CN106466486A - Application in preparation anti-gastric cancer medicament for the miR-133 small molecule nucleic acid drug - Google Patents
Application in preparation anti-gastric cancer medicament for the miR-133 small molecule nucleic acid drug Download PDFInfo
- Publication number
- CN106466486A CN106466486A CN201510507677.9A CN201510507677A CN106466486A CN 106466486 A CN106466486 A CN 106466486A CN 201510507677 A CN201510507677 A CN 201510507677A CN 106466486 A CN106466486 A CN 106466486A
- Authority
- CN
- China
- Prior art keywords
- mir
- gastric cancer
- application
- preparation anti
- cancer medicament
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates to biomedicine technical field, there is provided the new medical usage of Microrna miR-133, specifically refer to application in malignant tumor molecular targeted therapy for the miR-133；Present invention further teaches application in preparation anti-gastric cancer medicament for the miR-133.The present invention the experiment proved that, in Carcinogenesis of Stomach, the expression of miR-133 is significantly inhibited；The expression recovering miR-133 can suppress the propagation of stomach cancer cell, thus playing antitumor action by targeting anti-apoptotic molecule Mcl-1 and Bcl-xL.The present invention is that the clinical treatment of gastric cancer provides new potential molecular target.
Description
Technical field
The present invention relates to biomedicine technical field, more particularly, miR-133 small molecule nucleic acid drug
Application in preparation anti-gastric cancer medicament.
Background technology
Gastric cancer is the common malignant tumor of digestive system, is also a kind of high tumor of grade malignancy simultaneously,
Survival rate only has 20-30% within overall 5 years.In China, the equal shelter of its M ＆ M has malignant tumor
The 2nd.With standard the radical operation of gastric cancer D2 standardization carry out, and various new put,
The application of chemotherapy means, its clinical efficacy obtains a certain degree of raising.Even if however, being effected a radical cure
Property excision and in the case of receiving the adjuvant chemotherapy of specification, still have some patientss that the recurrence of tumor occurs
And transfer, point out the limitation of existing treatment meanss.It is now recognized that gastric cancer is that a kind of biology is heterogeneous
Very big tumor, its generation is participated in jointly by several genes group and epigenetics mechanism.Therefore, enter one
Step deeply recognizes stomach carcinogenesis, the cell in evolution and molecular mechanism, for the diagnosis and treatment more becoming more meticulous
This persistent ailment, has important scientific meaning and value for clinical application.
MicroRNA (miRNA) is the non-coding small fragment RNA that a class length is about 22 nucleotide,
Its evolution conservative, it is by the 3 ' untranslated regions (3 ' with mRNA (messenger RNA)
Untranslational region, 3 '-UTR) interact thus regulating and controlling the translation of mRNA, and then extensively
Participate in the various biological activities such as growth, tumor, inflammation.Research finds, miRNA swells in many mankind
All there is abnormal expression, or they are by changing the expression of oncogene or antioncogene, directly affect in tumor
The growth of tumor, propagation and apoptosis, or the phenotype with tumor, by stages and survival of patients has dependency, from
And occurred with the identity of early diagnosiss and the biomarker of the monitoring state of an illness.
MiR-133 family early than identified discovery in mouse muscle growth course research in 2002, its
Sequence is guarded in species camber.In human genome, miR-133 family comprises three family members：
MiR-133-a-1, miR-133a-2 and miR-133b, they are located at the 18th, 20 and No. 6 successively respectively
On chromosome.The mature sequence of miR-133 includes miR-133a-3p and miR-133b, and it is
3 ' end shearings of primary transcript (pri-miRNA) hairpin structure of miR-133, two one-tenth
Ripe sequence very high homology in structure, there is the difference of a base in only 3 ' ends.Research confirms,
The abnormal expression of miR-133 is related to the disease of multiple skeletal muscle and cardiac muscle.In recent years, miR-133 exists
Effect in tumor area is also progressively disclosed, including bladder cancer, carcinoma of prostate and gastric cancer.For example, exist
In human bladder cancer, miR-133a can be directly targeted and adjust the expression of oncogene GSTP1, and
The expression of lowering of miR-133a is then passed through to strengthen the anti-apoptotic effect of GSTP1 mediation, thus promoting bladder cancer
Develop (Uchida etc., MiR-133a induces apoptosis through direct regulation of
GSTP1in bladder cancer cell lines, Urol Oncol, volume 31 1 phase).In gastric cancer, miR-133
Expression and tumor size, intramural invasion and peripheral organ's transfer be in negative correlation, its dysfunction is shadow
Ring independent hazard factor (Cheng etc., the miR-133is a key negative regulator of of gastric cancer prognosis
CDC42-PAK pathway in gastric cancer, Cell Signal, volume 26 12 phase).However, miR-133
Institute's role, definite the Molecular Biology Mechanism and whether can conduct in the development of stomach carcinogenesis
Small molecule nucleic acid drug there is no relevant report for clinical treatment gastric cancer.
Content of the invention
The present invention relates to biomedicine technical field, there is provided Microrna-miR-133's is new pharmaceutical
On the way, specifically refer to application in malignant tumor molecular targeted therapy for the miR-133；Present invention further teaches
Potential value in curing gastric cancer for the miR-133 small molecule nucleic acid drug.
A first aspect of the present invention, there is provided the new medical usage of miR-133, specifically refers to miR-133
Application in preparation anti-gastric cancer medicament；The sequence of described miR-133 is as follows：
miR-133a-3p：5’-UUUGGUCCCUUCAACCAGCUG-3’(SEQ ID NO.1)
miR-133b：5’-UUUGGUCCCUUCAACCAGCUA-3’(SEQ ID NO.2)
Above-mentioned miR-133a-3p and miR-133b can be used alone or simultaneously in preparation anti-gastric cancer medicament
Application.
Described medicine, is the expression referring to improve or increase miR-133a-3p or/and miR-133b
Reagent.
The miR-133b/a-3p referring in the present invention, that is, refer to miR-133a-3p or/and miR-133b.
Described medicine can suppress the increasing of stomach cancer cell by targeting anti-apoptotic molecule Mcl-1 and Bcl-xL
Grow.
Described anti-gastric cancer refers to prevent or treats gastric cancer.
Described miR-133 is to include but is not limited to：MiR-133 sequence, specificity interference miR-133 base
Because of the little disturbing molecule of expression, processing, such as siRNA molecule, miRNA molecule, antisense nucleotide etc.,
The expression plasmid of miR-133 sequence and its high expression adenoviruss and slow viruss.
In a preferred embodiment of the invention, in described miR-133 body, expression reagent is
AgomiR-133 (purchased from Guangzhou Rui Bo company).
In the present invention, described medicine refers to miR-133 for sole active composition, or contains
The pharmaceutical composition of miR-133.
Described pharmaceutical composition refers to containing the miR-133 described in effective dose or its inhibitor, and
Pharmaceutically acceptable carrier.
Described medicine refers to miR-133 or the miR-133 activity in vivo composition containing miR-133 sequence
AgomiR-133, has anti-tumor activity, can be used for clinical treatment gastric cancer.
The above-mentioned miR-133 activity in vivo composition AgomiR-133 containing miR-133 sequence is
AgomiR-133b/a-3p, concrete synthetic method is：
After the mature sequence based on miR-133b/a-3p for the sequence of Agomir-133 synthesizes, connect at 3 ' ends
One cholesterol molecule, assists nucleic acid to enter cell.5 ' end the first two nucleotide and 3 ' four nucleoside in end
Between acid, thio backbone modification is added by thio reaction, complete nucleotide molecule all carries out the modification that methylates,
It is used for strengthening the stability of small molecule nucleic acid.
The composition of described " pharmaceutically acceptable " applies to people and/or animal and no excessively bad pair is anti-
Answer (as toxicity, stimulation and allergy), that is, have the material of rational benefit/risk ratio.
Described " effective dose " refer to people and/or animal can be produced function or activity and can by people and/or
The amount that animal is accepted.
Any applicable route of administration is all possible, including but not limited to：Oral, intravenous injection,
Subcutaneous injection, muscle give, administer locally to, implanting, slow release gives, give in heart；Preferably,
Described administering mode is that non-bowel gives.
Beneficial effect
The present invention the experiment proved that, in Carcinogenesis of Stomach, the expression of miR-133 is significantly inhibited；
The expression recovering miR-133 can suppress stomach cancer cell by targeting anti-apoptotic molecule Mcl-1 and Bcl-xL
Propagation, thus play antitumor action.
The present invention is that the clinical treatment of gastric cancer provides new potential molecular target.
Brief description
Fig. 1. in gastric cancer, miR-133b/a-3p expression is notable lowers
(A) the heating power map analysis of the miRNA group of 14 pairs of gastric cancer specimen.Shown result is every sample reading value
Log2 logarithm, and be standardized with simple counting plate reading value.Heating power map analysis is by with DESeq
The R software of bag completes (padj ＜ 0.05, log2 multiple changes ＞ 3).RNA sequence is from TCGA data base
Download obtains.(B) qRT-PCR method is to normal gastric mucosa immortality cell GES and gastric carcinoma cell lines
In SGC7901 and MNK45, the expression of miR-133b/a-3p carries out quantitation.The expression conduct of U6snRNA
Internal reference.Data is expressed in the form of means standard deviation (n=5), * *, p<0.01.(C)qRT-PCR
Method is entered to the expression of miR-133b/a-3p in clinical 20 gastric cancer obtaining and corresponding normal gastric mucosa
Row quantitative analyses.The expression of miR-133b/a-3p is using U6 as internal reference.
Fig. 2. histone modification mediates the downward of miR-133b/a-3p in Carcinogenesis of Stomach
(A) qRT-PCR method detects three precursor Pri-miR-133a-1 of miR-133 in GES cell line,
The expression of pri-miR-133a-2and pri-miR-133b.Data is in the form of means standard deviation (n=5)
Expression.(B) qRT-PCR method detects three of miR-133 in gastric carcinoma cell lines SGC7901 and MNK45
Individual precursor Pri-miR-133a-1, the expression of pri-miR-133a-2and pri-miR-133b.GES cell line is made
For comparison.Data representation form is with (A), * *, p<0.01.(C) to stomach cancer cell respectively with DNA
Methylation inhibitor 5-azacytidine (10nM), histone methylated inhibitor DZNep (10nM)
Or Antibiotic FR 901228 SAHA (10nM) processes a period of time, qRT-PCR detects
The expression of miR-133b/a-3p.Data is expressed in the form of means standard deviation (n=3), * *,
p<0.01.(D) ChIP analysis, RT-PCR are carried out to normal gastric mucosa immortality cell and gastric carcinoma cell lines
Method to miR-133a-1 and miR-133b promoter region H3Kme3, H3K27me3, H3 acetylation and
H4 Acetylation Level is analyzed.Data representation form is with (C), * *, p<0.01.
Fig. 3 .miR-133b/a-3p reduces cytoactive and promotes apoptosis
(A) SGC7901 and MNK45 cell is according to 5：4 ratio transfection miR-133a-3p and miR-133b
Mixture, make final concentration of 20nM or 100nM.Transfect latter 36 hours, using the inspection of qRT-PCR method
Survey the expression of miR-133b/a-3p.Data is expressed in the form of means standard deviation (n=5).(B)
SGC7901 and MNK45 cell is transfected according to the method in (A), using the detection of CCK8 method
Cell proliferative conditions.Data representation form is with (A), * *, p<0.01.(C) with 20nM concentration
MiR-133b/a-3p transfectional cell 72 hours, then adopts Annexin V and PI to dye in cell, adopts
Flow cytometry.The negative cell of the positive PI simultaneously of Annexin V is considered as apoptotic cell.Data
Expressed in the form of means standard deviation (n=3), * *, p<0.01.(D) transfection method of cell is same
(C), after, transfecting 24 hours, cell is carried out with serum-free and hypoxia is cultivated 24 hours.Using TUNEL
Staining analyzes apoptotic cell, with red arrow instruction.TUNEL (green), DAPI (blue).
Fig. 4 .miR-133b/a-3p is directly targeted anti-apoptotic molecule Mcl-1 and Bcl-xL.
(A) it show the schematic diagram that miR-133b/a is combined with the pairing of its target site, this figure is via TargetScan
(www.targetscan.org) is downloaded in website.(B) according to correlation step, HEK293 cell (1 ×
104) the 3 '-UTR luciferase reporting plasmids of cotransfection 100ng pMIR-Mcl-1 and 40ng
PTK-Renilla- luciferase plasmids or its adapter section mutation reporter plasmid with compare or
MiR-133b/a-3p (final concentration 20nM) cotransfection.After 24 hours, detect luciferase activities and Renilla
Luciferase activities are standardized.Data is expressed in the form of means standard deviation (n=3), * *, p<0.01.
(C) HEK293 cell transfecting pMIR-Bcl-xL 3 '-UTR area fluorescence report plasmid and corresponding RNA.Glimmering
Light element activity test method is with (B).(D) SGC7901 cell transfecting 20nM miR-133b/a-3p,
Detect the expression of two target molecule rna levels of Mcl-1 and Bcl-xL by qRT-PCR method after 36 hours,
Detect the expression of protein level by western blot method.(E) MNK45 cell accepts such as (D)
The same process of middle SGC7901, detected Mcl-1 and Bcl-xL two by qRT-PCR method after 36 hours
The expression of target molecule rna level, detects the expression of protein level by western blot method.(F)
The expression of Mcl-1 and Bcl-xL in detection I phase to IIIB phase different representative gastric cancer specimen by stages,
The expression of miR-133b/a-3p is in the display of figure lower section.N represents corresponding surrounding normal gastric tissue, and T represents stomach
Cancerous tissue.
Fig. 5 .miR-133b/a-3p suppresses the growth of in-vivo tumour, and it lowers significantly correlated with gastric cancer progress.
(A) miR-133 becomes the biological action of tumor to nude mice tumor animal.Outside the both sides hind leg of same nude mice
Side subcutaneous injection 1 × 10 respectively6Individual SGC7901 or MNK45 cell, then passes through mouse tail vein injection
AgomiR-133b/a-3p or AgomiR-NC, concentration is every mice 5nM, once in a week.Referring to
Fix time measurement gross tumor volume.Data is expressed in the form of means standard deviation (n=5).*, p<0.05；
*, p<0.01.(B) using qRT-PCR method, mice is become with the table of miR-133b/a-3p in tumor tumor body
Reach and detected.Data is expressed in the form of means standard deviation (n=5).*, p<0.01.(C)
Detected using the expression that ImmunohistochemistryMethods Methods become Bcl-xL and Mcl-1 in tumor tumor body to mice.
Specific embodiment
With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are only used for
The present invention is described rather than limits the scope of the present invention.
Unless otherwise described, the enforcement of the present invention will be using molecular biology, microbiology, recombinant DNA
With immunologic routine techniquess, these are all known to those skilled in the art.These technology are in following literary composition
There is complete description in offering：For example, Sambrook《Molecular Cloning:A Laboratory guide》Second edition (1989)；
《DNA clone》The I and II volume (D.N.Glover edits 1985)；《Oligonucleotide synthesizes》(M.J.Gait
Editor, 1984)；《Nucleic acid hybridization》(B.D.Hames and S.J.Higgins edits .1984)；《Albumen
Matter purification：Principle and practice》Second edition (Springer-Verlag, N.Y.), and《Experiment immunization learns to do
Volume》I-IV volume (D.C.Weir and C.C.Blackwell edits 1986).Or, can produce according to reagent
The description that business is provided is carried out.
Unless otherwise indicated, otherwise percentage ratio and number are calculated by weight.Unless otherwise defined, Wen Zhongsuo
The all specialties using and scientific words and same meaning familiar to one skilled in the art institute.Additionally, appointing
What method similar or impartial to described content and material all can be applicable in the present invention.Described in literary composition
Preferably implementation is only presented a demonstration with material and is used.
Embodiment 1
The present inventor has access in download cancer gene group atlas (TCGA) data base and comprises 14 pairs of gastric cancer marks
This miRNA data information, is analyzed to the miRNA of significance difference opposite sex expression by R language.
Find compared with normal control sample, miR-133-a-1, miR-133a-2 in stomach organization and
MiR-133b all occurs significantly to lower (Figure 1A).
And then, we are Cultured Human Gastric Cancer Cells In Vitro system SGC7901 and MNK45, with normal gastric tissue
Immortal cell line GES, as comparison, is verified to the above results by qRT-PCR method.Find
In gastric carcinoma cell lines, the expression of ripe fragment miR-133b/a-3p of miR-133 is compared with compared with control cells GES
Also significantly lower (Figure 1B).
In order to be further characterized by above-mentioned experimental result, we gather 20 clinical gastric cancer frozen tissue specimen
(Specimen origin in Pu Waier section of Shanghai Long March Hospital (gastrointestinal surgery), through Pathologis clarify a diagnosis for
Gastric cancer), find that the expression of miR-133b/a-3p in cancerous tissue is substantially less than Normal group in same individuality
Expression (Fig. 1 C) in knitting.Result above is pointed out, in Carcinogenesis of Stomach, miR-133b/a-3p
Expression can lower.
Present inventors studied there is the molecular mechanism of stable downward in stomach organization in miR-133b/a-3p.
Because in human genome, have the precursor of three miR-133, i.e. miR-133a-1 (No. 18 dyeing
Body), miR-133a-2 (No. 20 chromosomes) and miR-133b (No. 6 chromosomes).We analyze first
The source of ripe miR-133b/a-3p, by three miR-133 precursors in GES cell line
QRT-PCR analyzes, and finds that miR-133b/a-3p is mainly derived from miR-133a-1 and miR-133b (figure
2A).And the expression of miR-133 precursor miR-133a-1 and and miR-133b is same in gastric carcinoma cell lines
It is substantially less than its in GES cell line (Fig. 2 B).In view of epigenetics are modified in miRNA expression
Important function in regulation and control, we have studied DNA methylation, histone methylated and histone acetyl
Change effect in miR-133 expression regulation for three kinds of epigenetic modifications.Find histone methylated suppression
Agent DZNep and Antibiotic FR 901228 SAHA all can dramatically increase in gastric carcinoma cell lines
The expression of miR-133b/a-3p, and DNA methylation inhibitor 5-azacytidine does not then affect
The expression (Fig. 2 C) of miR-133b/a-3p, points out histone modification to take part in the table of miR-133b/a-3p
Reach regulation and control.And then, we adopt chromatin immune co-precipitation (CHIP) method to miR-133a-1 and
The epigenetics modification level of miR-133b promoter region carries out detection by quantitative.Find in stomach cancer cell
The two site H3K4me3 methylation level related to transcriptional activation and H3 Acetylation Level all significantly drop
Low；On the contrary, related to Transcription inhibition site H3K27me3 methylation level then significantly raises (Fig. 2 D).
Similar, in gastric carcinoma cell lines, the H3 Acetylation Level of miR-133b significantly reduces and H3K27me3
Methylation level significantly raises.Therefore, our research confirms, the downward of miR-133 is that histone is repaiied
Decorations mediation and unrelated with methylating of DNA.
In order to study biological effect produced by miR-133 downward in gastric cancer, we synthesize
The plan of miR-133 is used for high expression miR-133 (Fig. 3 A) in vitro like thing (mimics).Using interferin
MiR-133mimics or miR-133 inhibitor (inhibitor) is transfected gastric carcinoma cell lines by transfection reagent
Afterwards, using CCK-8 cell proliferation detection technique, find that the expression recovering miR-133 can significantly inhibit stomach
The propagation (Fig. 3 B) of cancerous cell.And then, gastric carcinoma cell lines are transfected miR-133 by us, after 72 hours
By Annexin V and the dyeing of PI apoptosis, and carry out Flow cytometry, find transfection miR-133
The ratio (Fig. 3 C) of Annexin V positive cell can be dramatically increased afterwards, point out miR-133 can lure
Lead the apoptosis of stomach cancer cell.In order to verify above-mentioned experimental result, we have carried out TUNEL to cell culture
With the double staining of DAPI, in the stomach cancer cell culture finding transfection miR-133, observe many apoptosis
Corpusculum, and transfection control group then only observes minimal amount of TUNEL positive cell (Fig. 3 D).Above-mentioned
Result of study is pointed out, and miR-133 can suppress the propagation of stomach cancer cell.
We have inquired into the target molecule of miR-133 effect further.Although previously research reported some
The target spot of miR-133, in this research, we first pass through TargetScan (www.targetscan.Org) and exist
The target spot of its effect of line software analysis, in conjunction with aforementioned experimental results thus it is speculated that Mcl-1 and Bcl-xL (Fig. 4 A)
It is probably the target spot that miR-133 plays antitumor action；Because this two molecules are all close with apoptosis
Related.By building double fluorescent reporter gene expression vectors of above-mentioned molecule it has been found that miR-133 exists
There is conservative target site in the 3 ' UTR region of Mcl-1 and Bcl-xL.Detection according to double fluorescent reporter gene
As a result, the action target spot that we demonstrate that miR-133 is anti-apoptotic molecule Mcl-1 and Bcl-xL (Fig. 4 B-C).
Pass through qPCR and Western Blot further it is experimentally confirmed that the plan of transfection miR-133 can reduce stomach like thing
In cancerous cell line Mcl-1 and Bcl-xL protein level expression but do not affect mRNA level in-site expression (figure
4D-E), prompting miR-133 may be translated after being transcribed by suppression and not affect the degraded of mRNA.Additionally,
It has been found that the expression of Mcl-1 and Bcl-xL is with miR-133's in these available gastric cancer clinical samples
Expression is in notable negative correlation, and related to the progress of stomach cancer (Fig. 4 F).The above results are pointed out,
MiR-133 is played a role by the 3 ' UTR region being directly targeted Mcl-1 and Bcl-xL.
Finally, we pass through to build gastric cancer in nude mice tumor-bearing model, the anti-tumor in vivo to miR-133
Effect is studied.We have synthesized the active drug in vivo cholesterol connection of miR-133 first
MiR-133 (AgomiR-133b/a-3p) and its blank agomiR-NC.By 1 × 106Gastric cancer is thin
Born of the same parents' subcutaneous injection, after the hind leg of nude mice, once passes through tail vein injection AgomiR-133b/a-3p altogether every time
6 weeks, observe the impact to tumor bearing nude mice tumour growth.Find that AgomiR-133b/a-3p can significantly prolong
Tumor becomes tumor time and tumor size late.Finally we put to death mice, obtain tumor tissues specimen, carry out
QPCR and histopathological analysis.Find its miR-133's of mice that AgomiR-133b/a-3p is processed
Level significantly raises, and the expression with Mcl-1 and Bcl-xL is remarkably decreased, and matches with experiment in vitro.
In sum, we conclude that, miR-133 can suppress gastric cancer tumor growth, can be used as treatment
A kind of potential targeted drug of gastric cancer.
Embodiment 2：The high expression impact to stomach cancer cell for the miR-133 in experiment in vitro
Shanghai JiMa pharmacy Technology Co., Ltd is entrusted to synthesize the plan of miR-133 like thing (mimics), sequence
As follows：
UUUGGUCCCUUCAACCAGCUG(SEQ ID NO.1)
Or UUUGGUCCCUUCAACCAGCUA (SEQ ID NO.2).
Experimental technique：
1st, stomach cancer cell culture and transfection：It is thin that gastric carcinoma cell line SGC-7901 and MNK45 are purchased from the Chinese Academy of Sciences
Born of the same parents storehouse, using the DMEM culture medium culturing containing 10%FBS, every 36h carries out 1:3 pass on.Cell
Transfect using INTERFERin transfection reagent (purchased from Polyplus-transfection company) and press reagent and say
Bright book transfects RNA.
2nd, real-time quantitative RT-PCR：Cell total rna uses TRIzol (Invitrogen) to extract, total mNRA
Using Fast200 test kit (flying prompt biological purchased from Shanghai) extracting.QRT-PCR uses SYBR RT-PCR
Test kit (Takara) simultaneously completes on LightCycler (Roche) real-time PCR.MiRNA's
Relative quantification uses 2-ΔΔCtMethod calculates (U6 is internal reference), and the relative quantification of mRNA is made using GAPDH
For internal reference.
Experimental result：Using INTERFERin transfection reagent by miR-133mimics or miR-133
After inhibitor transfection gastric carcinoma cell lines, using CCK-8 cell proliferation detection technique, find to recover
The expression of miR-133 can significantly inhibit the propagation (Fig. 3 B) of stomach cancer cell.And then, we are thin by gastric cancer
Born of the same parents system transfection miR-133, passes through Annexin V and the dyeing of PI apoptosis, and it is thin to carry out streaming after 72 hours
Born of the same parents' art detects, can dramatically increase the ratio (figure of Annexin V positive cell after finding transfection miR-133
3C), prompting miR-133 can induce the apoptosis of stomach cancer cell.In order to verify above-mentioned experimental result, I
Cell culture has been carried out with the double staining of TUNEL and DAPI, find the stomach of transfection miR-133
Cancerous cell culture in observe many apoptotic bodies, and transfection control group then only observe minimal amount of
TUNEL positive cell (Fig. 3 D).The studies above result is pointed out, and miR-133 is permissible in testing in vitro
The propagation of suppression stomach cancer cell.
Embodiment 3：In experiment in vivo, high expression miR-133 can suppress Gastric Carcinoma Growth.
Experimental technique：
1st, SGC7901 or MNK45 cell is prepared single cell suspension, with asepsis injector by 1 × 106
Individual cell is inoculated in oxter on the right side of nude mice by subcutaneous injection method, to make gastric cancer in nude mice tumor animal mould
Type.Nucleic acid drug AgomiR-133 (purchased from Guangzhou Rui Bo company) tail vein injection enters gastric cancer in nude mice lotus
In tumor animal model body.
2nd, real-time quantitative RT-PCR：Cell total rna uses TRIzol (Invitrogen) to extract, total mNRA
Using Fast200 test kit (flying prompt biological purchased from Shanghai) extracting.QRT-PCR uses SYBR RT-PCR
Test kit (Takara) simultaneously completes on LightCycler (Roche) real-time PCR.The phase of miRNA
2- Δ Δ Ct method is used to calculate (U6 is internal reference) to quantitative.
3rd, SABC：
1) mouse tumor is taken to organize, paraffin embedding, section, 60 DEG C of roasting piece, 1h；
2) dewaxing and rehydration：Dimethylbenzene 10min, 100% ethanol 5min, 95% ethanol 5min, 90% ethanol
5min, 85% ethanol 5min, 80% ethanol 5min, 75% ethanol 5min, 60% ethanol 5min,
50% ethanol 5min, 30% ethanol 5min, tap water 1min, hydrogen peroxide 1min；
3) 1 part of 30%H2O2Plus 10 parts of distilled water, room temperature 10min, distillation washing 3 times, each 3min；
4) antigen retrieval：By section immersion 0.01M citrate buffer, maximum fire (98 DEG C -100 DEG C) in microwave
It is heated to seething with excitement, cool down (about 5-10min), repeatedly twice；
5) section is naturally cooled to room temperature, PBS washs 3 times, each 5min；
6) close, 5%BSA, room temperature 20min, get rid of surplus liquid；
7) Deca one resist (MCL-1 and Bcl-xL), 37 DEG C, 1h, or 4 DEG C overnight；
8) PBS washs 3 times, each 3min；
9) Deca two resists, 37 DEG C, 15-30min；
10) PBS washs 3 times, each 3min；
11) Deca SABC, 37 DEG C, 30min；
12) PBS washs 3 times, each 5min；
13) difference Deca developer in 1ml distilled water, mixes；
14), after DAB developer configures, Deca is in section, room temperature, detection response time (about 5min) under mirror；
15) tap water is rinsed well, crosses distilled water；
16) haematoxylin redyes 2min, and tap water rinses；
17) it is dehydrated：30% ethanol 3min, 50% ethanol 3min, 70% ethanol 3min, 80% ethanol 3min,
90% ethanol 3min, 95% ethanol 3min, 100% ethanol 3min, dimethylbenzene 20min；
18) gummy mounting, microscopy.
Experimental result：In gastric cancer in nude mice tumor-bearing model, pass through tail vein injection once in a week
AgomiR-133b/a-3p totally 6 weeks, observes the impact to tumor bearing nude mice tumour growth.Find
AgomiR-133b/a-3p can significantly postpone tumor and become tumor time and tumor size.Finally we put to death little
Mus, obtain tumor tissues specimen, carry out qPCR and histopathological analysis.Find
The level of its miR-133 of mice that AgomiR-133b/a-3p is processed significantly raises, with Mcl-1 and
The expression of Bcl-xL is remarkably decreased it was demonstrated that the effectiveness of miR-133.
Below the preferred embodiment to the invention is illustrated, but the invention is not
It is limited to described embodiment, those of ordinary skill in the art are without prejudice on the premise of the invention spirit
A variety of equivalent modifications or replacement also can be made, these equivalent modifications or replacement are all contained in the application
In claim limited range.
Claims (10)
- Application in preparation anti-gastric cancer medicament for the 1.miR-133, described miR-133 be selected from following arbitrary or both Combination：MiR-133a-3p, sequence is as shown in SEQ ID NO.1；MiR-133b, sequence is as shown in SEQ ID NO.2.
- 2. application in preparation anti-gastric cancer medicament for the miR-133 according to claim 1 is it is characterised in that institute State miR-133a-3p and miR-133b to be used alone in preparation anti-gastric cancer medicament or apply simultaneously.
- 3. miR-133 according to claim 1 preparation anti-gastric cancer medicament in application it is characterised in that Described medicine, is the reagent referring to improve or increase miR-133 expression.
- 4. miR-133 according to claim 1 preparation anti-gastric cancer medicament in application it is characterised in that Described medicine can suppress the propagation of stomach cancer cell by targeting anti-apoptotic molecule Mcl-1 and Bcl-xL.
- 5. application in preparation anti-gastric cancer medicament for the miR-133 according to claim 1 is it is characterised in that institute The medicine stated refers to miR-133 for sole active composition, or the pharmaceutical composition containing miR-133.
- 6. miR-133 according to claim 5 preparation anti-gastric cancer medicament in application it is characterised in that Described pharmaceutical composition refers to containing the miR-133 described in effective dose, and pharmaceutically acceptable load Body.
- 7. miR-133 according to claim 1 preparation anti-gastric cancer medicament in application it is characterised in that Described medicine is miR-133, the expression plasmid containing miR-133 sequence, the height containing miR-133 sequence Expression adenoviruss or slow viruss.
- 8. miR-133 according to claim 1 preparation anti-gastric cancer medicament in application it is characterised in that Described medicine refers to miR-133 or the miR-133 activity in vivo composition containing miR-133 sequence AgomiR-133.
- 9. miR-133 according to claim 8 preparation anti-gastric cancer medicament in application it is characterised in that on Stating the miR-133 activity in vivo composition AgomiR-133 containing miR-133 sequence is AgomiR-133b/a-3p, concrete synthetic method is：After the mature sequence based on miR-133b or miR-133a-3p for the sequence of Agomir-133 synthesizes, 3 ' End connects a cholesterol molecule；Pass through sulfur between 5 ' end the first two nucleotide and 3 ' four nucleotide in end Generation reaction adds thio backbone modification, and complete nucleotide molecule all carries out the modification that methylates.
- 10. miR-133 according to claim 1 preparation anti-gastric cancer medicament in application it is characterised in that The route of administration of described medicine includes：Oral, intravenous injection, subcutaneous injection, muscle give, locally Give, implant, slow release gives, give in heart.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510507677.9A CN106466486A (en) | 2015-08-18 | 2015-08-18 | Application in preparation anti-gastric cancer medicament for the miR-133 small molecule nucleic acid drug |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510507677.9A CN106466486A (en) | 2015-08-18 | 2015-08-18 | Application in preparation anti-gastric cancer medicament for the miR-133 small molecule nucleic acid drug |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106466486A true CN106466486A (en) | 2017-03-01 |
Family
ID=58214267
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510507677.9A Pending CN106466486A (en) | 2015-08-18 | 2015-08-18 | Application in preparation anti-gastric cancer medicament for the miR-133 small molecule nucleic acid drug |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106466486A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113388615A (en) * | 2021-06-11 | 2021-09-14 | 扬州大学附属医院 | MiRNA for preventing and/or treating acute pancreatitis and pharmaceutical application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103764173A (en) * | 2011-07-01 | 2014-04-30 | 得克萨斯系统大学董事会 | Compositions and methods for treating skeletal myopathy |
| CN103933582A (en) * | 2014-04-28 | 2014-07-23 | 南通大学 | Application of Let-7 family miRNA (micro-ribonucleic acid) in preparing medicament for treating nerve regeneration related diseases |
-
2015
- 2015-08-18 CN CN201510507677.9A patent/CN106466486A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103764173A (en) * | 2011-07-01 | 2014-04-30 | 得克萨斯系统大学董事会 | Compositions and methods for treating skeletal myopathy |
| CN103933582A (en) * | 2014-04-28 | 2014-07-23 | 南通大学 | Application of Let-7 family miRNA (micro-ribonucleic acid) in preparing medicament for treating nerve regeneration related diseases |
Non-Patent Citations (3)
| Title |
|---|
| TIANZHU QIU等: "mir-145,mir-133a and mir-133b inhibit proliferation, migration, invasion and cell cycle progression via targeting transcription factor sp1 in gastric cancer", 《FEBS LETTERS》 * |
| YANFANG LIU等: "identification of miRNomes in human stomach and gastric carcinoma reveals miR-133b/a-3p as therapeutic target for gastric cancer", 《CANCER LETTERS》 * |
| 于鹏: "miRNAs对骨髓间充质干细胞分化的影响", 《中国博士学位论文全文数据库 医药卫生科技辑》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113388615A (en) * | 2021-06-11 | 2021-09-14 | 扬州大学附属医院 | MiRNA for preventing and/or treating acute pancreatitis and pharmaceutical application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | miR-221/222 promote malignant progression of glioma through activation of the Akt pathway | |
| Gu et al. | GFRα2 prompts cell growth and chemoresistance through down-regulating tumor suppressor gene PTEN via Mir-17-5p in pancreatic cancer | |
| Yuan et al. | MiR‐590‐3p regulates proliferation, migration and collagen synthesis of cardiac fibroblast by targeting ZEB1 | |
| CN107108686A (en) | RNA for malignant tumour disturbs composition and method | |
| CN107921147B (en) | New precursor miRNA and application thereof in tumor treatment | |
| Zhou et al. | M2 Macrophage-derived exosomal miR-501 contributes to pubococcygeal muscle regeneration | |
| CN107760784A (en) | Application of circular RNA circ-FOXP1 | |
| Guo et al. | Upregulation of miR-96 promotes radioresistance in glioblastoma cells via targeting PDCD4 | |
| Peng et al. | Nerve Growth Factor (NGF) Encourages the Neuroinvasive Potential of Pancreatic Cancer Cells by Activating the Warburg Effect and Promoting Tumor Derived Exosomal miRNA‐21 Expression | |
| Li et al. | Roles of a TMPO-AS1/microRNA-200c/TMEFF2 ceRNA network in the malignant behaviors and 5-FU resistance of ovarian cancer cells | |
| Yuan et al. | Advances of circRNA-miRNA-mRNA regulatory network in cerebral ischemia/reperfusion injury | |
| CN110251529A (en) | MiR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament | |
| CN106906217B (en) | siRNA for inhibiting Kdm6a gene expression and application thereof | |
| Song et al. | Downregulation of miR‑7 and miR‑153 is involved in Helicobacter pylori CagA induced gastric carcinogenesis and progression | |
| CN106466486A (en) | Application in preparation anti-gastric cancer medicament for the miR-133 small molecule nucleic acid drug | |
| CN110684841A (en) | Application of let-7b and rSjp40 in preparation of medicine for preventing or treating schistosome infection liver fibrosis | |
| CN113564252B (en) | New use of methylase METTL3 | |
| CN104995300B (en) | The adjusting of RNA activity and vasopermeability | |
| CN107858351A (en) | A kind of applications of double-strand siRNA in the medicine for preparing malignant tumour | |
| CN109224076B (en) | Gene miR-140-3P related to lung cancer diagnosis and treatment, and mimics and application thereof | |
| KR20130014840A (en) | Method for treating and diagnosing liver cancer using mir-636 | |
| CN105617401B (en) | Tumor radiation sensitization and radiation side effect weakening effects of miRNA, implementation method and application | |
| Wang et al. | Effect of tumor-derived extracellular vesicle-shuttled lncRNA MALAT1 on proliferation, invasion and metastasis of triple-negative breast cancer by regulating macrophage M2 polarization via the POSTN/Hippo/YAP axis | |
| Wu et al. | MicroRNA let-7a: A novel therapeutic candidate in prostate cancer | |
| CN114306608B (en) | Tumor treatment target point adapting to hypoxia or anoxia microenvironment and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170301 |