CN106399584B - A kind of mandarin fish infectious spleen and kidney necrosis virus inactivation quick testing reagent kit and detection method - Google Patents
A kind of mandarin fish infectious spleen and kidney necrosis virus inactivation quick testing reagent kit and detection method Download PDFInfo
- Publication number
- CN106399584B CN106399584B CN201610710027.9A CN201610710027A CN106399584B CN 106399584 B CN106399584 B CN 106399584B CN 201610710027 A CN201610710027 A CN 201610710027A CN 106399584 B CN106399584 B CN 106399584B
- Authority
- CN
- China
- Prior art keywords
- inactivation
- isknv
- necrosis virus
- cell
- mandarin fish
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention discloses a kind of mandarin fish infectious spleen and kidney necrosis virus inactivation quick detection kit and detection methods.The detection kit and detection method are to monitor whether ISKNV inactivates by the detection to viral mRNA, comprising the concrete steps that will be 7 days after inactivated vaccine semifinished or finished goods inoculation CPB cell, extract cell total rna, remove DNA residual, carry out reverse transcription, then quantitative fluorescent PCR reaction is carried out with for mandarin fish infectious spleen and kidney necrosis virus ORF099 gene conserved region sequence design special primer and probe, determines whether virus inactivates completely according to reaction result.The present invention can inactivate mandarin fish infectious spleen and kidney necrosis virus and be used for quickly detecting, and can simplify ISKNV cell inactivation vaccine inactivation checked operation program, shorten round of visits, save the cost, improve inactivation and examine sensitivity, improve production of vaccine efficiency.
Description
Technical field
The present invention relates to a kind of infectious spleen and kidney necrosis virus inactivation quick detection kit and detection methods, and in particular to
A kind of quick detection fluorescence quantitative RT-PCR detecting kit of ISKNV inactivation and detection method based on viral mRNA monitoring.
Background technique
Mandarin fish (Siniperca chuatsi) is the important species of China's high-quality fresh-water fishes consumption and foreign exchange earning, because of its taste
Road is delicious, and protein content is high and is liked deeply by the majority of consumers.However serious disease problem has become limitation mandarin fish and supports
Grow the main bottleneck of industry development.Mandarin fish infectious spleen and kidney necrosis virus disease (Infectious spleen and kidney
Necrosis virus, ISKNV), have the characteristics that disease incidence is high, pathogenicity rate is high, causes economic loss big, Control Technology is ground
Studying carefully becomes one of fish disease researcher important topic.Vaccine inoculation is the prevention most economical effective means of Virus disease of fish, cell inactivation
Vaccine becomes most one of commercialized vaccine of industrial prospect because having due to preparation is easy, immune effect is stable, the R&D cycle is short.
Inactivation of virus inspection is a ring important in ISKNV cell inactivation vaccine preparation, but traditional inactivation of virus detection method is to pass through
In 3 generation of cell blind passage, passes through whether inoculation fish body verifying virus inactivates completely simultaneously, and whole process about needs 30 days time, this is greatly
The production of vaccine period is extended greatly, reduces the production capacity of vaccine, therefore is badly in need of establishing a kind of quick inspection party of ISKNV inactivation
Method.Virus viral related gene processive transcription in proliferation process, therefore viral mRNA can be monitored and examine disease
Whether poison inactivates.For RNA virus, it is fast that Yu Fen etc. uses chain specificity RT-PCR to establish a kind of poliovirus inactivation
Fast verification method；Kim etc. is with cucumber green statin mosaic virus (Cucumber green mottle mosaic virus, CGMMV)
Genome temperature-sensitive sensillary area is the heat inactivation RT-PCR rapid detection method that target establishes the disease；For DNA virus, Yuasa etc.
Koi herpesvirus (koi herpesvirus, KHV) mRNA is monitored by RT-PCR to detect the virus in duplication.And it is directed to
Mandarin fish infectious spleen and kidney necrosis virus (ISKNV) inactivates rapid detection method, and there is not been reported.The present invention is thin from ISKNV infection CPB
Selecting expression quantity highest early genes after born of the same parents system in express spectra result is target gene, using gene mRNA monitoring as disease
Whether poison inactivates complete index, establishes ISKNV inactivation quickly detection fluorescent quantitative RT-PCR method, it is intended to shorten ISKNV cell
Round of visits is inactivated in inactivated vaccine production process, improves production of vaccine efficiency.
Summary of the invention
It is an object of the invention to establish a kind of infectious spleen and kidney necrosis virus inactivation quick detection kit and detection side
Method.
The technical solution used in the present invention is: from 5 tables are selected in express spectra result after ISKNV infection CPB cell line
Up to amount highest early genes, ORF099 gene expression amount highest is confirmed through qRT-PCR, it is quick to be selected as inactivation of virus
The target gene of detection.Specific reverse transcription primer, fluorescence quantification PCR primer and probe are designed, test sample is treated using qRT-PCR
The cell total rna of 7d is detected after product inoculation CPB cell, is shown if detecting ISKNV mRNA in the presence of ISKNV living, instead
Then without.
A kind of mandarin fish infectious spleen and kidney necrosis virus fluorescence quantitative RT-PCR detecting kit, including following component: it is directed to mandarin fish
Infectious spleen and kidney necrosis virus (ISKNV) specific primer and probe, reverse transcriptase, Taq enzyme, inverse transcription reaction liquid, fluorescence are fixed
Quantitative response liquid.
Preferably, the specific primer and probe for mandarin fish infectious spleen and kidney necrosis virus (ISKNV) is basis
The design of mandarin fish infectious spleen and kidney necrosis virus ORF099 gene conserved region sequence.
Preferably, described for the specific primer of mandarin fish infectious spleen and kidney necrosis virus (ISKNV) and the sequence of probe
It is as follows:
ORF099-F:5'-ACTTGGCTTCCACACAATCC-3'(SEQ ID NO:1)；
ORF099-R:5'-ATGCTGTGCTGTCATCTTGC-3'(SEQ ID NO:2)；
ORF099-P:5 ' FAM+ATTGGCATCCAAGCCAATATACATGGC+TAMARA 3 ' (SEQ ID NO:3) is visited
Needle sequence both ends are luminophore and quencher.
Preferably, positive criteria product is also contained in the kit, the positive criteria product is mandarin fish infectious spleen renal necrosis
Virus.
A kind of mandarin fish infectious spleen and kidney necrosis virus inactivation rapid detection method, which comprises the steps of:
1) CPB cell is inoculated with after diluting ISKNV cell inactivation vaccine finished product to be measured or semi-finished product by a certain percentage, together
When using positive criteria product inoculating cell as control；
2) 7d after inoculating cell extracts cell total rna, and removes wherein residual DNA；
3) total serum IgE is after reverse transcription primer in kit and enzyme carry out reverse transcription after handling, with the primer in kit, spy
Needle, Taq enzyme, reaction solution carry out quantitative fluorescent PCR, while using and the reaction system of template is not added as blank control；
4) when peak occurs in positive sample, and blank control does not play peak, it is the positive that sample to be tested, which plays peak, and it is endless to represent inactivation
Entirely；Sample to be tested does not play peak as feminine gender, and it is complete to represent inactivation.
Preferably, the primer of the kit used in the detection method are as follows:
ORF099-F:5'-ACTTGGCTTCCACACAATCC-3'(SEQ ID NO:1)；
ORF099-R:5’-ATGCTGTGCTGTCATCTTGC-3’(SEQ ID NO:2)。
Preferably, the probe of the kit used in the detection method are as follows:
ORF099-P:5 ' FAM+ATTGGCATCCAAGCCAATATACATGGC+TAMARA 3 ' (SEQ ID NO:3) is visited
The both ends link luminophore and quencher of needle.
The beneficial effects of the present invention are: this method sensitivity is more than cell blind passage method and fish body safety test method.3 batches
ISKNV cell inactivation vaccine sample verification result show this method stability and cell blind passage method, fish body innocuity test method one
It causes, shows that the inactivation of virus rapid detection method for the qRT-PCR monitoring based on viral mRNA that this research is established can substitute biography
The cell blind passage method and fish body safety method of system realize the quick detection of ISKNV inactivation.And round of visits length is inactivated to vaccine
Production cycle plays a decisive role, and ISKNV inactivation is established in this research can determine whether virus inactivates for method for quickly detecting 7 days,
And traditional cell blind passage method and fish body safety test period at least needs 24 days and 21 days, therefore, this method is substantially shorter
The ISKNV inactivated vaccine production cycle, improve the production efficiency of vaccine.
Detailed description of the invention
Fig. 1, ISKNV infect gDNA removal verifying in CPB cell total rna；(a): indicating dilution poison disease vaccination CPB cell
7 days (U-A, R-A) and 11 days (U-B, the R-B) RNA samples extracted afterwards, U-A U-B indicate not removing the RNA of gDNA, R-A R-B
RNA after indicating removal gDNA；(b) it is inoculated with after indicating 0.05%, 0.1% and 0.2% final concentration formalin-inactivated ISKNV 72h
The CPB cell 9 days RNA samples obtained, U-C indicate that the RNA for not removing gDNA, R-C indicate the RNA after removal gDNA；
Fig. 2, fluorescence quantitative RT-RCR detect ISKNV and infect CPB cell restrovirus genetic transcription quantity.
Specific embodiment
Below with reference to embodiment, the present invention is further illustrated, and however, it is not limited to this.
Embodiment
1. the screening of target gene
According to the existing ISKNV infection CPB cell transcription spectrum in this laboratory as a result, choosing highest 5 virus of expression quantity
ORF, using 5.0 software design specific primer of Primer and probe (being shown in Table 1).By ISKNV gradient dilution at 1,10,100,
1000 copies/mL is inoculated with T25 Tissue Culture Flask respectively, extracts total serum IgE reverse transcription after inoculation 7 days and prepares cDNA template.Using
Premix Ex TaqTM(Probe qPCR) kit detects the expression quantity of these genes.Reaction system: 10 μ of Mix is sequentially added
L, 0.4 μ L of ROX, each 0.4 μ L of 10 μm of ol/L primer I SKNV FP/ISKNV RP, 10 μm of ol/L probe I SKNV probe0.4 μ
L, 2 μ L templates, moisturizing to 20 μ L.Negative control group replaces sample to be tested with deionized water.Reaction condition are as follows: 95 DEG C of 30s, 1
Circulation；95 DEG C of 5s, 60 DEG C of 34s, 40 circulations, acquire fluorescence signal when 60 DEG C.An inspection is filtered out in conjunction with transcript profile result
With higher sensitivity gene is surveyed as inactivation and examines target gene.As shown in table 2, ISKNV infects the transcription spectrum of CPB cell for 24 hours
The results show that 5 viral genes are followed successively by ORF023, ORF099, ORF100, ORF032, ORF008, fluorescence before relative expression quantity
Quantitative RT-PCR testing result shows, in inoculation 1,10,100,1000 copies/mL ISKNV cell culture fluid, ORF099 turns
The Ct value for recording this amplification is lower, wherein 1,1000 copies/mL inoculum density Ct value is minimum in 5 early genes,
Show that ISKNV ORF099 gene transcription level is higher, using its as inactivation examine target gene sensitivity with higher because
This selects ORF099 gene quickly to examine target gene as inactivation.
1 ISKNV of table infects 5 early genes transcription spectrums and fluorescence quantitative RT-RCR verification result after CPB cell
The design of 2 specific primers and probe
According to mandarin fish infectious spleen and kidney necrosis virus ORF099 protein nucleic acid sequence, gene conservative fragments designed for inspection
The primer and probe of mandarin fish infectious spleen and kidney necrosis virus is surveyed, sequence is as follows:
ORF099-F:5'-ACTTGGCTTCCACACAATCC-3'(SEQ ID NO:1)；
ORF099-R:5'-ATGCTGTGCTGTCATCTTGC-3'(SEQ ID NO:2)；
ORF099-P:5'-ATTGGCATCCAAGCCAATATACATGGC-3'(SEQ ID NO:3)；
Fluorescence probe reporter group is FAM, quenching group TAMARA.
3. virus mRNA extraction is synthesized with cDNA
CPB cell is infected with ISKNV, extracts cell RNA with TRIzol Reagent after there is obvious lesion, extracts step
It is rapid: every 1 × 105Cell quantity is added 1mlTRIzol and cracks 5min, and piping and druming mixes；200 μ L chloroforms are added, acutely shake 15s,
It is placed at room temperature for 10min, 4 DEG C of centrifuge 12000rpm are centrifuged 15min；It takes supernatant that isometric isopropanol is added, is placed at room temperature for
10min, 4 DEG C of centrifuge 12000rpm are centrifuged 10min；Supernatant is abandoned, 75% ethyl alcohol of 1ml, vortex mixed, 4 DEG C of centrifuges are added
7500rpm is centrifuged 5min；Supernatant is abandoned, several minutes of natural drying at room temperature, appropriate DEPC water dissolution is added, carries out reverse transcription immediately.
Reverse transcription uses TaKaRa PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real
Time) kit, the first step remove genomic DNA reaction system: sequentially add 5 × gDNA Eraser Buffer, 2 μ L,
gDNA Eraser1μL、Total RNA 2μL、RNase Free dH2O5 μ L, 42 DEG C of 2min of reaction condition, 4 DEG C of preservations；Second
Step reverse transcription use 20ul system: sequentially add first step reaction solution 10ul, 1 μ L of PrimeScript RT Enzyme MixI,
RT Primer Mix 4μL、5×PrimeScript Buffer 2(for Real Time)4μL、Rnase Free H2O 1μ
L, 37 DEG C of 15min of reaction condition, 85 DEG C of inactivation 5s, 4 DEG C of preservations.
4. being established based on virus mRNA fluorescent quantitative PCR detection method
Removal efficiency verifying takes 1 respectively, 10,100, after 1000 copies/mL ISKNV inoculating cell the 7th day, 11 days and
The 9th day cell total rna carries out the removal of gDNA after inactivation ISKNV virus inoculation cell, respectively to remove preceding total serum IgE and removal
Total serum IgE is that template carries out qPCR afterwards, and ISKNV ORF099 gene can be detected in the sample for not carrying out gDNA removal as the result is shown, is gone
It can't detect ORF099 gene (Fig. 1) after removing, show to remain in total serum IgE without DNA after the removal of gDNA.
The sensitivity test of fluorescence quantitative PCR detection virus mRNA is respectively by 1,10,100,1000 copies/mL ISKNV
7 days after inoculating cell, 9 days, 11 days, extract cell total rna carry out fluorescence quantitative RT-RCR detection.As shown in Fig. 2, with virus
The increase of inoculum concentration and the extension of inoculation time, the ISKNV mRNA detected is more, wherein after 1 copy/mL virus inoculation 7 days
It can detect 1~2 copy/μ L ISKNV mRNA, therefore by 7 days after inactivation of viruses liquid inoculation CPB cell using glimmering
Light quantitative RT-PCR, which detects virus mRNA, can be detected the residual of 1 live virus, show that this method has high sensitivity.
5. application of this method in detection ISKNV inactivation is examined
The CPB cell that fluorescence quantitative RT-RCR detection is uninfected by ISKNV carries out fluorescence quantitative RT-RCR and has had no peak, shows
Virus-free gene mRNA in sample indicates ISKNV complete inactivation.By 0.05%, 0.1% and 0.2% final concentration formalin-inactivated
It is inoculated with CPB cell 9 days after ISKNV 72h, qRT-PCR testing result shows the raising with concentration of formaldehyde, the ISKNV detected
MRNA is gradually decreased.According to the inactivation of virus method for quickly detecting that this research is established, 0.2% formalin-inactivated ISKNV 72h is followed by
Kind of CPB cell detection less than viral gene mRNA, illustrate ISKNV with this condition by complete inactivation, and cell blind passage experiment knot
Fruit shows do not occur CPE (table 2) from 0.1% final concentration formalin-inactivated disease 72h inoculating cell blind passage three generations, illustrates that this research is established
Inactivation of virus method for quickly detecting than cell blind passage method have higher sensitivity.3 batches using method prepared by laboratory
Secondary ISKNV cell inactivation vaccine sample is detected, and 3 batches of samples are feminine gender as the result is shown, with cell blind passage and fish body safety
Test result is consistent (table 2), wherein+indicate positive, there is lesion or plays peak；It indicates that detection result is feminine gender, i.e., does not detect
Live virus.The above result shows that the inactivation of virus method for quickly detecting method based on ISKNVmRNA detection that this research is established is
Reliably.
2 fluorescence quantitative RT-RCR of table detects virus mRNA method and fish body innocuity test method to 3 batch ISKNV cell inactivations
The comparison of vaccine inactivation inspection result
<110>China's Pearl River Fishery Research Institute of Aquatic Science Research Institute
<120>a kind of mandarin fish infectious spleen and kidney necrosis virus inactivation quick testing reagent kit and detection method
<130>
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> ISKNV
<400> 1
acttggcttc cacacaatcc 20
<210> 2
<211> 20
<212> DNA
<213> ISKNV
<400> 2
atgctgtgct gtcatcttgc 20
<210> 3
<211> 27
<212> DNA
<213> ISKNV
<400> 3
attggcatcc aagccaatat acatggc 27
Claims (3)
1. a kind of infectious spleen and kidney necrosis virus inactivates quick detection kit, including following component: being directed to mandarin fish infectious spleen and kidney
Specific primer and probe, reverse transcriptase, Taq enzyme, inverse transcription reaction liquid, the fluorescent quantitation reaction solution of necrosis virus (ISKNV)；
It is characterized in that, the specific primer and probe for mandarin fish infectious spleen and kidney necrosis virus (ISKNV) is according to mandarin fish
The design of infectious spleen and kidney necrosis virus ORF099 gene mRNA conserved region sequence, the sequence of the specific primer and probe is such as
Shown in lower:
Reverse transcription primer:
ORF099-F:5'-ACTTGGCTTCCACACAATCC-3'；
ORF099-R:5'-ATGCTGTGCTGTCATCTTGC-3'；
Probe ORF099-P:5 ' FAM+ATTGGCATCCAAGCCAATATACATGGC+TAMARA 3 ', the both ends chain sending and receiving of probe
Light group and quencher.
2. detection kit according to claim 1, which is characterized in that also contain positive criteria product in the kit,
The positive criteria product is to contain mandarin fish infectious spleen and kidney necrosis virus.
3. the method for quickly detecting the inactivation of mandarin fish infectious spleen and kidney necrosis virus using detection kit described in as claimed in claim 1 or 22,
It is characterized by comprising the following steps:
1) it is inoculated with CPB cell after diluting ISKNV cell inactivation vaccine finished product to be measured or semi-finished product by a certain percentage, simultaneously will
Positive criteria product inoculating cell is as control；
2) 7d after inoculating cell extracts cell total rna, and removes wherein residual DNA；
3) total serum IgE is after reverse transcription primer in kit and reverse transcriptase carry out reverse transcription after handling, in kit primer,
Probe, Taq enzyme, fluorescent quantitation reaction solution carry out quantitative fluorescent PCR, while using and the reaction system of template is not added as blank pair
According to；
4) when peak occurs in positive sample, and blank control does not play peak, it is the positive that sample to be tested, which plays peak, and it is incomplete to represent inactivation；To
Sample does not play peak as feminine gender, and it is complete to represent inactivation；
The primer of the kit used in the detection method are as follows:
ORF099-F:5'-ACTTGGCTTCCACACAATCC-3'；
ORF099-R:5'-ATGCTGTGCTGTCATCTTGC-3'；
The probe of the kit used in the detection method are as follows:
ORF099-P:5 ' FAM+ATTGGCATCCAAGCCAATATACATGGC+TAMARA 3 ',
The both ends link luminophore and quencher of probe；
Above-mentioned application is not used in the diagnosis of disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610710027.9A CN106399584B (en) | 2016-08-23 | 2016-08-23 | A kind of mandarin fish infectious spleen and kidney necrosis virus inactivation quick testing reagent kit and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610710027.9A CN106399584B (en) | 2016-08-23 | 2016-08-23 | A kind of mandarin fish infectious spleen and kidney necrosis virus inactivation quick testing reagent kit and detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106399584A CN106399584A (en) | 2017-02-15 |
| CN106399584B true CN106399584B (en) | 2019-11-19 |
Family
ID=58004639
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610710027.9A Active CN106399584B (en) | 2016-08-23 | 2016-08-23 | A kind of mandarin fish infectious spleen and kidney necrosis virus inactivation quick testing reagent kit and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106399584B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107974434B (en) * | 2017-06-23 | 2021-06-11 | 中国水产科学研究院珠江水产研究所 | Method and kit for measuring content of effective antigen of infectious spleen and kidney necrosis virus inactivated vaccine |
| CN111485035A (en) * | 2019-01-29 | 2020-08-04 | 广东美格基因科技有限公司 | Fluorescent quantitative PCR method for detecting infectious spleen and kidney necrosis viruses of mandarin fish and corresponding kit |
| CN109762940A (en) * | 2019-02-02 | 2019-05-17 | 中国水产科学研究院珠江水产研究所 | For detecting the primer sets and kit of infectious spleen and kidney necrosis virus Yu mandarin fish rhabdovirus |
| CN111733283B (en) * | 2020-04-28 | 2021-07-06 | 广东海大畜牧兽医研究院有限公司 | Triple fluorescence PCR detection kit for infectious spleen and kidney necrosis virus, largemouth black bass virus and mandarin fish rhabdovirus |
| CN113755438B (en) * | 2021-10-11 | 2023-08-08 | 浙江省淡水水产研究所 | Mandarin fish spinal cord tissue cell line and construction method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925592A (en) * | 2012-11-28 | 2013-02-13 | 湖北省农业科学院畜牧兽医研究所 | Fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) rapid diagnostic kit for specific detection of duck flavivirus infection and application method thereof |
| CN103397107A (en) * | 2013-07-26 | 2013-11-20 | 中国兽医药品监察所 | Bovine viral diarrhea virus (BVDV) fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit |
| CN103966358A (en) * | 2014-04-23 | 2014-08-06 | 中国水产科学研究院珠江水产研究所 | Fluorescent quantitative PCR detection kit for infectious spleen and kidney necrosis virus and Fluorescent quantitative PCR detection method of infectious spleen and kidney necrosis virus |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100701672B1 (en) * | 2004-12-10 | 2007-04-03 | 대한민국 | Genes of a korean isolate rbiv and a vaccine against rbiv |
-
2016
- 2016-08-23 CN CN201610710027.9A patent/CN106399584B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925592A (en) * | 2012-11-28 | 2013-02-13 | 湖北省农业科学院畜牧兽医研究所 | Fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) rapid diagnostic kit for specific detection of duck flavivirus infection and application method thereof |
| CN103397107A (en) * | 2013-07-26 | 2013-11-20 | 中国兽医药品监察所 | Bovine viral diarrhea virus (BVDV) fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit |
| CN103966358A (en) * | 2014-04-23 | 2014-08-06 | 中国水产科学研究院珠江水产研究所 | Fluorescent quantitative PCR detection kit for infectious spleen and kidney necrosis virus and Fluorescent quantitative PCR detection method of infectious spleen and kidney necrosis virus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106399584A (en) | 2017-02-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106399584B (en) | A kind of mandarin fish infectious spleen and kidney necrosis virus inactivation quick testing reagent kit and detection method | |
| CN106636471B (en) | Multiplex PCR detection kit for simultaneously detecting WSSV, AHPND, EHP and IHHNV of prawns | |
| Kuo et al. | Real-time quantitative PCR assay for monitoring of nervous necrosis virus infection in grouper aquaculture | |
| CN103966358B (en) | A kind of mandarin fish infectious spleen and kidney necrosis virus fluorescent quantificationally PCR detecting kit and detection method | |
| CN103397107B (en) | Bovine viral diarrhea virus (BVDV) fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit | |
| CN107385111A (en) | The real-time fluorescence quantitative PCR detection primer and its kit of a kind of goose astrovirus | |
| CN103045755A (en) | Fluorescent quantitative PCR (polymerase chain reaction) method, primer and kit for detecting EBOV (Ebola virus) | |
| CN105463136B (en) | Kit for the detection of avian infectious bronchitis virus RT-PCR partings | |
| CN105112564A (en) | Method and kit for detecting high-risk HPV (human papillomavirus) E6/E7 mRNA (messenger ribonucleic acid) by ligase | |
| CN104099428B (en) | A kind of triple real-time fluorescence PCR primers, probe and test kit differentiating Ranavirus virus | |
| CN107828914A (en) | Infectious subcutaneous and haematopoietic necrosis virus（IHHNV）RAA constant temperature fluorescence detection method and reagent | |
| CN103866050A (en) | Fluorescent quantitative PCR (polymerase chain reaction) detection method and primer for porcine epidemic diarrhea viruses | |
| CN107338328B (en) | Method for quantitatively detecting GII norovirus in fruits and vegetables by one-step droplet digital PCR (polymerase chain reaction) | |
| CN112695137A (en) | PMA-qPCR detection method of porcine pseudorabies virus | |
| CN103045754A (en) | One-step process real-time fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) method and kit for detecting Z/S subtype ebola viruses | |
| CN105463132A (en) | Genetic marker of canine parvovirus and specific primers as well as probe thereof | |
| CN110373496A (en) | Kit and detection method for the detection of 8 type aviadenovirus of I subgroup serum | |
| CN112301168B (en) | TaqMan real-time fluorescent quantitative RT-PCR kit and method for detecting largemouth black bass double RNA virus | |
| CN106566895B (en) | PCR primer for simultaneously detecting type I, type II and type III of cyprinid herpes virus, kit and application | |
| CN108060265A (en) | For detecting the primer sets of the oyster herpetovirus of infection blood clam and probe and its application | |
| CN109628640B (en) | RPA-LFD primer, method and kit for rapidly detecting spring viremia of carp virus | |
| CN106755598A (en) | Fluorescence LAMP primer and its detection method for detecting shrimp cream head disease virus | |
| CN104946796A (en) | Kit and detection method for detecting tomato spotted wilf virus by RT-LAMP method | |
| Kalokhoran et al. | Co-circulation of three clusters of 793/B-like avian infectious bronchitis virus genotypes in Iranian chicken flocks | |
| CN107604101A (en) | One breeding pigeon New-type adenovirus real-time fluorescence quantitative PCR detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |