art keywords
- bargen
- streptococcuses
- culture
- lactic acid
- acid producing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/02—Separating microorganisms from their culture media
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/56—Lactic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/09—Lactobacillales, e.g. aerococcus, enterococcus, lactobacillus, lactococcus, streptococcus
- A61K39/092—Streptococcus
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention provides a kind of lactic acid producing bargen's streptococcuses, and its nucleotide includes sequence shown in SEQ NO.1, and the separation method of this bargen's streptococcus is as follows：1) prepare the enrichment culture base fluid containing soluble starch, and by sealing cooling after its high temperature sterilize deoxygenation, adjusting pH is 6.5 to 6.8；2) by the bacterium source of aseptic anaerobism collection according to 1：30～70 ratio and step 1) in prepare the enrichment culture base fluid of gained and be mixed in Anaerobic culturel container, after 37 DEG C of concussion and cultivates at least 24 hours, erect Anaerobic culturel container, continue quiescent culture at least 24 hours；3) preparative separation culture medium, after high temperature sterilize deoxygenation under anaerobic environment cool down, adjust pH be 6.5 to 6.8 after pour plate；4) picking step 2) in precipitate in culture vessel, coat plate for isolated culture, 37 to 39 DEG C of lucifuges are cultivated 24 to 36 hours under anaerobic, select surface wettability, glossy, color is milky round drop-wise bacterium colony, carries out separation and Culture.The method separation is simply efficient, selectivity is stronger.
Description
Technical field
The present invention relates to a kind of bargen's streptococcuses, more particularly, to a kind of lactic acid producing that can utilize amylofermentation output mixed acid
Bargen's streptococcuses, and the extracorporeal separation method of this bacterium, belong to microbial technology field.
Background technology
Bargen's streptococcuses (Streptococcus bovis) are the main Lactic Acid Producings of cud, are feeding high concentrate diet
Lead to the major incentive of cud lactic acidosises.Separation and Culture bargen's streptococcuses from ruminant tumor gastric, study its fermentation and acid and lead to
Road and major influence factors are by for finding the method suppressing the generation of its lactic acid (such as：Research and development of suppressive additive etc.) theory is provided
Reference, thus reach the mesh alleviating ruminant tumor gastric lactic acidosises by regulating and controlling the generation of bargen's streptococcuses lactic acid on producing
's.In addition, produce the feature of mixed acid using bargen's streptococcuses, detached cud source bargen's streptococcuses can be used for ruminant blue or green
Storage feed fermentation, improves and lactic acid bacteria is used as the fermentation pattern of the unification of fermentation strain merely.
At present, the research about bargen's streptococcuses is concentrated mainly on bargen's streptococcuses Microflora in the case of detection rumen ecology
Situation of change.Wang, et al. result of study finds, the quantity of bargen's streptococcuses increases severely after rumen ecology, directly discloses
Its pivotal role (Wang H, Pan X, Wang C, et al.Effects of different in induction rumen ecology
dietary concentrate to forage ratio and thiamine supplementation on the rumen
fermentation and ruminal bacterial community in dairy cows[J].Animal
Production Science,2015,55(2):189-193).Abroad, particularly European countries are by means of efficient antibacterial storehouse
Resource sharing platform, has researched and developed the antibiotic formulations that monensin etc. effectively kills cud bargen's streptococcuses
(McGuffey R K,Richardson L F,Wilkinson J I D.Ionophores for dairy cattle:
current status and future outlook[J].Journal of Dairy Science,2001,84:E194-
E203), and effective stimuluss ruminant produce anti-bargen's streptococcuses antibody vaccine etc. (Shu Q, Bird S H, Gill H S,
et al.Immunological cross-reactivity between the vaccine and other isolates
of Streptococcus bovis and Lactobacillus[J].FEMS Immunology&Medical
Microbiology,1999,26(2):153-158), provide feasible solution for preventing and treating rumen ecology aborning
Certainly scheme.However, causing related inflammation reaction so that depositing from external related strain of introducing because bargen's streptococcuses can infect the mankind
In certain risk, and it is more high to introduce cost.
Domestic laboratory has carried out the work of separation and Culture bargen's streptococcuses from cud, but related successful case report
Actually rare, it is primarily due to：(1) difficult construction strictly anaerobic environment：Cud source bargen's streptococcuses be anaerobe, anaerobe to point
Require from the anaerobic environment of, culture more strict, even if the micro oxygen that is mixed into is not result in that it is dead, but is likely to be of for a long time and draws
Play the possibility of its differentiation mutation, so that the partial loss of function under its anaerobism；(2) sorting culture medium does not have selectivity：Point
Select culture medium many with glucose as the energy, can be utilized by all antibacterials of almost cud, the partly antibacterial with bargen's streptococcuses antagonism
There is higher glucose competitiveness, thus suppression even produces harmful toxic matter and kills bargen's streptococcuses, lead to bargen's streptococcuses
In-vitro separation efficiency is very low；(3) bargen's streptococcuses bacterial plaque feature is unfamiliar with, leads to the leakage in screening process to be selected.
Content of the invention
It is an object of the invention to provide a kind of lactic acid producing bargen's streptococcuses, this bacterium can have and utilizes amylofermentation to produce well
Mixed acid.
The present invention also aims to providing a kind of separation method of lactic acid producing bargen's streptococcuses, the method is simply efficient, choosing
Selecting property is stronger, solves anaerobism and the bargen's streptococcuses strains separation of tool fermentation starch generation lactic acid does not have specificity, separation efficiency
A low difficult problem.
The present invention also aims to providing the application of above-mentioned lactic acid producing bargen's streptococcuses and its separation method.
To achieve these goals, technical scheme is as follows：
The invention provides a kind of lactic acid producing bargen's streptococcuses, its nucleotide sequence includes SEQ as shown in sequence table
NO.1.
The invention provides a kind of separation method of lactic acid producing bargen's streptococcuses as above, mainly comprise the steps：
(1) prepare enrichment culture base fluid：
With water as solute, being added thereto to mass ratio is 1.0% peptone, 0.5% yeast extract, and 1.0% beef carries
Take thing, 1.0% soluble starch, 0.2%K2HPO4, 0.1% Tween 80,0.02%MgSO4·7H2O, 0.005%MgSO4·
H2O, 0.2% ammonium citrate, 0.5%C2H3NaO2, and it is added thereto to "diazoresorcinol" sodium (final concentration of 20mg/L), as anaerobism
Indicator, sealing cooling after by the enrichment culture base fluid high temperature sterilize deoxygenation of configuration, adjusting pH is 6.5 to 6.8.Preferably,
The enrichment culture base fluid of configuration is put in high-pressure sterilizing pot and takes after the abundant deoxygenation at least 15 minutes of 115 to 121 DEG C of autoclavings
Go out sealing cooling.In enrichment culture base fluid component, with soluble starch as unique energy source so that other of starch cannot be utilized
Bacterium poor growth in enrichment culture base fluid, and bargen's streptococcuses can utilize starch, rapid propagation, forms dominant microflora.
(2) bacterium source dilution
By the bacterium source of aseptic anaerobism collection according to 1：The enrichment culture of prepared acquisition in 30～70 ratio and step (1)
Base fluid is mixed in Anaerobic culturel container, after 37 DEG C of concussion and cultivates at least 24 hours, erects Anaerobic culturel container, continues standing
Culture at least 24 hours.
(3) prepare solid separation culture medium
With water as solute, being added thereto to mass ratio is 1.0% peptone, 0.5% yeast extract, and 1.0% beef carries
Take thing, 1.0% soluble starch, 0.2%K2HPO4, 0.1% Tween 80,0.02%MgSO4·7H2O, 0.005%MgSO4·
H2O, 0.2% ammonium citrate, 0.5%C2H3NaO2, and it is added thereto to 1.5% agarose, by the isolation medium high temperature of configuration
Sterilizing deoxygenation after under anaerobic environment cool down, adjust pH be 6.5 to 6.8 after pour plate.Preferably, the isolation medium of configuration is put
115 to 121 DEG C of autoclavings take out immediately after at least 15 minutes and are transferred to cooling in anaerobism work station in the high-pressure sterilizing pot,
Adjusting pH is 6.5 to 6.8, and pours plate.
(4) the isolating and purifying of antibacterial
The culture fluid in the culture vessel in step (2) is abandoned in suction, retains precipitate.Because bargen's streptococcuses thalline is white,
And can occur after lactic acid producing to assemble sedimentation.Picking precipitates a little, coats the culture plate that separation and Culture pours, preferably agar culture
On plate, 37 to 39 DEG C of lucifuges are cultivated 24 to 36 hours under anaerobic, select surface wettability, glossy, color is milky
Round drop-wise bacterium colony, carry out the identification of lactic acid producing biochemical tube and Gram’s staining identification, select qualification result be lactic acid producing positive and
Gram-positive bacterium colony is further transferred to separation and Culture in new flat board.Preferably, repeat this step 4 times, separate and obtain
Pure bacterial strain.
Present invention also offers lactic acid producing bargen's streptococcuses as above and its separation method are in exploitation bargen's streptococcuses vaccine
And the application of novel fodder fermenting agent aspect.
The beneficial effect of technical scheme is：
1) extracorporeal separation method of the lactic acid producing bargen's streptococcuses that the present invention provides, can simply efficiently, selectivity strongly
Separate and screening bargen's streptococcuses bacterial strain.Wherein, with soluble starch as unique energy source so that other bacterium of starch cannot be utilized to exist
Poor growth in enrichment medium, and allow bargen's streptococcuses to utilize starch, rapid propagation, form dominant microflora, compared to
Using glucose as the prior art of the energy, the separation method that the present invention provides is higher to the selectivity of bargen's streptococcuses；Additionally,
In bacterium source dilution step, different from the sorting of " dilution enrichment culture liquid, be then seeded on flat board " commonly used in the prior art
Method, employs in the present invention and erects the standing method of at least 24 hours, makes bargen's streptococcuses occur to assemble to sink by erectting,
And produce the formation mucus glue white precipitate such as lactic acid, standing makes gathering sink to bottom for a long time, forms white precipitate,
So that sorting streptococcus are directly to select white depositions to carry out separation and Culture further, so that the purposiveness of method for separating
Higher；In addition, the standing of at least 24 hours is so that bargen's streptococcuses fermentation produces more lactic acid, it is left that pH is further decreased to 4.5
The right side, now nearly all antibacterial all cannot tolerate this low pH and total number is dead, but bargen's streptococcuses are resistant to low pH, thus without dead
Die, so that detached selectivity is higher.The extracorporeal separation method of the lactic acid producing bargen's streptococcuses that the present invention provides solves to be sent out
The anaerobism bargen's streptococcuses strains separation that ferment starch produces lactic acid is difficult, a difficult problem for low separation efficiency；
2) separate the bargen's streptococcuses bacterial strain purity obtaining and vigor is higher, can be used in vitro study rumen ecology condition
Lower its produces the change of sour path；In addition, separating the bacterial strain obtaining there is the ability that fermentation starch produces mixed acid, will be ruminant
Ensilage fermentation provides novel fermentation strain, has certain economic benefit.
Brief description
Fig. 1 is S1 environmental scanning electronic microscope figure.
Fig. 2 is S1 Gram’s staining figure.
Fig. 3 is that S1 produces the sour qualitative figure of LC-MS/MS.
Fig. 4 is that S1 is grown on rich in dextrose culture-medium growth curve chart.
Fig. 5 is S1PCR product electrophoretogram.
Fig. 6 is S1 sequencing peak figure.
Fig. 7 is S1 systematic growth tree graph.
Specific embodiment
In order to illustrate technical scheme and technical purpose, below in conjunction with the accompanying drawings and specific embodiment is to the present invention
It is described further.
Embodiment 1
The present embodiment 1 provides a kind of separation method of lactic acid producing bargen's streptococcuses, specifically includes following steps：
(1) bacterium source obtains
With feed essence slightly than for 7:3 diet feeding Yangzhou University's experiment agriculture and animal husbandry field healthy adult band rumen fistula Sa energy milk
Goat 15 days, induces it to produce acidosis, using the granted patent technology of Patent No. ZL201520957016.1, anaerobism is aseptic
Collection, the Sa energy milk goat rumen fluid of filtration fistula, load in aseptic aerobic sealing bag and seal.
(2) prepare enrichment medium
Weigh peptone 10.0g, yeast extract 5.0g, beef extract 10.0g, soluble starch 10.0g, K2HPO4
2.0g, Tween 80 1.0g, MgSO4·7H2O 0.2g, MgSO4·H2O 0.05g, ammonium citrate 2.0g, C2H3NaO25.0g
Afterwards, it is dissolved in 1L ultra-pure water, and the "diazoresorcinol" sodium of Deca 20 μ l 0.1% (mass fraction) thereto, it is put in autoclaving
In pot, 121 DEG C of autoclavings take out sealing cooling after 15 minutes, and adjusting pH is 6.8.
(3) bacterium source dilution, transport and preservation
By the rumen fluid of aseptic anaerobism collection according to 1：50 ratio and step (2) enrichment medium are mixed in Anaerobic culturel
In bottle, it is placed in 37 DEG C of heat insulation transportations, send into laboratory and continue to be positioned over concussion and cultivate in 37 DEG C of couveuses and, after 24 hours, establish
Anaerobic culturel bottle, continues quiescent culture 24 hours.
(4) preparative separation culture medium
Weigh peptone 10.0g, yeast extract 5.0g, beef extract 10.0g, soluble starch 10.0g,
K2HPO42.0g, Tween 80 1.0g, MgSO4·7H2O 0.2g, MgSO4·H2O 0.05g, ammonium citrate 2.0g, C2H3NaO2
After 5.0g, it is dissolved in 1L ultra-pure water, and is added thereto to 15.0g agarose, be put in 121 DEG C of high pressure in high-pressure sterilizing pot and go out
Bacterium is taken out immediately after 15 minutes and is transferred to cooling in anaerobism work station, adjusts pH for 6.8, pours plate.
(5) the isolating and purifying of antibacterial
Take out the culture bottle after quiescent culture, inhale and abandon culture fluid, retain bottom white precipitate.Because bargen's streptococcuses thalline is in
Can occur after white, and lactic acid producing to assemble sedimentation.With a little white precipitate of loop carrier picking, fine jade is spread evenly across using method of scoring
On fat culture plate, in anaerobism work station, 37-39 DEG C of lucifuge cultivates 24-36 hour, selects surface wettability, glossy, color is
Milky round drop-wise bacterium colony, carries out the identification of lactic acid producing biochemical tube and Gram’s staining identification, and selection qualification result is lactic acid producing
Positive and gram-positive bacterium colony is further transferred to separation and Culture in new flat board, repeats above procedure 4 times, separates and obtains
Pure bacterial strain.
(6) prepare Storaged media
Weigh peptone 10.0g, yeast extract 5.0g, beef extract 10.0g, soluble starch 5.0g, glucose
5.0g, K2HPO42.0g, Tween 80 1.0g, MgSO4·7H2O 0.2g, MgSO4·H2O 0.05g, ammonium citrate 2.0g,
C2H3NaO2After 5.0g, it is dissolved in 1L ultra-pure water, be put in high-pressure sterilizing pot 121 DEG C of autoclavings after 15 minutes, immediately
Taking-up is transferred to cooling in anaerobism work station, and adjusting pH is 6.8, afterwards with isopyknic sterile liquid glycerol 1:1 equal-volume mixes,
Homogenizer homogenizing, is sub-packed in cell cryopreservation tube standby.
(7) antibacterial after purification preserves
Choose the bacterium colony of pure bacterial strain with loop carrier, go in the cryopreservation tube containing Storaged media, spiral cover seals, and the shake that is vortexed
Swing 30 seconds, put into liquid nitrogen flash freezer, subsequently transfer to -80 DEG C of ultra cold storage freezers and preserve for a long time.
Embodiment 2
In the present embodiment 2, system identification is carried out to bacterium colony detached in example 1 above.
(1) Morphological Identification
Colonial morphology is observed and is found that bargen's streptococcuses new strains S1 bacterium colony is milky, moistens, glossy, circle drop-wise.Will
The bacterium colony being grown on agar plate digs out together with agar, puts into 2% glutaraldehyde and fixes 4 hours, after taking out lyophilization,
Using culture medium and thalline together technique for fixing, it has been observed that S1 bacterial strain is spherical in shape under environmental scanning electronic microscope, diameter is on 1 μm of left side
The right side, multiple cells join end to end in chain (Fig. 1).Wherein, technique for fixing is (i.e. together for culture medium and thalline：On agar plate
Bacterium colony dig out together with agar, put into 2% glutaraldehyde and fix 4 hours, rather than rinse bacterium colony with glutaraldehyde), it is to avoid
When coating sample stage after bacterium colony being selected using traditional method and observing, during choosing bacterium mechanical select so that chain even
Connect fracture.
(2) physicochemical property identification
Reference《The outstanding Bacteria Identification handbook of uncle》Carry out Gram’s staining and physicochemical characteristicses identification.Gram result shows in sun
Property (Fig. 2)；Produce (Fig. 3) such as sour result display lactic acid producing, formic acid, acetic acid.In conjunction with《The outstanding Bacteria Identification handbook of uncle》To bargen's streptococcuses
Define, tentatively draw S1 bacterial strain be can ferment starch produce acid bargen's streptococcuses bacterial strain.
(3) breed Performance Testing
In the enrichment culture liquid of the 10.0g/L containing glucose (not soluble-containing starch) that S1 inoculation to pH is 6.8,
This bacterial strain quickly can be rised in value using glucose, and batch culture reaches propagation plateau (Fig. 4) for 8 hours.
(4) 16S rRNA genome identification
Take S1 bacterial strain bacterium solution 2mL being in exponential phase, give birth to work Ezup pillar bacterial genomes extracts reagent with Shanghai
Box extracts this S1 bacterial strain DNA, as bacterial strain 16S rRNA gene amplification template.By Primer 6 software design amplimer
For：F：ATACATAGCCGACCTGAGA (SEQ NO.2), R：CCTACAATCCGAACTGAGAT (SEQ NO.3), transfers to Shanghai
Raw work synthesis.PCR reaction system is 25 μ L：10x Taq-buffer 2.5 μ L, dNTPs (2.5mmo l/L) 1 μ L, Ex Taq enzyme
0.2 μ L, each 0.5 μ L of F and R primer (10uM), sterilize tri-distilled water 19.8 μ L, because organizing template 0.5 μ L.Its amplification reaction condition is:
94 DEG C of denaturations 4min；94 DEG C of degeneration 45s, 55 DEG C of renaturation 45s, 72 DEG C of prolongation 1min, circulate 30 times；Repair for 72 DEG C and extend
10min.
Through 1% agarose gel electrophoresiies, PCR primer checks whether amplified fragments are purpose fragments.Result is shown as
1500bp about purpose fragment (Fig. 5).After being defined as purpose fragment, the bar of DNA mesh needed for the cutting of PCR primer electrophoretic band
Band, way of purification carries out according to description step, PCR primer PCR primer direct Sequencing after purification.Sequencing spectral peak in figure is each
Peak is stable, and no coincidence peak occurs, and the bacterial strain more pure (Fig. 6) for sequencing is described.Sequencing result sequence through with existing
Bargen's streptococcuses bacterial strain compares and finds, the pig source ATCC27960 (accession number of S1 bacterial strain and report：AB002481.1) cud source
JB1 (accession number：AF104109.1) bacterial strain homology height (Fig. 7), belongs to Streptococcus, bargen's streptococcuses kind altogether.This S1 bacterial strain is surveyed
Sequence sequence data is included by the GenBank data base of NCBI, and accession number is：KU853019.1(http://
www.ncbi.nlm.nih.gov/nuccore/KU853019.1).
Embodiment 3：
In the present embodiment 3, bargen's streptococcuses S1 is carried out with fermentation soluble starch and has produced formic acid, acetic acid and lactic acid analysis.
Take 2ml for the S1 bacterial strain of exponential phase, be inoculated into enrichment medium containing 100ml and (provide only 1g/L solubility
, as carbon source, other compositions are constant for starch) anaerobism bottle in, 37 DEG C of water-baths, Deca NaOH keeps that yeasting pH is constant is
6.5, in shaking table, 13 hours collection fermentation liquids of culture, measure the yield of formic acid, lactic acid and acetic acid, result shows (table 1)：
Produce formic acid, acetic acid and lactic acid under this condition of culture and account for 7.10%, 18.66% and 74.24% in total acid system respectively.For fermentation
Soluble starch produces mixed acid, has the application prospect utilizing it as ensilage fermentation agent.
Table 1：Formic acid, lactic acid and acetic acid amount are produced in S1 control pH fermentation
Ultimate principle, principal character and the advantages of the present invention of the present invention have been shown and described above.The technology of the industry
, it should be appreciated that the present invention is not restricted to the described embodiments, the simply explanation described in above-described embodiment and description is originally for personnel
The principle of invention, without departing from the spirit and scope of the present invention, the present invention also has various changes and modifications, the present invention
Claimed scope is by appending claims, description and its equivalent thereof.
Claims (7)
1. a kind of lactic acid producing bargen's streptococcuses are it is characterised in that the nucleotide of described galactopoiesis bargen's streptococcuses is included as SEQ in sequence table
Sequence shown in NO.1.
2. a kind of separation method of lactic acid producing bargen's streptococcuses as claimed in claim 1 is it is characterised in that main include following walking
Suddenly：
(1) prepare enrichment culture base fluid：
With water as solute, being added thereto to mass ratio is 1.0% peptone, 0.5% yeast extract, 1.0% beef extract,
1.0% soluble starch, 0.2%K2HPO4, 0.1% Tween 80,0.02%MgSO4·7H2O, 0.005%MgSO4·H2O,
0.2% ammonium citrate, 0.5%C2H3NaO2, and be added thereto to the "diazoresorcinol" sodium of final concentration of 20mg/L, will configuration richness
Sealing cooling after collection liquid medium high temperature sterilize deoxygenation, adjusting pH is 6.5 to 6.8；
(2) bacterium source dilution：
By the bacterium source of aseptic anaerobism collection according to 1：The enrichment culture base fluid of prepared acquisition in 30～70 ratio and step (1)
It is mixed in Anaerobic culturel container, after 37 DEG C of concussion and cultivates at least 24 hours, erect Anaerobic culturel container, continue quiescent culture
At least 24 hours；
(3) prepare solid separation culture medium：
With water as solute, being added thereto to mass ratio is 1.0% peptone, 0.5% yeast extract, 1.0% beef extract,
1.0% soluble starch, 0.2%K2HPO4, 0.1% Tween 80,0.02%MgSO4·7H2O, 0.005%MgSO4·H2O,
0.2% ammonium citrate, 0.5%C2H3NaO2, and it is added thereto to 1.5% agarose, go out in the isolation medium high temperature by configuration
After bacterium deoxygenation under anaerobic environment cool down, adjust pH be 6.5 to 6.8 after pour plate, prepared plate for isolated culture；
(4) the isolating and purifying of antibacterial：
The culture fluid in the culture vessel in step (2) is abandoned in suction, retains precipitate；Picking precipitates a little, coats step 3) in
The plate for isolated culture of preparation, under anaerobic 37 to 39 DEG C of lucifuges cultivate 24 to 36 hours, select surface wettability, glossy,
Color is milky round drop-wise bacterium colony, carries out the identification of lactic acid producing biochemical tube and Gram’s staining identification, and selection qualification result is
Lactic acid producing is positive and gram-positive bacterium colony is further transferred to separation and Culture in new flat board.
3. a kind of separation method of lactic acid producing bargen's streptococcuses as claimed in claim 2 is it is characterised in that in step (1), incite somebody to action
The enrichment culture base fluid of configuration takes out after being put in 115 to 121 DEG C of autoclavings abundant deoxygenation at least 15 minutes in high-pressure sterilizing pot
Sealing cooling.
4. a kind of separation method of lactic acid producing bargen's streptococcuses as claimed in claim 2 or claim 3 is it is characterised in that in step (3)
In, take out immediately after the isolation medium of configuration is put in high-pressure sterilizing pot 115 to 121 DEG C of autoclavings at least 15 minutes and turn
Move to cooling in anaerobism work station.
5. a kind of separation method of lactic acid producing bargen's streptococcuses as claimed in claim 4 is it is characterised in that in step (4), excellent
Selection of land, repeats this step 4 times, separates and obtains pure bacterial strain.
6. a kind of separation method of lactic acid producing bargen's streptococcuses as claimed in claim 2 is it is characterised in that in step (4), excellent
Selection of land, repeats this step 4 times, separates and obtains pure bacterial strain.
7. lactic acid producing bargen's streptococcuses as claimed in claim 1 or lactic acid producing bargen's streptococcuses as claimed in claim 2 point
From application in terms of exploitation bargen's streptococcuses vaccine and novel fodder fermenting agent for the method.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610473872.9A CN106479910B (en) | 2016-06-25 | 2016-06-25 | Lactic acid-producing streptococcus bovis and separation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610473872.9A CN106479910B (en) | 2016-06-25 | 2016-06-25 | Lactic acid-producing streptococcus bovis and separation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106479910A true CN106479910A (en) | 2017-03-08 |
| CN106479910B CN106479910B (en) | 2020-07-24 |
Family
ID=58238639
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610473872.9A Active CN106479910B (en) | 2016-06-25 | 2016-06-25 | Lactic acid-producing streptococcus bovis and separation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106479910B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114045245A (en) * | 2021-12-15 | 2022-02-15 | 塔里木大学 | Lactic acid-producing streptococcus bovis and separation method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102294026A (en) * | 2010-11-17 | 2011-12-28 | 赤峰博恩药业有限公司 | Milk cow streptococcal mastitis inactivated vaccine and preparation method thereof |
| CN103800901A (en) * | 2014-01-27 | 2014-05-21 | 内蒙古华希生物科技有限公司 | Streptococcus and dairy cow mastitis vaccine obtained by inactivating streptococcus |
-
2016
- 2016-06-25 CN CN201610473872.9A patent/CN106479910B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102294026A (en) * | 2010-11-17 | 2011-12-28 | 赤峰博恩药业有限公司 | Milk cow streptococcal mastitis inactivated vaccine and preparation method thereof |
| CN103800901A (en) * | 2014-01-27 | 2014-05-21 | 内蒙古华希生物科技有限公司 | Streptococcus and dairy cow mastitis vaccine obtained by inactivating streptococcus |
Non-Patent Citations (3)
| Title |
|---|
| CHEN,L.M.: "GenBank: KU853019.1，Streptococcus equinus strain S1 16S ribosomal RNA gene, partial sequence", 《NCBI》 * |
| 欧海龙等: "奶牛瘤胃中牛链球菌的分离鉴定", 《中国微生态学杂质》 * |
| 祖菲等: "牛链球菌的分离鉴定及生物信息学分析", 《中国畜牧兽医》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114045245A (en) * | 2021-12-15 | 2022-02-15 | 塔里木大学 | Lactic acid-producing streptococcus bovis and separation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106479910B (en) | 2020-07-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kenters et al. | Isolation of previously uncultured rumen bacteria by dilution to extinction using a new liquid culture medium | |
| CN106978355B (en) | Co-culture of anaerobic fungi and methanobacteria and application of co-culture in natural enzymes for dairy cattle feed | |
| CN102492643B (en) | Lactobacillus rhamnosus grx19 and its application | |
| CN102533588A (en) | Lactobacillus brevis for producing extracellular exopolysaccharide and application thereof | |
| CN113862164B (en) | High-protein saccharomyces cerevisiae and application thereof | |
| CN105176872B (en) | Streptococcus thermophilus and its application | |
| CN104531587A (en) | Lactobacillus plantarum (LP-ONLLY) and application thereof in active fermented milk | |
| CN103923869A (en) | Bacillus subtilis gene engineering bacterial producing Neu5Ac, construction method and application thereof | |
| Kim et al. | Fumarate reductase-producing enterococci reduce methane production in rumen fermentation in vitro | |
| CN113403227A (en) | Lactobacillus plantarum and preparation method and application thereof | |
| CN108641979A (en) | A kind of enterococcus faecium, its high density fermentation cultural method and probiotics prepared therefrom | |
| Lustrato et al. | Cheese whey recycling in traditional dairy food chain: effects of vinegar from whey in dairy cow nutrition | |
| CN103451163B (en) | The hydrogen peroxide enzyme mutant that a kind of enzyme is lived and thermostability improves | |
| CN106479932B (en) | A kind of Lactobacillus pentosus producing γ-aminobutyric acid | |
| CN106479910A (en) | A kind of lactic acid producing bargen's streptococcuses and its separation method | |
| CN104877942A (en) | New strain of Paenibacillus sp.YN2 as well as culture method and application of new strain | |
| CN116445372A (en) | Agile lactobacillus for improving ruminant rumen nitrogen conversion efficiency and application thereof | |
| CN110452849A (en) | A kind of probiotic lactobacillus plantarum | |
| CN110484477A (en) | One plant of lactobacillus delbrueckii subsp bulgaricus strain and its application | |
| CN106434779B (en) | Lactobacillus pentosus SS6 is producing the application in γ-aminobutyric acid | |
| CN102382779B (en) | Manufacture method for set type additive-free yogurt and lactobacillus casei used therein | |
| CN101921719A (en) | Legionella transport and enrichment medium | |
| CN109055284A (en) | A kind of the wine brewing strain of ocean acid-producing bacteria and its application | |
| Ren et al. | Molecular Identification of lactic acid bacteria isolated from the traditional fermented yak yogurt in western Sichuan Region | |
| CN101348769B (en) | H+-ATP enzyme acid resistant gene atpA' and Lactobacillus casei containing the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |