CN106434687A - Gene QDTY11.5<IR66897B> for substantially enhancing drought tolerance of rice in reproductive stage, and molecular marking method thereof - Google Patents
Gene QDTY11.5<IR66897B> for substantially enhancing drought tolerance of rice in reproductive stage, and molecular marking method thereof Download PDFInfo
- Publication number
- CN106434687A CN106434687A CN201610485842.XA CN201610485842A CN106434687A CN 106434687 A CN106434687 A CN 106434687A CN 201610485842 A CN201610485842 A CN 201610485842A CN 106434687 A CN106434687 A CN 106434687A
- Authority
- CN
- China
- Prior art keywords
- drought
- breeding
- ir66897b
- rice
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
- 235000007164 Oryza sativa Nutrition 0.000 title claims abstract description 49
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 33
- 235000009566 rice Nutrition 0.000 title claims abstract description 29
- 230000024346 drought recovery Effects 0.000 title claims abstract description 8
- 240000007594 Oryza sativa Species 0.000 title claims description 43
- 238000000034 method Methods 0.000 title abstract description 15
- 230000002708 enhancing effect Effects 0.000 title abstract 2
- 230000001850 reproductive effect Effects 0.000 title abstract 2
- 238000009395 breeding Methods 0.000 claims abstract description 27
- 230000001488 breeding effect Effects 0.000 claims abstract description 24
- 238000002372 labelling Methods 0.000 claims abstract description 10
- 210000000349 chromosome Anatomy 0.000 claims abstract description 7
- 241000209094 Oryza Species 0.000 claims abstract 6
- 239000000463 material Substances 0.000 claims description 8
- 108700028369 Alleles Proteins 0.000 claims description 6
- 239000008280 blood Substances 0.000 claims description 2
- 210000004369 blood Anatomy 0.000 claims description 2
- 239000012634 fragment Substances 0.000 claims description 2
- 241000196324 Embryophyta Species 0.000 abstract description 15
- 238000004458 analytical method Methods 0.000 abstract description 7
- 239000003147 molecular marker Substances 0.000 abstract description 6
- 230000008569 process Effects 0.000 abstract description 6
- 238000005516 engineering process Methods 0.000 abstract description 5
- 238000009394 selective breeding Methods 0.000 abstract description 3
- 238000009396 hybridization Methods 0.000 abstract 1
- 238000006116 polymerization reaction Methods 0.000 abstract 1
- 238000005204 segregation Methods 0.000 abstract 1
- 238000011160 research Methods 0.000 description 9
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 9
- 230000000694 effects Effects 0.000 description 8
- 230000008641 drought stress Effects 0.000 description 7
- 238000012360 testing method Methods 0.000 description 7
- 238000004519 manufacturing process Methods 0.000 description 6
- 239000003550 marker Substances 0.000 description 6
- 230000008901 benefit Effects 0.000 description 3
- 230000000306 recurrent effect Effects 0.000 description 3
- 230000035882 stress Effects 0.000 description 3
- 240000008467 Oryza sativa Japonica Group Species 0.000 description 2
- 230000000996 additive effect Effects 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 235000013339 cereals Nutrition 0.000 description 2
- 230000004069 differentiation Effects 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 238000011156 evaluation Methods 0.000 description 2
- 239000000284 extract Substances 0.000 description 2
- 230000002349 favourable effect Effects 0.000 description 2
- 238000001914 filtration Methods 0.000 description 2
- 230000002068 genetic effect Effects 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 230000003204 osmotic effect Effects 0.000 description 2
- 238000012797 qualification Methods 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- 210000000582 semen Anatomy 0.000 description 2
- 238000000926 separation method Methods 0.000 description 2
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 1
- 229920000742 Cotton Polymers 0.000 description 1
- 230000009418 agronomic effect Effects 0.000 description 1
- 238000009412 basement excavation Methods 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 230000007812 deficiency Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 239000013505 freshwater Substances 0.000 description 1
- 239000000017 hydrogel Substances 0.000 description 1
- 230000008676 import Effects 0.000 description 1
- 229920000058 polyacrylate Polymers 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 230000002787 reinforcement Effects 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
- 238000010200 validation analysis Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Botany (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a gene QDTY11.5<IR66897B> for substantially enhancing the drought tolerance of rice in a reproductive stage, and a molecular marking method thereof, and belongs to the fields of rice high-yield and anti-adversity breeding and molecular genetics. QDTY11.5 is identified from Jijing88 and four donor derived breeding selection colonies through a segregation distortion positioning technology, is positioned at the 77.8 cM position of eleventh chromosome, is verified from three random selection colonies through a single-labeling analysis technology, and is closely linked and labeled to an economical molecular marker RM229. The gene is suitable for rice drought-resistant molecule assisted selective breeding and polymerization breeding, effectively covers the shortages of previous natural variation genes, allows drought-resistant individuals to be obtained through genotype selection of low-generation breeding colonies in the seedling stage, so hybridization transfer breeding is timely to carry out, the drought resistance identification process in the adult plant stage is omitted, the breeding efficiency is improved, and the breeding process is accelerated.
Description
Technical field
The present invention relates to one kind dramatically increases Oryza sativa L. Drought-tolerant gene in reproduction period QDTY 11.5IR66897BAnd its molecular marker side
Method, this gene dramatically increases yield under drought stress for the Oryza sativa L., belongs to rice high yield breeding for stress tolerance and molecular genetics field,
Be applied to introducing rice high yield breeding for stress tolerance in Drought-tolerant gene QDTY 11.5 in reproduction periodIR66897B, and closely connect using with it
Lock molecular marker RM229 carries out molecule assisted selection to this gene.
Background technology
Oryza sativa L. is China is also one of important cereal crops in the whole world, and Oryza glutinosa annual production accounts for China's total output of grain
About half.Oryza sativa L. is the crop of water consumption maximum in the world, and China's freshwater resources quite lack, and distribution is again uneven, is complete
13, ball one of poorest country of water resource per capita.Increase severely with China and world population, water resource worsening shortages, tradition
Rice makees production and is faced with increasingly severe arid threat, and the consumption demand to rice grows with each passing day.In order to solve water
Rice water requirement is big and agricultural water this contradiction in short supply, except needing actively to develop " water-saving agriculture ", builds hydraulic engineering, reinforcement
Outer to the utilization of water resource it is often more important that from the point of view of long-range, cultivating most economical effectively drought-resistant new rice variety.
Study on the drought-resistant breeding of the various crop such as Semen Maydiss, Cotton Gossypii and Semen Tritici aestivi currently with Protocols in Molecular Biology
More.But studied also relatively on the low side by the upland rice variety of Molecular design breeding technology selection-breeding resisting drought saving water.Rice Germplasm Resources
It is a huge gene treasure-house, different types of drought tolerant germplasm money is all widely being collected by our times main Rice Production state
Source.In International Rice drought resisting field, the country such as India, Brazil, Thailand, International Rice Research Institute, International Tropical Agricultural Research Institute
Pass through at first to import a collection of High-yield Dry Land Rice kind of dryland rice drought resistance gene selection-breeding and promote on producing with unit.Our drought
Rice breeding is relative later with basic research aspect research starting, but makes much progress.It is reported that, China has had about more than 5000
Part Upland Rice Germplasm material.Therefore excavating the drought-enduring resource of these Oryza sativa L. has extremely to the grain-production of China and national security problem
Great strategic importance.
Molecule genetics research shows, Oryza sativa L. is to the quantitative trait that arid resistance is by controlled by multiple genes.Existing so far
The related QTL of a large amount of drought tolerance is positioned, and some genes related to arid are also by successful clone.Although these resistances are related
The excavation of gene contributes to it is understood that the hereditary basiies to drought resistance for the Oryza sativa L., but most gene is still difficult to really exist
Succeed in breeding practice application.On the one hand it is because that basic scientific research and breeding practice research have space, linking is not
Enough, on the other hand then it is because lacking the larger effect gene that can be applicable to marker assisted selection.In order to overcome this problem, we
Developed a set of by by the drought tolerant germplasm screening and the not drought-enduring japonica rice combo of China's high-quality, to multiple after stress selects
Breeding population carry out conjoint analysis method excavate main effect Drought-tolerant gene.This selection and use colony and conventional genetic colony phase
Ratio has three obvious advantages;(1) individual in population quantity is relatively small, and phenotype and genotype identification can be saved in a large number
Cost and resource;(2) the drought-enduring donor of multiple separate sources, can enrich the drought-enduring hereditary variation of colony, be expected to excavate big effect
Answer Drought-tolerant gene;(3) through artificial selection, most of part strain is similar to recurrent parent in Main Agronomic performance, but
Objective trait and yield have more advantage, therefore can be directly used as the parent of pyramiding breeding, or even can directly select
New lines.
This selection and use colony hybridizes backcrossing by the drought tolerant germplasm of 3 separate sources respectively at lucky round-grained rice 88 and is derived, point
It is not IR66897B (International Rice institute) family (P1), MR77 (Malaysian) family (P2), SN265 (Chinese) family (P3).
Based on the strategy of co-located, we first pass through the method achievement being partially located separately from this selection and use group expansion QTL
Position Research.Result show at the 11st chromosome 77.8cM exist one with the drought-enduring main effect QTL being associated, be named as
QDTY 11.5.And then its verity is confirmed by the One marker analysis result of 3 random selection colonies.This QTL and economy
Practical molecular marker RM229 close linkage labelling, drought-enduring favorable allels are derived from drought-enduring parent IR66897B and MR77, do
24.6% production loss can be retrieved under drought stress.By the existing document of analysis and Relational database it has been found that QDTY
11.5IR66897BResiding interval not yet has Drought-tolerant Gene to be reported, therefore it is concluded that QDTY 11.5IR66897BBe one new
Main effect Drought-tolerant gene.
Content of the invention
In order to overcome the deficiencies in the prior art, it is an object of the invention to provide Oryza sativa L. Drought-tolerant gene in a reproduction period QDTY
2.9 and its molecule labelling method.The present invention utilizes selection and use colony and randomly chooses colony Liang Lei target group, in Oryza sativa L. the
Successfully navigate at 11 chromosome 77.8cM one with the drought-enduring larger effect gene QDTY 11.5 being associatedIR66897B.It is drought-enduring to have
Sharp allele is derived from drought-enduring parent IR66897B and MR77, with molecular marker RM229 close linkage.The practicality warp of PCR-based
Ji phenotypic marker RM229, can carry out drought-enduring molecule assisted selection research in Oryza sativa L. reproduction period effectively using it.
Technical scheme is as follows:Oryza sativa L. Drought-tolerant gene in reproduction period QDTY 11.5IR66897B, in rice genome
The position of 11 chromosome 77.8cM exist one to a drought-enduring related gene locis QDTY 11.5IR66897B, sub- southeast
Allele on this site of two drought tolerant germplasm IR66897B and MR77 can to dramatically increase Oryza sativa L. resistance in reproduction period
Drought.
QDTY 11.5IR66897BMolecule labelling method it is characterised in that:With a pair special PCR primer to RM229, its
Middle forward primer sequence is:CACTCACACGAACGACTGAC, reverse primer sequences are:CGCAGGTTCTTGTGAAATGT, altogether
With the breeding material genomic DNA with kind IR66897B blood relationship for the amplification, if primer RM229 can be amplified by PCR
The 123bp similar with IR66897B about size fragment, then speculate that this breeding material is likely to resistance to containing QDTY 11.5
Non-irrigated allele.
Identify Drought-tolerant gene in the reproduction period (QDTY 11.5 on the 2nd chromosome by the present inventionIR66897B) and can be to it
The molecular method being utilized.The present invention compared with prior art has advantages below and effect:
1. different from the drought-enduring QTL position of current report, enrich the multiformity of natural variation gene.
2., by the screening of compact linkage molecule labelling, it is obtained in that the enhanced breeding material of drought tolerance in reproduction period.
3. the molecular marker of the present invention can be used for the genotype selection of seedling stage breeding population, effectively differentiates to carry this gene
Drought-enduring type individual, be easy to timely hybridize transformation, accelerate breeding process.
Brief description
In order to be illustrated more clearly that the embodiment of the present invention or technical scheme of the prior art, below will be to embodiment or existing
Have technology description in required use accompanying drawing be briefly described it should be apparent that, drawings in the following description be only this
Some embodiments of invention, for those of ordinary skill in the art, on the premise of not paying creative work, acceptable
Other accompanying drawings are obtained according to these accompanying drawings.
Accompanying drawing:The P1 colony parent and random individual plant electrophoretogram in RM229 site.(M、P1And P2Respectively represent marker,
Lucky round-grained rice 88 and IR66897B;1-12 represents 10 individual plants randomly choosing from P1 colony)
Specific embodiment
With reference to embodiment, the present invention is further described.
Embodiment 1
(1) positioning of drought-enduring QTL
1. material to be tested
First to screen 3 local varieties IR66897B (P1 colony male parent) from germplasm resource bank, MR77 (P2 colony father
This), and SN265 (P3 colony male parent) not drought-enduring japonica rice Ji round-grained rice 88 3 high generation Backcross introgression of structure with Chinese high yield and high quality respectively
It is colony.After two-wheeled drought stress in reproduction period selects, the 81 drought-enduring strains filtering out in 3 familys constitute selection and use
Colony's (table 1).
1. 3 selection and use Canopy structure information of table
N1It is the original BC without drought stress2F2Group size;N2It is to select after first round drought stress is processed
Drought-enduring strain number;N3It is the drought-enduring strain number filtering out after 2 wheel drought stresses are processed;.
2. genotype identification
Method with reference to (2000) such as Temnykh extracts genomic DNA respectively to each individual plant.With donor parents and samsara
Polymorphic SSR primer is had to carry out typing to the genotype of offspring derived from different familys respectively between parent's Ji round-grained rice 88.3 familys
Polymorphism primer number is respectively 181,201 and 38.
3. drought-enduring assessment
Drought-enduring qualification test is in Ningxia Academy of Agri-Forestry Sciences's Experimental Base and Chinese Academy of Agricultural Sciences's Changping County, Beijing Experimental Base
Complete.Each test site all includes matched group and two parts for the treatment of group.Matched group all takes normal filling in whole period of duration
Water management, treatment group then then begins to take on Osmotic treatment until seed full maturity in the ear differentiation stage.Comparison and process are all
Completely random district's groups test using 3 repetitions.Using single plant yield as evaluation index.
4. inclined separation analyzes (QTL positioning)
Because 81 strains are made up of different 3 different familys, between different familys, polymorphism mark has differences, therefore I
Be first according to the method for Cui etc. (2015) and developed conforming genetic linkage mapses.And then using (2015) such as Cui
There is provided is located separately the positioning that method carries out drought-enduring QTL partially.When Wald value about or equal to 16.97 of a labelling, I
Think that this labelling QTL drought-enduring with 1 is chain.
Drought-enduring QTL identification in reproduction period.3 familys navigate to 7 drought tolerances QTL altogether.Wherein it is located at the 11st chromosome
QDTY 11.5 on the position of 77.8cM is all navigated to by P1 colony, from International Rice drought tolerant germplasm IR66897B exist
Allele on this site can dramatically increase the drought tolerance in reproduction period for the Oryza sativa L..
The positioning of the drought-enduring QTLQDTY2.9 of table 2
(2) QDTY 11.5IR66897BChecking
1. material to be tested
From original 3 advanced backcross analysis (800 strains of each colony processing without drought stress with artificial selection
System) in randomly choose 60 individual plants respectively and form 3 accidental validation colonies.
2. genotype identification
Extract the genomic DNA of Oryza sativa L. individual plant using conventional CTAB method.With between donor parents and recurrent parent Ji round-grained rice 88
Polymorphic SSR primer is had respectively the genotype of offspring derived from different familys to be identified.Standard PCR using 20 μ l systems
The template DNA of the different individual plant of operating process amplification, carries out the separation of PCR primer with polyacrylate hydrogel electrophoresis.
3. drought-enduring phenotypic assessment
Drought-enduring qualification test is carried out in Chinese Academy of Agricultural Sciences's Changping County, Beijing proving ground and Ningxia academy of agricultural sciences Experimental Base.
The test of each test site all includes matched group and treatment group two parts.The whole period of duration of matched group all takes normal field pipe
Reason, and treatment group starts Osmotic treatment until seed full maturity in the ear differentiation stage.Comparison and process are all using 3 repetitions
Completely random district's groups test.Using single plant yield as evaluation index.
3. One marker analysis
Genotype according to represented by the RM229 labelling amplified band of different strains, 60 strains of each family are divided
Become two groups, one group is individuality with lucky round-grained rice 88 homozygous genotype;Another group is individuality with donor homozy genotype.Dan Biao
Note analysis result shows, QDTY 11.5 is positioned in P1 and P2 colony again, the average individual plant in two places under drought stress
Units increased in production reaches 24.6%, is the drought resisting QTL of a main effect, and resistance favorable allels are all from donor parents.This shows
QDTY 11.5IR66897BIt is the Drought-tolerant gene of a necessary being, and RM229 is really and QDTY 11.5 close linkage, can be direct
It is applied to drought resisting molecule assisted selection.
Table 3.QDTY 11.5IR66897BAnd its checking of linked marker RM229
HDY, the average single plant yield of homozygosis donor gene type plant;HRY, the average individual plant of homozygosis recipient genotypes plant
Yield;RPY, the average single plant yield of recurrent parent Ji round-grained rice 88;A, additive effect.
It is obvious to a person skilled in the art that the invention is not restricted to the details of above-mentioned one exemplary embodiment, Er Qie
In the case of the spirit or essential attributes of the present invention, the present invention can be realized in other specific forms.Therefore, no matter
From the point of view of which point, embodiment all should be regarded as exemplary, and be nonrestrictive.The scope of the present invention is by appended power
Profit requires rather than described above limits, it is intended that all in the implication and scope of the equivalency of claim by falling
Change is included in the present invention.Any reference in claim should not be considered as limiting involved claim.
Moreover, it will be appreciated that although this specification is been described by according to embodiment, not each embodiment only wraps
Containing an independent technical scheme, only for clarity, those skilled in the art should for this narrating mode of description
Using description as an entirety, the technical scheme in each embodiment can also form those skilled in the art through appropriately combined
Understandable other embodiment.
Claims (3)
1. one kind dramatically increases Oryza sativa L. drought tolerance in reproduction period gene QDTY11.5IR66897BIt is characterised in that:In rice genome
The position of 11 end of chromosome 77.8cM exist one to a drought-enduring related gene locis QDTY 11.5, International Rice institute
Allele on this site for drought tolerant germplasm IR66897B of selection-breeding can dramatically increase the drought tolerance in reproduction period for the Oryza sativa L..
2. Drought-tolerant gene QDTY 11.5 as claimed in claim 1IR66897BMolecule labelling method it is characterised in that:With a pair
Special PCR primer to RM229, wherein forward primer sequence is:CACTCACACGAACGACTGAC, reverse primer sequences are:
CGCAGGTTCTTGTGAAATGT, coamplification carries the breeding material genomic DNA of kind IR66897B blood relationship, if primer
RM229 can by PCR amplify the 123bp similar with IR66897B about size fragment, then speculate this breeding material
It is likely to the drought-enduring allele containing QDTY 11.5.
3. application in rice breeding for the Drought-tolerant gene according to claim 1,2.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610485842.XA CN106434687A (en) | 2016-06-27 | 2016-06-27 | Gene QDTY11.5<IR66897B> for substantially enhancing drought tolerance of rice in reproductive stage, and molecular marking method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610485842.XA CN106434687A (en) | 2016-06-27 | 2016-06-27 | Gene QDTY11.5<IR66897B> for substantially enhancing drought tolerance of rice in reproductive stage, and molecular marking method thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN106434687A true CN106434687A (en) | 2017-02-22 |
Family
ID=58183819
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610485842.XA Withdrawn CN106434687A (en) | 2016-06-27 | 2016-06-27 | Gene QDTY11.5<IR66897B> for substantially enhancing drought tolerance of rice in reproductive stage, and molecular marking method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106434687A (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1952144A (en) * | 2005-10-18 | 2007-04-25 | 华中农业大学 | Promoting growth of root and/or improving drought resistance of plant by using paddy gene OsRRG1 |
CN1952142A (en) * | 2005-10-17 | 2007-04-25 | 华中农业大学 | Improvement of plant drought resistance by using paddy pathogenesis-related gene OsPR4-1 |
-
2016
- 2016-06-27 CN CN201610485842.XA patent/CN106434687A/en not_active Withdrawn
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1952142A (en) * | 2005-10-17 | 2007-04-25 | 华中农业大学 | Improvement of plant drought resistance by using paddy pathogenesis-related gene OsPR4-1 |
CN1952144A (en) * | 2005-10-18 | 2007-04-25 | 华中农业大学 | Promoting growth of root and/or improving drought resistance of plant by using paddy gene OsRRG1 |
Non-Patent Citations (1)
Title |
---|
崔彦茹 等: "利用水稻选择育种群体定位抗旱QTL", 《中国作物学会-2015年学术年会论文摘要集》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN106566888A (en) | Method for selecting and breeding variety with diversified resistance by molecular marker-assisted selection | |
CN105830912A (en) | Breeding method for rice with high yield and durable neck blast resistance | |
CN110305980B (en) | Breeding method and application of anti-clubroot high-oleic-acid rape | |
CN101491212B (en) | Marker-assisted selection quick cultivation method of rice strain containing amylase of middle content | |
CN100494403C (en) | Method of assisting screening for cold resistant paddy rice and its special primer | |
CN102121052B (en) | Specific molecular marker sequence for identifying recessive genic male sterility mutant gene ms 26 and its wild type allele | |
CN104109713B (en) | With the multilocus assisted selection method that wheat conventional breeding whole process is combined | |
CN102599047A (en) | Method by adopting molecular marker-assisted backcross to improve gibberellic disease expansion resistance of wheat | |
CN109006456B (en) | Breeding method of pimento nuclear male sterile dual-purpose line | |
CN108531644B (en) | Molecular marker closely linked with upland cotton AS98 dwarfing character and application thereof | |
CN101773067A (en) | Method for recurrently and selectively breeding non-glutinous rice by using recessive cytoblast sterile material | |
CN104762298B (en) | A kind of rice seedling resistant gene of salt qST11 and its molecule labelling method | |
CN104762299B (en) | A kind of rice seedling resistant gene of salt qST2 and its molecule labelling method | |
CN106434687A (en) | Gene QDTY11.5<IR66897B> for substantially enhancing drought tolerance of rice in reproductive stage, and molecular marking method thereof | |
CN105624277B (en) | Method for obtaining molecular marker closely linked with tobacco plant height development character | |
CN108570515B (en) | Cold-resistant gene qCT6.7 for rice at booting stageDODMolecular marker and application thereof | |
CN108085404A (en) | Giant pumpkin female trait molecular marker and the primer pair of identification giant pumpkin female character by force by force | |
CN106047891A (en) | Gene QDTY 2.9IR66897B capable of obviously increasing rice reproductive-stage drought tolerance and molecular marker method thereof | |
CN102613069B (en) | Breeding method for improving stripe virus disease resistance of BT type japonica rice restorer | |
CN102626048B (en) | Method of molecular marker assisted backcross to improve scab invasion resistance of wheat | |
CN100513580C (en) | Method of auxiliary screening cold resistant paddy rice and its special primer | |
CN107926699A (en) | A kind of method using corn full genome omics technology fast accurate selecting and breeding corn self-mating system | |
CN100355906C (en) | Method of auxiliary screening cold resistant paddy rice and its special primer | |
Akahori et al. | Development of a new codominant CAPS marker for sex genotype identification in asparagus | |
CN100449004C (en) | Method for quick cultivating 'three line' hybrid rice sterility line using molecule mark |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WW01 | Invention patent application withdrawn after publication |
Application publication date: 20170222 |
|
WW01 | Invention patent application withdrawn after publication |