CN106478774B - Signal peptide for protein expression - Google Patents
Signal peptide for protein expression Download PDFInfo
- Publication number
- CN106478774B CN106478774B CN201510527208.3A CN201510527208A CN106478774B CN 106478774 B CN106478774 B CN 106478774B CN 201510527208 A CN201510527208 A CN 201510527208A CN 106478774 B CN106478774 B CN 106478774B
- Authority
- CN
- China
- Prior art keywords
- signal peptide
- protein
- pcho
- expression
- foreign protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention relates to a signal peptide for protein expression, in particular to a signal peptide for guiding the secretory expression of a foreign protein (such as an antibody) in a mammalian cell, wherein the amino acid sequence of the signal peptide is shown as SEQ ID NO. 1. The signal peptide can be added into an expression vector of recombinant proteins (such as antibodies) of mammalian cells and is used for guiding the high-efficiency secretory expression of foreign proteins. Compared with the existing signal peptide, the signal peptide-guided foreign protein expression level is greatly improved, and the invention has wide industrial application prospect.
Description
Technical Field
The invention relates to the field of biotechnology, in particular to a signal peptide for guiding the secretory expression of a foreign protein (such as an antibody) in a mammalian cell.
Technical Field
In 2007, the gene recombinant protein drugs in China are developed rapidly, and in the upstream stage of the genome technology, an escherichia coli and pichia pastoris expression system is utilized, and a new fusion protein carrier is constructed, so that the half-life period, solubility and other characteristics of the existing recombinant protein drugs are effectively improved, a new process is provided for industrial preparation, and the recovery rate of the recombinant protein is improved; however, the downstream separation and purification technology and the expression and purification capability of the mammalian cell expression system still have great defects. In particular, antibody drugs, an important component of modern biological medicine, have the characteristics of high specificity and high affinity for corresponding antigens, so that the antibodies show incomparable advantages with other types of drugs in the diagnosis and treatment of diseases. The antibody drug gradually develops towards low antigenicity and high specificity through the development process of a murine antibody, a chimeric antibody, a humanized antibody and a fully human antibody. The antibody preparation method is developed continuously by the conventional serum technology, the hybridoma technology, the genetic engineering antibody technology and the antibody library technology, and the method for obtaining the fully human antibody by using the in vitro screening technology and the screening of the transgenic animals becomes the main direction of antibody research at present. The expression of proteins (such as antibodies) by mammalian cells becomes the mainstream of protein drug production, but the expression efficiency of exogenous proteins by mammalian cells is low, and the cost is high, so that the improvement of the expression efficiency of exogenous proteins by mammalian cells and the reduction of the production cost are important in the current work.
Industrially, the expression level of a protein (e.g., an antibody) is influenced by many factors, such as an expression vector, a host, a culture medium, a culture process, and the like. The expression ability of the expression vector is influenced by factors such as a promoter and a signal peptide, wherein the signal peptide plays an important role in the secretory expression process of the protein (such as an antibody) and directly influences the quality of the secretory protein.
The signal peptide is located at the N-terminus of the secreted protein. Generally consists of 15 to 30 amino acids. Includes three regions: a positively charged N-terminus, referred to as the basic amino terminus; an intermediate hydrophobic sequence, mainly neutral amino acids, capable of forming an alpha helical structure, which is the main functional region of the signal peptide; a longer, negatively charged C-terminus, containing small amino acids, is the signal sequence cleavage site, also called the processing region. When the signal peptide sequence is synthesized and recognized by a Signal Recognition Particle (SRP), protein synthesis is suspended or slowed, the signal recognition particle carries the ribosome to the endoplasmic reticulum, and protein synthesis is restarted. Under the guidance of the signal peptide, the newly synthesized protein enters the lumen of the endoplasmic reticulum, and the signal peptide sequence is cleaved by the action of a signal peptidase. The function of the signal peptide for secreting foreign proteins is as follows:
1) the signal peptide can guide the secretory protein or the membrane protein to come out of the cell.
2) The hydrophobic core of the signal peptide determines the secretion efficiency of the protein.
3) The signal peptide can guide the protein to be positioned correctly in different regions or different organelles in the cell.
4) The signal peptide can enhance the secretion of the foreign protein by the secretion enhancer.
5) The short signal peptide is beneficial to reducing the molecular weight of an expression vector and improving the stability and the transcription efficiency of an exogenous gene expression cassette integrated on a host chromosome.
The signal peptide has no strict specificity, so that the signal peptide sequence of the host cell can be utilized, and a sequence for coding the signal peptide can be added behind a promoter of an expression vector to secrete the foreign protein. The use of signal peptide sequences to direct the secretion of foreign proteins not only facilitates purification procedures, but also is of great importance in the preparation of certain genetically engineered products (e.g., antibodies) of particular utility. The secretion efficiency of the same protein is far from each other even if the protein can be secreted and expressed under the action of different signal peptides. The secretion efficiency of the foreign protein can be improved by properly modifying the structure of the signal peptide. For foreign proteins (such as antibodies), the expression level can be increased by times by selecting proper signal peptides, and the significance is very profound for industrial production and scientific research.
Disclosure of Invention
The inventors of the present invention have studied signal peptides for a long time and provided a signal peptide that can induce the expression of foreign proteins (e.g., antibodies) with high efficiency, thereby reducing the production cost of foreign proteins.
Accordingly, a first object of the present invention is to provide a signal peptide for protein expression.
The second purpose of the invention is to provide the application of the signal peptide.
It is a third object of the present invention to provide a polynucleotide encoding the signal peptide.
It is a fourth object of the present invention to provide a mammalian cell expression vector comprising a polynucleotide encoding the signal peptide.
The fifth object of the present invention is to provide a mammalian host cell transfected with the mammalian cell expression vector.
The sixth object of the present invention is to provide a method for producing a foreign protein.
In order to achieve the purpose, the invention provides the following technical scheme:
in a first aspect, the invention provides a signal peptide for protein expression, wherein the amino acid sequence of the signal peptide is shown as SEQ ID NO. 1.
In a second aspect the invention provides the use of said signal peptide for directing the secretory expression of a foreign protein (such as an antibody) in a mammalian host cell.
A third aspect of the invention provides a polynucleotide encoding a signal peptide as described above.
Further, the nucleotide sequence of the polynucleotide is shown as SEQ ID NO. 7.
In a fourth aspect, the present invention provides a mammalian cell expression vector comprising a polynucleotide encoding a signal peptide as described above and a polynucleotide encoding a foreign protein.
Further, a polynucleotide encoding the signal peptide as described above is immediately preceded by the polynucleotide encoding the foreign protein.
Further, the promoter of the mammalian cell expression vector may be an EF-1 α (human ligation factor-1 α) promoter, an hCMV (human cytomegalovirus) promoter, an SV40(Simian vacuolating virus 40, Simian vacuolating virus) late promoter, an SV40 early promoter, or a hybrid promoter of EF-1 α and hCMV promoter, and the like.
Further, the foreign protein may be any protein, such as an antibody or the like.
Preferably, the expression vector is pCHO1.0.
In a fifth aspect of the invention there is provided a mammalian host cell transfected with a mammalian cell expression vector as described above.
Further, the mammalian cell may be CHO (Chinese hamster ovary), BHK (baby hamster kidney cell), SP2/0 (mouse myeloma cell), C127 (mouse mammary tumor cell), HEK293(human embryo kidney293 cell), and the like.
Preferably, the cell is a CHO cell.
The sixth aspect of the present invention provides a method for producing a foreign protein, comprising the steps of: culturing the mammalian host cell as described above under conditions suitable for expression of the foreign protein, and isolating the foreign protein from the culture.
Has the advantages that: compared with the existing signal peptide, the invention greatly improves the expression level of the foreign protein (such as an antibody) in mammalian cells, improves the expression level by more than 2.5 times, obviously improves the secretion expression level of the foreign protein, is favorable for screening a high-expression monoclonal cell strain, can reduce the production cost, and has wide industrial application prospect.
Drawings
FIG. 1 is a diagram of a free pCHO1.0 expression vector.
FIG. 2 is a graph showing the comparison between the signal peptide of the present invention and the foreign protein expression amount induced by the natural antibody signal peptide.
FIG. 3 is a SEC-HPLC purity detection result chart of bevacizumab prepared using the signal peptide of the present invention.
Fig. 4 is a complete molecular weight map of the heavy chain of bevacizumab prepared using the signal peptide of the present invention.
Fig. 5 is a complete molecular weight map of the light chain of bevacizumab prepared using the signal peptide of the present invention.
Detailed Description
The following examples illustrate the invention in detail, but do not limit the scope of the invention.
The method for secreting and expressing protein (such as antibody) in mammalian cells by using the signal peptide of the invention comprises the following steps: the polynucleotide encoding the signal peptide of the present invention is linked to a polynucleotide encoding an expression protein (e.g., an antibody), and then cloned into a mammalian cell expression vector, and the recombinant mammalian cell expression vector is transfected into mammalian cells to express the target protein.
The polynucleotides of the present invention can be prepared by conventional synthetic methods.
An expression vector listed in the examples of the present invention is Freedom pcho1.0 (purchased from Invitrogen).
EXAMPLE 1 Synthesis of Signal peptide
The invention designs a novel artificially synthesized signal peptide 1, and simultaneously introduces natural antibody signal peptides 2-6 for comparison.
The amino acid sequences of signal peptides 1-6 are as follows.
Signal peptide 1: MGKWVKVLFALICIAVAES (design of the invention, SEQ ID NO:1)
Signal peptide 2: METPAQLLFLLLLWLP (GenBank: AAA36085.1, Homo sapiens, SEQ ID NO:2)
Signal peptide 3: MGWSCIILFLVATATGVHS (GenBank: CAA25967.1, Mus musculus, SEQ ID NO:3)
Signal peptide 4: MGWSCIILFLVATATG (GenBank: AAA38605.1, Mus musculus, SEQ ID NO:4)
Signal peptide 5: MSVPTQVLGLLLLWLTDARC (GenBank: CAB46315.1, Mus musculus, SEQ ID NO:5)
Signal peptide 6: MDMRVPAQLLGLLLLWLPG (GenBank: AAA58934.1, Homo sapiens, SEQ ID NO:6)
The nucleotide sequences of signal peptides 1-6 are as follows.
Signal peptide 1:
5’-ATGGGCAAGTGGGTGAAGGTGCTGTTCGCCCTGATCTGCATCGCCGTGGCCGAGAGC-3’(SEQ ID NO:7)
signal peptide 2:
5’-ATGGAAACCCCTGCTCAGCTCCTCTTCCTGCTCCTCCTCTGGCTCCCA-3’(SEQ ID NO:8)
signal peptide 3:
5’-ATGGGATGGTCCTGTATTATTCTGTTTCTCGTGGCTACTGCAACTGGCGTCCACAGC-3’(SEQ ID NO:9)
signal peptide 4:
5’-ATGGGATGGTCCTGTATTATTCTGTTTCTCGTGGCTACTGCAACTGGA-3’(SEQ ID NO:10)
signal peptide 5:
5’-ATGAGCGTCCCAACACAAGTGCTGGGTCTGCTGCTGCTGTGGCTGACTGACGCAAGG TGC-3’(SEQ ID NO:11)
signal peptide 6:
5’-ATGGATATGAGGGTGCCCGCTCAACTGCTGGGACTGCTGCTGCTGTGGCTGCCAGGC-3’(SEQ ID NO:12)
because the signal peptide is shorter, the nucleotide sequence of the signal peptide is synthesized according to a primer synthesis mode. The 5' end of each signal peptide is respectively added with an AvrII enzyme cutting site and an EcoRV enzyme cutting site, namely, the same signal peptide synthesizes two sequences (one contains the AvrII, and the other contains the EcoRV); the 3' end of each signal peptide is added with a segment with the same sequence as the target gene, so that the splicing is convenient.
EXAMPLE 2 construction of recombinant pCHO1.0 expression vector
The codon optimized bevacizumab gene heavy chain (WO 2004/065417, SEQ ID NO:25, BstZ171 restriction site added at the 3 'end) is spliced with signal peptide 1-6 (AvrII is contained at the 5' end) respectively, and is connected to plasmid pCHO1.0 (purchased from Invitrogen) after AvrII/BstZ171 double restriction treatment, and the obtained recombinant plasmids are named as pCHO-LC7, pCHO-LC2, pCHO-LC3, pCHO-LC4, pCHO-LC5 and pCHO-LC6 respectively.
The codon optimized bevacizumab gene light chain (WO 2004/065417, SEQ ID NO:25, PacI restriction enzyme cutting site added at the 3 'end) is spliced with signal peptides 1-6 (the 5' end contains EcoRV) respectively, and is connected to plasmids pCHO-LC7, pCHO-LC2, pCHO-LC3, pCHO-LC4, pCHO-LC5 and pCHO-LC6 which are subjected to EcoRV/PacI double restriction enzyme cutting respectively after being subjected to EcoRV/PacI double restriction enzyme cutting respectively, and the obtained recombinant plasmids are named as pCHO-A7, pCHO-A2, pCHO-A3, pCHO-A4, pCHO-A5 and pCHO-A6 respectively.
Wherein, the recombinant plasmid pCHO-A7 adopts the signal peptide 1 of the invention to secrete and express the light chain and the heavy chain of the bevacizumab, and the recombinant plasmids pCHO-A2, pCHO-A3, pCHO-A4, pCHO-A5 and pCHO-A6 respectively adopt natural signal peptides 2-6 to secrete and express the light chain and the heavy chain of the bevacizumab.
EXAMPLE 3 transient transfection expression Studies with recombinant expression vectors
Plasmids pCHO-A2, pCHO-A3, pCHO-A4, pCHO-A5, pCHO-A6 and pCHO-A7 were transfected into CHO-S cells (available from Life technologies) respectively by the liposome method (freestyle MAX, available from Invitrogen) and the antibody transient expression level was examined.
Specifically, 5. mu.g of plasmids pCHO-A2, pCHO-A3, pCHO-A4, pCHO-A5, pCHO-A6 and pCHO-A7 were transfected into CHO-S cells (about 3X 10 cells/well) cultured in 6-well plates (3 ml/well) according to the freestyle MAX protocol6Individual cells). Transfected cells at 8% CO2After culturing the cells in a shaking incubator (brand Infors) at 37 ℃ for 48 hours, the culture supernatant was collected and the expression level of human bevacizumab was measured by ELISA. The results are shown in FIG. 2 and Table 1.
TABLE 1,
| Plasmid numbering | Signal peptide | Antibody expression level (μ g/ml) |
| pCHO-A2 | SEQ ID NO:2 | 1 |
| pCHO-A3 | SEQ ID NO:3 | 1.1 |
| pCHO-A4 | SEQ ID NO:4 | 1.41 |
| pCHO-A5 | SEQ ID NO:5 | 1.28 |
| pCHO-A6 | SEQ ID NO:6 | 1.2 |
| pCHO-A7 | SEQ ID NO:1 | 3.6 |
The result shows that compared with the natural antibody signal peptide, the signal peptide of the invention improves the secretory expression quantity of the antibody by more than 2.5 times under the same condition, which indicates that the signal peptide of the invention can obviously improve the secretory expression quantity of the foreign protein in the CHO cell.
EXAMPLE 4 preparation of Small amounts of antibody
50. mu.g of pCHO-A7 plasmid were transfected into 30ml of CHO-S cells (1X 10) cultured in shake flasks according to the instructions of the Freecom CHO-S Kit (from Life technologies)6cells/ml). Transfected cells at 8% CO2After culturing the cells at 37 ℃ for 48 hours with shaking in a shaking incubator, Methotrexate (MTX) and puromycin were added for pressure screening. When the cell viability rose to 90%, Simple Fed-batch (3X 10) was performed5Cell density inoculation, 4g/L sugar is supplemented on day 3 and day 5, and 6g/L sugar is supplemented on day 7; 37 ℃/130 rpm/8% CO2) To produce small amounts of antibody. After 14 days of culture, a simple flow-through culture supernatant was collected and affinity purified using a ProteinA purification column (MabSelect SuRe, from GE Healthcare) (binding buffer: NaCl 0.5M, Na)2HPO420mM, pH 8.0; eluent: 50mM citric acid buffer pH3.5) to finally obtain high-purity bevacizumab.
Example 5 identification of the quality of expressed antibodies
The SEC-HPLC (DIONEX, UItimate 3000-VWD1) purity analysis of bevacizumab prepared in example 4 resulted in a purity of more than 97% as shown in FIG. 3.
Complete molecular weight analysis of the prepared bevacizumab using Q-TOF (Waters, XEVO G2Q-TOF) resulted in the molecular weight determination of the light and heavy chains as shown in fig. 4 and 5, consistent with the original drug.
The detection results show that the antibody secreted by the signal peptide is the target antibody and can be used for guiding the correct expression of foreign proteins (such as antibodies).
According to the method, the inventor of the invention also carries out similar experiments on proteins such as etanercept, trastuzumab, Rituximab (Rituximab, MabThera) and the like, and the results show that the expression level of the protein guided by the signal peptide is greatly improved in mammalian cells.
Claims (10)
1. A signal peptide for protein expression is characterized in that the amino acid sequence of the signal peptide is shown as SEQ ID NO. 1.
2. The signal peptide of claim 1 for use in directing the secretory expression of a foreign protein in CHO cells.
3. A polynucleotide encoding the signal peptide of claim 1.
4. The polynucleotide of claim 3, wherein the nucleotide sequence of the polynucleotide is set forth in SEQ ID No. 7.
5. A CHO cell expression vector containing the polynucleotide of claim 3 or 4 and a polynucleotide encoding a foreign protein.
6. The CHO cell expression vector of claim 5, wherein the polynucleotide of claim 3 or 4 immediately precedes the polynucleotide encoding the foreign protein.
7. The CHO cell expression vector of claim 5 or 6, wherein the promoter of the CHO cell expression vector is selected from the group consisting of an EF-1 α promoter, an hCMV promoter, an SV40 promoter, and a hybrid promoter of EF-1 α and hCMV promoters.
8. The CHO cell expression vector of claim 5 or 6, wherein the foreign protein is an antibody.
9. A CHO cell transfected with the CHO cell expression vector of any one of claims 5 to 8.
10. A method for producing a foreign protein, comprising the steps of: culturing the CHO cell of claim 9 under conditions suitable for expression of the foreign protein, and isolating the foreign protein from the culture.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510527208.3A CN106478774B (en) | 2015-08-25 | 2015-08-25 | Signal peptide for protein expression |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510527208.3A CN106478774B (en) | 2015-08-25 | 2015-08-25 | Signal peptide for protein expression |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106478774A CN106478774A (en) | 2017-03-08 |
| CN106478774B true CN106478774B (en) | 2021-09-14 |
Family
ID=58233937
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510527208.3A Active CN106478774B (en) | 2015-08-25 | 2015-08-25 | Signal peptide for protein expression |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106478774B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116102625B (en) * | 2023-03-20 | 2023-09-22 | 杭州斯达特生物科技有限公司 | Signal peptide and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011102178A1 (en) * | 2010-02-19 | 2011-08-25 | 独立行政法人産業技術総合研究所 | Analysis system using modified reporter gene |
| CN103305478A (en) * | 2013-06-08 | 2013-09-18 | 中国人民解放军疾病预防控制所 | In-vivo imaging tracing system of vaccinia virus and application of system |
| CA2893359A1 (en) * | 2012-12-05 | 2014-06-12 | Strategia Therapeutics, Inc. | Protein expression enhancing polypeptides |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1993001214A1 (en) * | 1991-07-08 | 1993-01-21 | Chugai Seiyaku Kabushiki Kaisha | Recombinant human interleukin 6 with homogeneous n-terminus and production thereof |
| CN102659928B (en) * | 2010-09-17 | 2014-02-05 | 上海凯茂生物医药有限公司 | Synthetic signal peptide and application thereof |
-
2015
- 2015-08-25 CN CN201510527208.3A patent/CN106478774B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011102178A1 (en) * | 2010-02-19 | 2011-08-25 | 独立行政法人産業技術総合研究所 | Analysis system using modified reporter gene |
| CA2893359A1 (en) * | 2012-12-05 | 2014-06-12 | Strategia Therapeutics, Inc. | Protein expression enhancing polypeptides |
| CN103305478A (en) * | 2013-06-08 | 2013-09-18 | 中国人民解放军疾病预防控制所 | In-vivo imaging tracing system of vaccinia virus and application of system |
Non-Patent Citations (5)
| Title |
|---|
| cell surface exposed luciferase gLUC59 [synthetic construct];GenBank;《GenBank》;20091020;ACCESSION NO: ACR61711.1 * |
| Improving mammalian cell factories: The selection of signal peptide has a major impact on recombinant protein synthesis and secretion in mammalian cells;Beate Stern等;《Trends in Cell & Molecular Biology》;20070131;第1-17页 * |
| Optimization of Heavy Chain and Light Chain Signal Peptides for High Level Expression of Therapeutic Antibodies in CHO Cells;Ryan Haryadi等;《PLOS ONE》;20150123;第1-16页 * |
| Optimized Signal Peptides for the Development of High Expressing CHO Cell Lines;Lars Kober等;《Biotechnology and Bioengineering》;20130430;第110卷(第4期);第1164-1173页 * |
| 信号肽对外源蛋白分泌效率的影响;赵慧等;《生命的化学》;20031231;第23卷(第3期);第177-179页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106478774A (en) | 2017-03-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10533045B2 (en) | Antibody purification and purity monitoring | |
| KR101591671B1 (en) | method for reducing heterogeneity of antibodies and a process of producing the antibodies thereof | |
| JP5076084B2 (en) | Novel vector and expression cell line for mass production of recombinant protein, and method for producing recombinant protein using the same | |
| JP2009508467A (en) | Methods for generating monoclonal antibodies against CD20 for the treatment of B-cell lymphoma | |
| KR102180660B1 (en) | Expression process | |
| CN113423836B (en) | Carbon source regulated protein production in recombinant host cells | |
| US10611831B2 (en) | Production cell line enhancers | |
| SG182953A1 (en) | Recombinant expression vector elements (reves) for enhancing expression of recombinant proteins in host cells | |
| CA2845579C (en) | Multi-copy strategy for high-titer and high-purity production of multi-subunit proteins such as antibodies in transformed microbes such as pichia pastoris | |
| CN106478773B (en) | Novel artificially synthesized signal peptide | |
| CN104974226B (en) | A kind of signal peptide for protein expression | |
| WO2019117136A1 (en) | Animal cells, method for producing animal cells, and method for producing target protein | |
| US20180142038A1 (en) | Anti-glycoprotein antibodies and uses thereof | |
| CN106478774B (en) | Signal peptide for protein expression | |
| US20160108357A1 (en) | Methods of culturing a cell | |
| WO2016095326A1 (en) | Construction method for och1-defective anti-cd20 tetravalent antibody expression pichia pastoris | |
| CN114395041B (en) | Method for preparing anti-IL-12 and/or IL-23 monoclonal antibody | |
| CN111116749B (en) | Recombinant humanized GPC3 antibody, and preparation and application thereof | |
| RU2717038C1 (en) | Cho-se-9/4 cell strain, producer of chimeric human erythropoietin antibody and chimeric antibody produced by said strain | |
| NZ621199B2 (en) | Multi-copy strategy for high-titer and high-purity production of multi-subunit proteins such as antibodies in transformed microbes such as pichia pastoris | |
| NZ721102B2 (en) | Multi-copy strategy for high-titer and high-purity production of multi-subunit proteins such as antibodies in transformed microbes such as pichia pastoris | |
| MXPA06004334A (en) | Methods of synthesizing heteromultimeric polypeptides in yeast using a haploid mating strategy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |