CN106434963A - Method for detecting methylation of wheat gamma-gliadin promoter region - Google Patents
Method for detecting methylation of wheat gamma-gliadin promoter region Download PDFInfo
- Publication number
- CN106434963A CN106434963A CN201610992110.XA CN201610992110A CN106434963A CN 106434963 A CN106434963 A CN 106434963A CN 201610992110 A CN201610992110 A CN 201610992110A CN 106434963 A CN106434963 A CN 106434963A
- Authority
- CN
- China
- Prior art keywords
- wheat
- promoter
- tawg04
- ptawg04
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of biological engineering, and in particular relates to a method for detecting whether a wheat gamma-gliadin promoter region is methylated or not. The wheat gamma-gliadin is gamma-gliadin TaWG04, and a promoter is a promoter pTaWG04 used for promoting the gamma-gliadin TaWG04 to perform translation and expression. When cytosine at -749bp of the promoter pTaWG04 and cytosine at -729bp of the promoter pTaWG04 are subjected to methylated modification, the expression of the gamma-gliadin TaWG04 is inhibited. The methylation detection method provided by the application is specifically used for detecting the wheat gamma-gliadin promoter region, and has the advantages of being short in detection period, high in specificity, high in accuracy, and the like; the method can be used for judging whether the promoter is methylated or not so as to effectively identify the expression status of the gamma-gliadin TaWG04 in wheat varieties, thus laying theoretical basis and application foundation for wheat quality improvement.
Description
Technical field
The invention belongs to technical field of bioengineering is and in particular to a kind of be directed to the molten protein promoter subregion of wheat γ -ol
Whether methylated detection method.
Background technology
Wheat seed is mainly made up of types of materials such as albumen, nucleic acid, lipid, carbohydrate, moisture.Egg is stored in wheat seed
White proportion is big, mainly includes glutelin and alcohol soluble protein two class, and they determine the unique processing quality of wheat.Wheat flour
Powder can form dough that is flexible and can bonding when adding water and rubbing up, and its exclusive cohesive is because it contains water-fast egg
White matter, i.e. glutenin and gliadin.In general, alcohol soluble protein accounts for the 40 ~ 50% of wheat seed storage protein total amount,
It is that the mankind mainly absorb one of source of nutrient protein.
Studied and thought, wheat has been one of main food allergen, thus in wheat seed the content of protein and
Quality directly affects quality of the life and the health of people.For example, wheat gliadin is the principal causative antigen of chylous diarrhea, and it is main
By polypeptide single-stranded presented in, rich in glutamine and proline, according to alcohol soluble protein in A-PAGE（pH=3.1）Electrophoresis moves
The difference of shifting rate, can be classified as α（The fastest）, β, γ and ω（The slowest）Four types, the toxicity of these albumen is considered to viscous
Membrane damage is larger.Therefore, the clone to alcohol soluble protein and function parsing also day by day become the main of current Wheat volatiles research
One of task, especially to alcohol soluble protein specific in wheat（Albumen TaWG04 as molten in γ -ol）Clone, analysis, can be specific mistake
The health of quick crowd provides basic research guarantee.
With regard to gene order（As promoter sequence）For, after it is by specific transformation or chemical modification, generally mean
The forfeiture of expression activity.As one of chemical modification, DNA methylation belongs to a kind of classical epigenetics phenomenon,
It is a kind of a kind of relatively conventional, more deep genetic modification mode of research.DNA methylation process is：In the transfer of DNA methyl
Under the catalysis of enzyme, methyl group transfers to cytosine base（C）On.After DNA methylation is modified, DNA sequence does not change
Become, but the transcript and expression of gene would generally be significantly affected in some instances it may even be possible to cause the silence of gene.
For the research of γ -ol molten albumen TaWG04, existing research has to its gene order, gene expression pattern
Basic research.But find in studying further, between different cultivars, the expression of this gene has certain difference,
And the reason to causing this difference：E.g. because gene order difference still starts the difference of the promoter of this gene expression
Different, then need to study further.For promoter research, then need to being due to promoter sequence difference, or chemical modification is former
Because being screened further.And be based on these researchs, then the expression of specific protein can be carried out with Gene regulation, thus more thorough
Solve the problems, such as allergen protein, thus there is highly important application value.
Content of the invention
Present invention aim at whether providing a kind of base of promoter pTaWG04 for γ -ol molten albumen TaWG04
There is methylated detection method, consequently facilitating judging that can γ -ol molten albumen TaWG04 obtain effective expression, and then being wheat
Quality-improving establishes application foundation.
Details are as follows for the technical scheme that the application is taken.
A kind of methylated detection method of the molten protein promoter subregion of wheat γ -ol, the molten albumen of described wheat γ -ol is
γ -ol molten albumen TaWG04, described promoter is to start the promoter that γ -ol molten albumen TaWG04 carries out accurate translation
PTaWG04, its base sequence is as shown in SEQ ID NO.1；Concrete detecting step is as follows：
（1）Extract the DNA of wheat samples, and process DNA extract with bisulfite；
（2）Carry out the design of specific primer using online methylated primers design software,（http://
www.urogene.org/cgi-bin/methprimer/methprimer.cgi）Primer sequence is as follows：
Forward primer F：5 '-ATTTTTTGAGGAATTTTATATTTGGTT-3 ',
Reverse primer R：5’-ATCCRTTTCAATTAAATCTTCCA-3’；
（3）With step（1）After middle process, DNA is template, using step（2）In designed primer sequence, carry out methylating spy
Different PCR（MSP）Reaction；The PCR detection reaction system design of 10 μ L is as follows：
25mM Mgcl2, 1 μ L；
10 × Maxima Hot Start Taq buffer, 1 μ L；
Maxima Hot start Taq DNA Polymerase, 0.1 μ L；
2.5mM dNTP mix, 1 μ L；
Forward primer F, 0.2 μ L；
Reverse primer R, 0.2 μ L；
Step（1）DNA profiling after middle process, 1 μ L；
ddH2O, 5.5 μ L；
PCR reaction condition is：95 DEG C of denaturations 4min；95 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of prolongation 1min, 30 are followed
Ring；Extend 10min after 72 DEG C；
（4）Recycling step（3）Middle pcr amplification product, using TA clone technology, the pcr amplified fragment being reclaimed is cloned into
On pMD18-T carrier, inverted, screening, checking after, select positive colony plasmid and be sequenced；
Sequencing result is compared with the non-methylated DNA fragments determining, final judgement promoter pTaWG04 region base sequence
Methylation status, decision method is：
After methylation-specific PCR reaction, non-methylated cytimidine in DNA sequence dna（C）Uracil can be fully converted to（U）,
And if containing methylated base, then methylated 5-methylcytosine can keep constant.
The non-methylated DNA fragments of described determination, are corresponding to γ -ol molten albumen TaWG04 normal expression in wheat breed
Promoter pTaWG04 sequence.
Corresponding to the molten albumen TaWG04 normal expression of described γ -ol promoter pTaWG04 sequence, corresponding wheat
Kind is, for example, specifically Zheng wheat 004.
, there is methylated wheat breed in described pTaWG04 promoter, be, for example, specifically Zheng wheat 366, western agriculture 979, new wheat
26th, Zheng wheat 9023 or Jimai 20.
Methylate modification pTaWG04 promoter wheat breed improvement in application ,-the 749bp of pTaWG04 promoter
Place's cytimidine（C）Locate cytimidine with -729bp（C）Methylate modification when, suppression γ -ol molten albumen TaWG04 expression；
The pTaWG04 promoter of the described modification that methylates, its corresponding wheat breed source, specifically for example, Zheng wheat 366, western agriculture
979th, new wheat 26, Zheng wheat 9023 or Jimai 20.
Based on above-mentioned methylation detecting method, testing result shows, alcohol soluble protein TaWG04 in wheat breed Zheng wheat 366
The section TTGCACACGGTGTATCAAATACAATGACGCA of promoter pTaWG04 upstream（-756bp ~-726bp）In-
The cytimidine of 749bp（C）Cytimidine with -729bp（C）Methylated modification, and it is suppressed that alcohol soluble protein after the modification that methylates
The expression of TaWG04；Further experiment shows, after corresponding methylated base demethylation, alcohol soluble protein TaWG04 gene
Expression is strengthened.
In early-stage Study, inventor finds the genomic dna sequence of γ -ol molten albumen TaWG04 in Zheng wheat 366 and Zheng
Indifference in wheat 004.However, this gene expression dose has notable difference in two kinds, the expression of this gene is in Zheng wheat
366 are substantially suppressed, and in conjunction with other research conditions, inventor speculates the promoter pTaWG04 area of γ -ol molten albumen TaWG04
Domain number of base sequence there may be the phenomenon that methylates.
For in the methylation detecting method of gene, methylation-specific PCR（Methylation-Specific PCR,
MSP）It is a kind of whether methylated method of quick detection gene, its know-why is will be phonetic for born of the same parents unmethylated in DNA sequence dna
Pyridine（C）It is fully converted to uracil（U）, and uracil（U）It is converted into thymidine during DNA replication dna（T）, and methylate
5-methylcytosine keep constant, thus whether methylated modification determines to related gene.Because the method is permissible
Carry out micro-analysis and homologous gene analysis, thus there is in analysis of related genes certain application prospect.But with regard to the application
For, because early stage is only to speculate that promoter number of base sequence there may be the phenomenon that methylates, but whether necessary being methyl
Change and whether be only because the gene expression difference that promoter partial methylation causes, be then unknown, also therefore, facing
During unknown nucleotide sequence, depend only on methylation-specific PCR number of base is carried out detection judge when, be to there is larger uncertainty
's.
In a word, methylation detecting method specificity provided herein is directed to the molten protein promoter subregion of wheat γ -ol
Detected there is that detection cycle is short, the specific high, degree of accuracy is high；Its direct application effect is can be to promoter
No presence methylates and is judged, according to this result, and then can effectively identify that γ -ol molten albumen TaWG04 divides in wheat breed
Cloth situation（Can determine that whether γ -ol molten albumen TaWG04 obtains effective expression in other words）, thus establishing for Wheat Quality Improvement
Theoretical foundation and application foundation.
Brief description
Fig. 1 is the quantitative PCR result of TaWG04 gene in Zheng wheat 366 and Zheng wheat 004；Result shows, TaWGG04 gene exists
In Zheng wheat 366, expression is relatively low, and the expression of this gene may be suppressed, and in figure " * * " represents TaWG04 gene in two materials
In expression there is significant difference；
Fig. 2 is after Zheng wheat 366 and Zheng wheat 004 methylation status of PTEN promoter detect, TaWG04 gene promoter upstream -726bp arrives -
Alignment's figure of 756bp；From alignment as can be seen that in Zheng wheat 004, C conversion at -749bp and -729bp position
For T, and in Zheng wheat 366, do not convert at -749bp and -729bp position；Wherein Zheng Un- wheat 366 represents and methylates
Nucleotide sequence before PCR detection process, Zheng T- wheat 366-1 ~ 10 represent the PCR testing result that methylates of 10 parts of Zheng wheat 366 samples,
Zheng T- wheat 004-1 ~ 10 represent the PCR testing result that methylates of 10 parts of Zheng wheat 004 samples；
Fig. 3 is the strong muscle kind wheat of 5 kinds of differences（Zheng wheat 366, western agriculture 979, new wheat 26, Zheng wheat 9023, Jimai 20）TaWG04
The methylation-specific PCR testing result of gene promoter upstream, wherein figure A are methylation-specific PCR（MSP）Detection rear electrophoresis
Figure, figure B is methylation-specific PCR（MSP）The sequence alignment figure of TaWG04 gene promoter upstream after detection；Zheng Un- wheat in figure B
366 represent the base sequence before methylation-specific PCR detection, the western agriculture of Zheng T- wheat 366, T- 979, the new wheat of T- 26, Zheng T- wheat 9023
Represent the base sequence after methylation-specific PCR detection with T- Jimai 20；
Fig. 4 is using the strong muscle kind wheat of 5 kinds of differences of demethylation agent treatment（Zheng wheat 366, western agriculture 979, new wheat 26, Zheng Mai
9023rd, Jimai 20）Afterwards, the testing result to TaWG04 gene expression amount for the quantitative PCR；Result shows, after processing through demethylation,
The expression of TaWG04 gene significantly improves；Wherein " * * " represents that expression in two materials for the TaWG04 gene has significantly
Sex differernce.
Specific embodiment
With reference to embodiment further details of explanation to technical solution of the present invention, before introducing specific embodiment, just
It is related to the briefly introduction of partial material situation in following embodiments to be described as follows.
Biomaterial：
Zheng wheat 366（Strong muscle kind）, western agriculture 979（Strong muscle kind）, new wheat 26（Strong muscle kind）, Zheng wheat 9023（Strong muscle kind）、
Jimai 20（Strong muscle kind）, Zheng wheat 004（Weak muscle kind）, provided by academy of agricultural sciences of Henan Province, these kinds belong to disclose
The commercial wheat kind obtaining；
E.colistraindh5α, purchased from Beijing Quan Shi King Company；
Experiment reagent：
DNA molecular amount marks（DNA Marker）, PCR mix etc. be TaKaRa Products；
High-fidelity enzyme Phusion, pMD18-T carrier, first chain synthetic agent box of cDNA are purchased from Fermentas company；
The little extraction reagent kit of plasmid, glue return kit, RNA extracts kit is purchased from Tiangeng biochemical technology（Beijing）Co., Ltd；
Kit for methylate DNA sample extraction is purchased from QIAGEN company (DNEASY PLANT MiNi Kit)；
Methylation analysis kit is purchased from QIAGEN company (EpiTect Bisulfite Kit).
Embodiment 1
On the basis of early-stage Study, the promoter pTaWG04 sequence such as SEQ of γ -ol molten albumen TaWG04 gene known to inventor
Shown in ID NO.1, therefore inventor is initially believed that the promoter of the γ -ol molten albumen TaWG04 gene of Zheng wheat 366 and Zheng wheat 004
The sequence of pTaWG04 is also identical.
Although base sequence is identical, Real time pcr analysis show further, the expression of TaWG04 gene（I.e.
The content of γ -ol molten albumen TaWG04）There is notable difference in Zheng wheat 366 and Zheng wheat 004.Below Real time PCR is divided
Analysis experiment is briefly discussed below.
（1）Extract RNA first（RNA extracts kit）, and reverse transcription is cDNA（First chain synthetic agent box of cDNA）,
Specific operation process is：
Seed after taking Zheng wheat 366, Zheng wheat 004 to pollinate respectively 28 days, extracts its RNA, and reverse transcription becomes cDNA；
（2）Using Actin as reference gene, design specific primer, with above-mentioned prepared cDNA as template, carry out Real
Time pcr analysis；
Quantitative design of primers used is：
TaWG04-F：5 '-TGCATGTCCCATCTGATTGC-3 ',
TaWG04-R：5’-TTTCCATTGCTACATCGATGGT-3’；
Actin-F:：5 '-GGCCCTTGCTCCTAGCAGTA-3 ',
Actin-R：5’- CCGGGACCAGACTCATCGTA-3’；
The 20 μ L reaction system designs of Real time PCR are as follows：
CDNA template, 60ng/ μ L, 8.4 μ L；
TaWG04-F, 10 μM, 0.8 μ L；
TaWG04-R, 10 μM, 0.8 μ L；
SYBR Green Real-time PCR Master Mix, 10 μ L；
Real time PCR amplification program the following is：95 DEG C, 2min (1 circulation)；95 DEG C, 10s, 60 DEG C, 10s, 72 DEG C,
30s (40 circulations)；95 DEG C, 10s (1 circulation)；65 DEG C to 95 DEG C 5s.
Finally, according to 2−ΔΔ CtMethod, using the knot of Bio-Rad CFX Manager software analysis Real-time PCR
Really.Mapped according to expression mean value ± SEM.
Result is as shown in Figure 1B.Can be seen that γ -ol molten albumen TaWG04 gene from Real time PCR result in Zheng
The expression of wheat 366 and Zheng wheat 004 has fairly obvious difference.
It should be noted that associative operation carries out operating with reference to corresponding reagent box specification, repeat no more.
Embodiment 2
Can be seen that although the promoter pTaWG04 sequence of γ -ol molten albumen TaWG04 gene is identical from above-described embodiment 1, but
In different cultivars, γ -ol molten albumen TaWG04 gene expression amount differs greatly.This difference of inventor's preliminary judgement be due to
There is some difference causes for promoter pTaWG04 sequence, and because its base sequence known is identical, then this difference
Be particularly likely that part base sequence in the promoter in one of kind be modified by sulphation caused by.Repair due to methylating
Decorations are the most common and common a kind of forms of change base activity in chemical modification, thus inventor is first with methylating
The base sequence of promoter pTaWG04 to γ -ol molten albumen TaWG04 gene for the specific PCR technology whether there is the phenomenon that methylates
Analyzed, concrete test experience process is briefly discussed below.
（1）Extract wheat samples DNA, with reference to plant DNA extraction kit（QIAGEN company, DNEASY PLANT MiNi
Kit）Specification, extract the DNA of Zheng wheat 366 and Zheng wheat 004 respectively, concrete operation step is as follows：
（A）The method using liquid nitrogen snap frozen first grinds sample（Zheng wheat 004 and Zheng wheat 366 seed）, it is subsequently adding 400 μ L
Buffer AP1 and 4 μ L Rnase A（With before can not mix）, under the conditions of 65 DEG C, it is incubated 15min, every 2 ~ 3min during incubation
Overturn once（Suitably incubation time can be increased as needed, so that RNA is fully degraded）；
（B）To step（A）Reactant liquor in plus 130 μ L Buffer P3, mix, ice bath 5min；Then 17000g centrifugation
5min；
Draw supernatant to new Qiagen shreader adsorption column (purple), then 17000g centrifugation 2min；
Draw collection liquid to new EP pipe（2mL）In, plus 1.5mL Buffer AW1, piping and druming mixing；
Draw supernatant 650 μ L to DNeasy adsorption column again（White）In, 10000g is centrifuged 1min, outwells supernatant, is repeated up to molten
Liquid has all moved；
（C）Put in new 2mL EP pipe, add 500 μ L Buffer AW2,10000g, centrifugation 1min, outwell supernatant；
Add 500 μ L Buffer AW2,17000g, centrifugation 2min；
Collecting pipe is put in new 1.5mL Ep pipe, stands 5min（Fully remove ethanol, can carry out in superclean bench）；
（D）100 μ L Buffer AE dissolvings, room temperature places 5min, 10000g, centrifugation 1min（Can reduce molten for raising DNA concentration
The amount of solution liquid）；
Repeat this step（Liquid is sucked again, centrifugation again improves sample acquisition amount）.
（2）Bisulfite converts DNA, to carry out methylation analysis, specially：
Methylation analysis kit using QIAGEN company（EpiTect Bisulfite Kit）To step（1）Middle gained DNA
Carry out bisulfite conversion processing, concrete process step is as follows：
（A）Preparation before beginning：
30mL absolute ethyl alcohol is added in Buffer BW（Mixed with overturning before）, 15 ~ 25 DEG C save backup；
27mL absolute ethyl alcohol is added in Buffer BD（96%~100%）, 2 ~ 8 DEG C save backup（Using shaking up before, using it
Close the lid immediately afterwards）；
Plus 310uL Rnase-free to Lyophilized Carrier RNA（310μg）In, it is made into the molten of 1 μ g/ μ L concentration
Liquid, is vortexed uniformly（Carrier RNA makes DNA and Epitect film combination even closer）；
By solution and the Buffer BL of dissolving Carrier RNA with 1:10 ratio is mixed；
In experimentation, if Buffer BL has precipitate, can place（<70℃）In water-bath, soft stirring makes it dissolve；But
Using before each solution should be made to keep same room temperature；
（B）Bisulfite converts DNA, and detailed process is：
A, 800 μ L Rnase-free water are added in Bisulfite Mix, mix about 5min until
Bisulfite Mix is completely dissolved（Can be heated to 60 DEG C about in course of dissolution to promote to dissolve, must not place after dissolving
On ice）；
B, preparation 140 μ L bisulfite conversion reaction solutions, specially：
DNA solution (1ng ~ 2ug), 10 μ L；
Rnase-free water, 10 μ L；
Bisulfite Mix, 85 μ L；
DNA Protect Buffer, 35 μ L；
After mixing reactant liquor, it is placed in room temperature（15~25℃）Under the conditions of mixed with abundant；
It should be noted that after DNA Protect Buffer adds, solution can become blue from green, now shows to mix abundant and PH
Value is correct；
C, the reactant liquor of above-mentioned mixing is placed in carry out bisulfite conversion DNA reaction, react about 5h（Whole course of reaction
Do not exceed 6h）；Specifically course of reaction is：
Denaturation, 95 DEG C, 5min；Insulation hatching, 60 DEG C, 25min；Denaturation, 95 DEG C, 5min；Insulation hatching, 60 DEG C, 85min；Become
Property, 95 DEG C, 5min；Insulation hatching, 60 DEG C, 175min；Preserve, 20 DEG C, 30min.
It should be noted that after bisulfite conversion DNA, after transformation, DNA can be saved in PCR instrument, will not be sexual
The loss of energy.
（C）Purify the DNA of bisulfite conversion, specially：
By step（B）Middle reaction completely reactant liquor transfer in new 1.5mL centrifuge tube (precipitation does not affect subsequent experimental, but
Try not to precipitate)；Plus 560 μ L Buffer BL（Containing 10 μ g/mL Carrier RNA）, it is vortexed and brief centrifugation；
Inhale whole mixed liquors in adsorption column, 12000g is centrifuged 1min, outwells collection liquid；
Add 500 μ L Buffer BW in adsorption column, 12000g is centrifuged 1min, outwells collection liquid；
500 μ L Buffer BD, room temperature is added in adsorption column（15~25℃）Incubation 15min, covers lid, and 12000g is centrifuged
1min, outwells collection liquid；
Add 500 μ L Buffer BW in adsorption column, 12000g is centrifuged 1min, outwells collection liquid；Repeat this step once；
Adsorption column is put in new 2mL collecting pipe, 12000g is centrifuged 1min, removes residual liquid；
Adsorption column is put in new 1.5ml centrifuge tube, 56 DEG C of incubation 5min, to allow residual liquid to evaporate；
Add 20 μ L Buffer EB in the filter membrane of adsorption column, 15000g is centrifuged 1min eluted dna, after the DNA of wash-out is used for
Continuous experiment or be stored in -20 DEG C standby.
（3）PCR expands, conversion, screening, and is sequenced, to judge to whether base there occurs to methylate, tool
Body process is：
Design special primer first, with step（2）The DNA of middle wash-out is template, enters performing PCR amplification, concrete primer sequence design
As follows：
Forward primer F：5 '-ATTTTTTGAGGAATTTTATATTTGGTT-3 ',
Reverse primer R：5’-ATCCGTTTCAATTAAATCTTCCA-3’；
The PCR amplification system design of 10 μ L is as follows：
25mM Mgcl2, 1 μ L；
10 × Maxima Hot Start Taq buffer, 1 μ L；
Maxima Hot start Taq DNA Polymerase, 0.1 μ L；
2.5mM dNTP mix, 1 μ L；
Forward primer F, 0.2 μ L；
Reverse primer R, 0.2 μ L；
Step（2）Middle eluted dna（Template DNA）, 1 μ L；
ddH2O, 5.5 μ L；
PCR reaction condition is：95 DEG C of denaturations 4min；95 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of prolongation 1min, 30 are followed
Ring；Extend 10min after 72 DEG C.
Electrophoresis detection is carried out to pcr amplification product（Gum concentration is 1.2%）, target stripe about 300bp, cut containing target
The blob of viscose of band, in 2mL centrifuge tube, carries out the recovery of PCR primer using the glue reclaim kit of Tiangeng company.The PCR reclaiming
Product is building up on pMD18-T carrier（Fermentas company）, 10 μ L linked systems are as follows：
PMD18-T Vector, 1 μ L；
Solution I, 5 μ L；
Recovery product, 4 μ L；
16 DEG C connect 3 hours
Connection product is converted in bacillus coli DH 5 alpha, coats solid LB screening and culturing medium（Amp resistance, concentration is 100mg/
mL）, it is put in culture 14h in 37 DEG C of constant incubators.Picking monoclonal simultaneously send raw work bioengineering（Shanghai）Carry out sequencing fragment.
Sequencing result shows：Zheng wheat 366 is identical with the promoter pTaWG04 base sequence of Zheng wheat 004（Sequencing result
As shown in sequence table SEQ ID NO.1）, its upstream -726bp to -756bp place gene base sequence be specially（As Figure 1A institute
Show）：
Zheng wheat 366（Zheng wheat 004）： -756 TTGCACACGGTGTATCAAATACAATGACGCA -726.
But shown based on above-mentioned DNA methylation assay result：γ -ol molten albumen TaWG04 gene in wheat breed Zheng wheat 366
The section TTGCACACGGTGTATCAAATACAATGACGCA of promoter pTaWG04 upstream（-756bp ~-726bp）In permissible
Find out, C does not all change on -749, -735, -727, -729 positions, show occur methylating now on this four positions
As, but sequence alignment finds that -749, -729 do not have to methylate in Zheng wheat 004,（As shown in Figure 2）, and just because of this
The difference that monomethylization is modified is it is suppressed that expression in Zheng wheat 366 for the γ -ol molten albumen TaWG04（As shown in Figure 1）.
As Zheng wheat 366, inventor is further to the promoter in western agriculture 979, new wheat 26, Zheng wheat 9023 and Jimai 20
PTaWG04 has carried out methylation-specific PCR and sequencing analysis, and result is as shown in Figure 3.Can be with primitive decision from Fig. 3 A, these
The promoter sequence of kind is identical, but can be seen that the part of the promoter these kinds from the sequencing result of Fig. 3 B
Base equally there occurs the modification phenomenon that methylates.
Embodiment 3
On the basis of embodiment 2 testing result, the modification that methylates for verifying base further is uniquely to affect the molten egg of γ -ol
The reason white TaWG04 expresses, thus it is necessary with regard to methylated base again demethylation, γ -ol after detection demethylation simultaneously
The expression of molten albumen TaWG04, if testing result shows, after demethylation, the expression of γ -ol molten albumen TaWG04
It is significantly improved（Expression is recovered in other words）, then i.e. it is believed that number of base in promoter pTaWG04
Methylating is the sole cause of impact γ -ol molten albumen TaWG04 expression.Actual result also demonstrates, in promoter pTaWG04
Strictly unique influence factor that methylates of number of base.Below related experiment process is briefly discussed below.
（One）The demethylation of number of base in methylated promoter pTaWG04
Using demethylation reagent（5-Aza-2 '-deoxycytidine, Sigma company）Respectively to Zheng wheat 366, western agriculture 979,
New wheat 26, Zheng wheat 9023 and Jimai 20 are processed, and specific demethylation experimentation is：
1st, take the 5-Aza-2 '-deoxycytidine of 12mg（Decitabine）Reagent is added to 50mL sterilized water
Middle dissolving, is configured to the solution for standby of 1mM；
2nd, the Tris of 12.1g is dissolved in sterilized water, adjusts pH to 7.5 with Hcl, be settled to 100mL, be configured to 1M
Tris-Hcl（pH 7.5）；
3rd, prepare the demethylation reagent buffer for wheat seed sample treatment, its control group is joined with experimental group buffer solution
Put scheme as follows：
；
4th, by after wheat seed sterilization, processed respectively with above-mentioned experiment reagent, after germination, move into chamber planting, concrete mistake
Cheng Wei：
First, take the wheat seed of different cultivars respectively, carry out disinfection sterilizing respectively, concrete sterilizing program is：70% is alcohol-pickled
1min, is washed out 2-3 time；30% H2O2Soak 5min, then wash 3-5 time；
Secondly, after seed is dried, it is placed on the culture dish added with a metafiltration paper, add 2mL sterilized water, 37 DEG C of culture 16h；
Then, the seed after culture is respectively placed on the new culture dish added with a metafiltration paper, is labeled as A（Control group）And B（Real
Test group）, to A（Control group）Add 2mL A buffer solution, 25 DEG C, dark culturing 48h, to B（Experimental group）Add 2mL B buffer solution,
25 DEG C, dark culturing 48h；
Finally, move into chamber planting after germination, breeding condition is as follows：
Photoperiod is illumination in 16 hours and 8 hours dark, 500 μm of ol/m of intensity of illumination2/ s, during seedling stage illumination, temperature is 20
DEG C, dark when temperature be 15 DEG C, when booting and pustulation period illumination temperature be 30 DEG C, dark when temperature be 20 DEG C.
（Two）Using real-time quantitative fluorescence PCR, the expression of γ -ol molten albumen TaWG04 is detected
Gather Zheng wheat 366 after above-mentioned demethylation agent treatment, western agriculture 979, new wheat 26, Zheng wheat 9023 and Jimai 20 respectively little
Wheat mature seed, extracts seed RNA and reverse transcription is cDNA, using real-time quantitative fluorescence PCR（QPCR kit, TOYOBO is public
Department）Technology detects, concrete detection process is as follows to the expression of γ -ol molten albumen TaWG04.
（1）Extract RNA first（RNA extracts kit）, and reverse transcription is cDNA（First chain synthetic agent box of cDNA）,
Specific operation process is：
（2）Using Actin as reference gene, design specific primer, with above-mentioned prepared cDNA as template, carry out Real
Time pcr analysis；
Quantitative design of primers used is：
TaWG04-F：5 '-TGCATGTCCCATCTGATTGC-3 ',
TaWG04-R：5’-TTTCCATTGCTACATCGATGGT-3’；
Actin-F:：5 '-GGCCCTTGCTCCTAGCAGTA-3 ',
Actin-R：5’- CCGGGACCAGACTCATCGTA-3’；
The 20 μ L reaction system designs of Real time PCR are as follows：
CDNA template, 60ng/ μ L, 8.4 μ L；
TaWG04-F, 10 μM, 0.8 μ L；
TaWG04-R, 10 μM, 0.8 μ L；
SYBR Green Real-time PCR Master Mix, 10 μ L；
Real time PCR amplification program the following is：95 DEG C, 2min (1 circulation)；95 DEG C, 10s, 60 DEG C, 10s, 72 DEG C,
30s (40 circulations)；95 DEG C, 10s (1 circulation)；65 DEG C to 95 DEG C 5s.
Finally, according to 2−ΔΔ CtMethod, using the knot of Bio-Rad CFX Manager software analysis Real-time PCR
Really.Mapped according to expression mean value ± SEM.
Result is as shown in Figure 4.Zheng wheat after Real time PCR result can be seen that demethylation agent treatment
366th, in western agriculture 979, new wheat 26, Zheng wheat 9023 and Jimai 20, the expression of γ -ol molten albumen TaWG04 significantly improves.
In sum, methylated and demethylation experiment is it is believed that in the middle part of promoter pTaWG04 by a series of
The influence factor being uniquely affect γ -ol molten albumen TaWG04 expression that methylates of point base.Based on this characteristic, it can be wheat
Good theoretical foundation and application foundation are established in breed improvement.
SEQUENCE LISTING
<110>Inst of Wheat, Henan Academy of Agricultural Sciences
<120>A kind of methylated detection method of the molten protein promoter subregion of wheat γ -ol
<130> none
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 1571
<212> DNA
<213> Triticum aestivum
<400> 1
tagatcccct gttgtaattt atcaaaaatt tatacacaag ctgcctttcc ataatttgaa 60
acattgtact ttctacttgc ctgcaggaag aactcttttg ttatggaccc ccttatctgg 120
cgaatagtcg ccaggagggg gtggcatttg cgaatgattc gctggcagtt ttagtttgag 180
ggatggaagt ttacatcagg gcgacatgac aatttctttt tgagaaggca aattgttgtt 240
ttaaataggc atcgtttgat cttgtctcgg aaccgaaact gccatcgaaa gagtttcgtt 300
tgccacctct ctcccagcaa acgattgcca attatgatta ccgtttgtta tatgcatgaa 360
ctgtgcgtct acagttggcg gcagcgaggt tgaggagacc ggtgtcatcg gcagcggctt 420
cagccggtgg aggcgtccta tggttgacgg ccgtgctcct tcctgctcga gaagagaagt 480
gagagggtgg tgagaggtga agagagcagg aggcggcagc ctggtgctgc tgcgggtcgt 540
agtaggagcc aaggcggcgg tgctgggtgg ctcgggctgt tatgcgggcg cgcgagcgac 600
accaagccct caacaaccgt gtccgtttca gttgggtctt ccatgttggg tacactggtg 660
gtgtccggct ctccgtctgc gtccattgtc cgttttggcg acccaaacgg acaaaaagcg 720
gacaaaaatt cgtgtccgtt tgagtcattg cgttgaagtt ggccttatgc tattccacag 780
tatactcaac gcactctaat tcacattgca tgctattaca tgcgtcattg tatttgatac 840
accgtgtgca atattttttt tctggtgaca atatatctac tatcgaacca agtataaagt 900
tcctcaaagg gtttaatatc atgttcatgg tgttcccgcg gaaatgcatg ggaatcatct 960
agtgtctatt aacaactata cgacattact aacattggca taaaaaaaag aattgatgag 1020
tcatgtatgc ttgttcatct taccatcata ttacacaaaa ctacgaagtt agttcagaaa 1080
gaaatagtct agaacaatct tcatattaat agtatgatct atcttaacaa cgccaagcaa 1140
gactataaac ttagttcccg acaagctatg ccaacctaga tgtgcctaac aacttgcaga 1200
acattacaaa cttagtttta gaaaggggtg taatatagat aagtgtttcg catgtaaaat 1260
gaatatgatg agtcattacg attatcaagc tttcctggca ctccatggat gtgtgctgca 1320
agaaagcaac tttggcgatc aatctgaaaa ttacacttgt aagtagcgcc accgaacaaa 1380
acataccaaa ggatcagttt gataagagta gaggaacttt acaagaaagc aaatgtgaag 1440
acgaaaagaa atcatttcat ggcagctata aatagccata cgccatgaag acccccttcc 1500
atcatccatc cttcagaaat ttggagcaca agcatccata ataaacaatc aagagtaacc 1560
acaaattcac c 1571
Claims (4)
1. a kind of molten methylated detection method of protein promoter subregion of wheat γ -ol is it is characterised in that described wheat γ -ol
Molten albumen is γ -ol molten albumen TaWG04, and described promoter is to start the startup that γ -ol molten albumen TaWG04 carries out transcriptional expression
The base sequence of sub- pTaWG04, pTaWG04 promoter is as shown in SEQ ID NO.1；Concrete detecting step is as follows：
（1）Extract the DNA of wheat samples, and process DNA extract with bisulfite；
（2）Design specific primer sequence is as follows：
Forward primer F：5 '-ATTTTTTGAGGAATTTTATATTTGGTT-3 ',
Reverse primer R：5’-ATCCGTTTCAATTAAATCTTCCA-3’；
（3）With step（1）After middle process, DNA is template, using step（2）In designed primer sequence, carry out methylating spy
Different PCR reaction；
（4）Recycling step（3）Middle pcr amplification product, using TA clone technology, the pcr amplified fragment being reclaimed is cloned into
On pMD18-T carrier, inverted, screening, checking after, select positive colony plasmid and be sequenced；
Sequencing result is compared with the non-methylated DNA fragments determining, final judgement promoter pTaWG04 region base sequence
Methylation status, decision method is：
After methylation-specific PCR reaction, in DNA sequence dna, non-methylated cytimidine can be fully converted to uracil, and if
Containing methylated base, then methylated 5-methylcytosine can keep constant；
The non-methylated DNA fragments of described determination, be corresponding to γ -ol molten albumen TaWG04 normal expression in wheat breed open
The sequence of mover pTaWG04.
2. the methylated detection method of the molten protein promoter subregion of wheat γ -ol as claimed in claim 1 is it is characterised in that institute
State the sequence of promoter pTaWG04 corresponding to γ -ol molten albumen TaWG04 normal expression, corresponding wheat breed is specially Zheng
Wheat 004.
3. methylate modification pTaWG04 promoter wheat breed improvement in application it is characterised in that pTaWG04 start
- 749bp place's cytimidine of son and -729bp place cytimidine methylate when modifying, the table of suppression γ -ol molten albumen TaWG04
Reach.
4. methylate the application in wheat breed improvement for the pTaWG04 promoter of modification as claimed in claim 3, and its feature exists
In, the pTaWG04 promoter of the described modification that methylates, its corresponding wheat breed source, specially Zheng wheat 366, western agriculture 979, new
Wheat 26, Zheng wheat 9023 or Jimai 20.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610992110.XA CN106434963B (en) | 2016-11-11 | 2016-11-11 | A kind of detection method of the molten protein promoter subregion methylation of wheat γ -ol |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610992110.XA CN106434963B (en) | 2016-11-11 | 2016-11-11 | A kind of detection method of the molten protein promoter subregion methylation of wheat γ -ol |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106434963A true CN106434963A (en) | 2017-02-22 |
| CN106434963B CN106434963B (en) | 2019-09-17 |
Family
ID=58207021
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610992110.XA Active CN106434963B (en) | 2016-11-11 | 2016-11-11 | A kind of detection method of the molten protein promoter subregion methylation of wheat γ -ol |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106434963B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102307999A (en) * | 2009-02-03 | 2012-01-04 | 科学研究高等机关 | Polynucleotide comprising sequences of wheat gliadins and use thereof for silencing by rnai |
-
2016
- 2016-11-11 CN CN201610992110.XA patent/CN106434963B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102307999A (en) * | 2009-02-03 | 2012-01-04 | 科学研究高等机关 | Polynucleotide comprising sequences of wheat gliadins and use thereof for silencing by rnai |
Non-Patent Citations (3)
| Title |
|---|
| ANDERSON，O.D.等: "JX295577.2", 《GENBANK》 * |
| FERNANDO PISTON等: "Analysis of the activity of a γ-gliadin promoter in transgenic wheat and characterization of gliadin synthesis in wheat by MALDI-TOF during grain development", 《MOL BREEDING》 * |
| 王瑞娴: "玉米转录因子Opaque2基因的转录调控与19-KDa α-醇溶蛋白基因的DNA甲基化研究", 《中国博士学位论文全文数据库 农业科技辑》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106434963B (en) | 2019-09-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108410907B (en) | Method for realizing HMGCR gene knockout based on CRISPR/Cas9 technology | |
| EP3805391A1 (en) | Use of yr4ds gene of aegilops tauschii in stripe rust resistance breeding of triticeae plants | |
| CN105648071A (en) | SNP (single nucleotide polymorphism) marker and method for identifying MC1R (melanocortin receptor 1) genes of pig breeds and colors of pig breeds as well as application | |
| CN110205388B (en) | Molecular marking method for two mutation sites in chicken MMP-11 gene 5' regulatory region and application of molecular marking method in chicken sexual precocity trait breeding | |
| CN106399323A (en) | Paddy rice leaf color regulation and control gene YL1 and use thereof | |
| CN112662760A (en) | Cancer gene methylation detection system and cancer in-vitro detection method implemented in cancer gene methylation detection system | |
| CN108384859A (en) | With the relevant SNP marker of tail type character of broadtail type sheep and application | |
| CN112662762A (en) | Probe composition for detecting 5 tumors of digestive tract | |
| CN112662763A (en) | Probe composition for detecting common amphoteric cancers | |
| CN106995850A (en) | It is a kind of to be used to detecting that mankind's mgmt gene to methylate the multiple fluorescence PCR detection reagent box of mutation | |
| CN106191253B (en) | Beijing duck based on GBS technology simplifies gene order surveying method | |
| KR101749547B1 (en) | Method for identifying species of eel using pna probe | |
| CN106566872B (en) | The analysis method in the pig SNP marker site based on sequencing genotyping technique | |
| Leroy et al. | A rapid method for detection of plant genomic instability using unanchored-microsatellite primers | |
| CN105483225B (en) | The specific Function molecular labeling of rice temp-sensing genic male sterile gene tms5 and its application | |
| CN111876514A (en) | Method for rapidly detecting gibberellin microspecies generated in rice bakanae disease | |
| CN106434963B (en) | A kind of detection method of the molten protein promoter subregion methylation of wheat γ -ol | |
| CN112662759A (en) | Probe composition for detecting 3 lumen organ tumors | |
| CN104109669B (en) | Genetic markers and application of the pig AMPD1 gene promoter regions SNP as hog on hook character | |
| CN106146638B (en) | It is a kind of control Senescence of Rice gene and its coding protein | |
| CN112921104B (en) | Variable shear marker for assisting in selecting weight of sheep tail fat, detection primer and application thereof | |
| AU2013302536A1 (en) | Lignin degrading enzymes from Macrophomina phaseolina and uses thereof | |
| CN112662764A (en) | Probe composition for detecting 11 cancers | |
| JP2011024439A (en) | Method for preparing sample nucleic acid | |
| KR20190139756A (en) | Method for regenerating modified plant from cell having modified gene involved in flavonoid biosynthesis using CRISPR/Cas9 system in Petunia protoplast |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |