CN106399508A - Rhizoctonia solani kuha SSR mark, as well as preparation method and application thereof - Google Patents
Rhizoctonia solani kuha SSR mark, as well as preparation method and application thereof Download PDFInfo
- Publication number
- CN106399508A CN106399508A CN201610841026.8A CN201610841026A CN106399508A CN 106399508 A CN106399508 A CN 106399508A CN 201610841026 A CN201610841026 A CN 201610841026A CN 106399508 A CN106399508 A CN 106399508A
- Authority
- CN
- China
- Prior art keywords
- primer
- seq
- nucleotide sequence
- dna
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a rhizoctonia solani kuha SSR mark, as well as a preparation method and application thereof, and belongs to the technical field of molecular organism. The rhizoctonia solani kuha SSR mark comprises 8 groups of primer pairs, and the preparation method comprises the following steps: firstly, extracting genome DNA of rhizoctonia solani kuha; secondly, obtaining a DNA fragment through restriction enzyme digestion total NDA; thirdly, ensuring that a biotin labeled probe is cross-fertilized with a target fragment; fourthly, enriching a DNA fragment containing an SSR sequence through a magnetic bead; fifthly, amplifying and purifying the DNA fragment containing the SSR sequence; sixthly, performing clone sequencing on the DNA fragment; seventhly, designing an SSR primer through an SSR flanking sequence, which is used for amplifying a microsatellite fragment of a locus. The rhizoctonia solani kuha SSR mark is high in primer specificity, stable in amplification, simple in operation, short in period and low in cost, meanwhile has the advantages of rich codominant inheritance and polymorphism, and can be applied to analysis of the genetic diversity of rhizoctonia solani kuha.
Description
Technical field
The invention belongs to field of molecular biotechnology is and in particular to a kind of Rhizoctonia solani Kahn SSR marker and its preparation side
Method, application.
Background technology
Microsatellite DNA, also known as simple repeated sequence (simple sequence repeat, SSR), is a kind of by 2-6
Nucleotide is uniformly distributed in the repetitive sequence in genome for unit, widely distributed in vivo in various biologies.Microsatellite has many
State property height, codominant inheritance, the advantages of quantity is enriched, high-resolution, genome coverage distance are wide and is easy to detection so that SSR
Labelling becomes one of widely used molecular marker.Separate microsatellite locus method have multiple, such as data base querying method, near
Edge species selection method, genomic library screening method, enriched library method and EST-SSR method etc..Because magnesphere has height
The effect of effect enrichment microsatellite DNA, and do not need more species gene group information, it is widely deployed in microsatellite locus
Screening.
Semen Maydiss are to be distributed one of widest cereal crops in the world, and cultivated area is only second to Semen Tritici aestivi and Oryza sativa L., be grain,
The multipurpose crop of feedstuff, the raw material of industry and exporting.The maize sown area of China and total output are only second to the U.S., occupy generation
Boundary's second.However, maize sheath blight is a kind of soil-borne disease that Semen Maydiss producing region extensively occurs, have a strong impact on the product of Semen Maydiss
Amount, causes huge economic loss, its pathogen is Rhizoctonia solani Kuhn（Rhizoctonia solaniKühn）, this bacterium host
Scope is quite varied, can infect 263 kinds of plants of 43 section such as Oryza sativa L., corn and soybean, Semen Tritici aestivi, causes that stricture of vagina is withered, the vertical disease such as withered.But
It is less for the genetics research of Rhizoctonia solani Kahn, the research of particularly DNA molecular level is extremely limited.In Semen Maydiss stricture of vagina
The Research foundation of rot bacterium genetic diversity is weaker always, and in public database, getable sequence information relatively has
Limit.Therefore, the application setting up efficient, comprehensive, stable SSR technology has very to the announcement of Rhizoctonia solani Kahn genetic diversity
Good supplementary meaning.
In order to study the genetic diversity of Rhizoctonia solani Kahn, applicant utilizes paramagnetic particle method concentration and separation maize sheath blight
The SSR sequence of bacterium, and therefrom develop SSR primer sequence, the labelling of exploitation has carried out heredity to Rhizoctonia solani Kahn
The application of Study on Diversity.
Content of the invention
The problem existing for prior art, the purpose of the present invention is to there are provided a kind of Rhizoctonia solani Kahn SSR mark
The preparation method of note, the method is easy, and equipment needed thereby is simple, easy and simple to handle, not it should be understood that the more heredity of test sample
In the case of background information, can efficiently concentrating and separate microsatellite DNA at short notice, thus analyzing acquisition, it is special
SSR primer sequence.
Another object of the present invention is to be to provide SSR marker answering in analysis Rhizoctonia solani Kahn genetic diversity
With obtained SSR primer has higher specific aim, simultaneously because SSR marker itself has quantity enriching, many equipotentials base
Cause and in codominant inheritance the advantages of, be used not only for Rhizoctonia solani Kahn genetic diversity and Genetic relationship, also may be used
To apply in the research such as the structure of Rhizoctonia solani Kahn genetic map, clone of target gene.
A kind of described Rhizoctonia solani Kahn SSR marker it is characterised in that include primer pair MA1, MA3, MA4, MA8,
MA10, MA11, MA12 and MA14, described primer pair MA1 includes primer MA1F and primer MA1R, described primer pair MA3 bag
Include primer MA3F and primer MA3R, described primer pair MA4 includes primer MA4F and primer MA4R, described primer pair MA8 bag
Include primer MA8F and primer MA8R, described primer pair MA10 includes primer MA10F and primer MA10R, described primer pair
MA11 includes primer MA11F and primer MA11R, and described primer pair MA12 includes primer MA12F and primer MA12R, described
Primer pair MA14 includes primer MA14F and primer MA12R,
The nucleotide sequence of described MA1F as shown in SEQ ID No.1,
The nucleotide sequence of described MA1F as shown in SEQ ID No.2,
The nucleotide sequence of described MA3F as shown in SEQ ID No.5,
The nucleotide sequence of described MA3R as shown in SEQ ID No.6,
The nucleotide sequence of described MA4F as shown in SEQ ID No.7,
The nucleotide sequence of described MA4R as shown in SEQ ID No.8,
The nucleotide sequence of described MA8F as shown in SEQ ID No.15,
The nucleotide sequence of described MA8R as shown in SEQ ID No.16,
The nucleotide sequence of described MA10F as shown in SEQ ID No.19,
The nucleotide sequence of described MA10R as shown in SEQ ID No.20,
The nucleotide sequence of described MA11F as shown in SEQ ID No.21,
The nucleotide sequence of described MA11R as shown in SEQ ID No.22,
The nucleotide sequence of described MA12F as shown in SEQ ID No.23,
The nucleotide sequence of described MA12R as shown in SEQ ID No.24,
The nucleotide sequence of described MA14F as shown in SEQ ID No.27,
The nucleotide sequence of described MA14R is as shown in SEQ ID No.28.
A kind of application in analysis Rhizoctonia solani Kahn genetic diversity for the described Rhizoctonia solani Kahn SSR marker.
A kind of preparation method of described Rhizoctonia solani Kahn SSR marker is it is characterised in that comprise the following steps：
a）Using water agar method separating corn sheath blight fungus；
b）Genome DNA is extracted from Rhizoctonia solani Kahn mycelium；
c）Using digestion with restriction enzyme above-mentioned steps b）The STb gene being extracted, and obtain genomic DNA segment；
d）Probe and the hybridization of purpose segment：
By the probe (AG) of pre- amplified production and 5 ' end biotin labelings in molecule hybrid heater12、(TCG)8、(GTC)8、
(GCT)8Hybridization 6-8h, hybridization is 100 μ L systems：20×SSC：15μL；10% mass volume ratio SDS：0.5μL；10
μL Sau3A L（10μM）；10 μ L contain the DNA profiling of joint（100 ng/μL）；Biotinylated probes：1μL（10μM）；ddH2O ：
67.6 μ L, the hybridization temperature of each probe is：(AC)1255℃、(TCG)865℃、(GTC)865 DEG C and (GCT)865 DEG C, obtain
Hybridization solution put 4 DEG C and save backup；
e）Using magnetic bead to above-mentioned steps d）In the DNA fragment containing SSR sequence be enriched with：
（1）Magnetic bead pretreatment：Take a pipe to be coated with the magnetic bead of streptavidin, pat ttom of pipe, then with rifle piping and druming until magnetic bead divides
Leave, collected with magnetic frame, magnetic bead hovering 30s, siphon away supernatant；Wash magnetic bead 3 times with 0.5 × SSC, each 5min, every time
Washing finishes and fixes magnetic bead with magnetic frame, to magnetic bead smooth；Finally, add the 6 × SSC200 μ L containing 0.1% SDS
In pipe, resuspended magnetic bead is with standby；
（2）Enrichment with magnetic bead：Standby hybridization solution is added in magnetic bead pipe, places 1h under room temperature, overturn magnetic bead every 3min, make
Its mix homogeneously；Collected with magnetic frame and remove supernatant；Wash magnetic bead 2 times with 6 × SSC containing 0.1%SDS, each 10min,
It is separately added into 200 μ L 6 × SSC and 200 μ L 3 × SSC afterwards and washs magnetic bead 2 times at room temperature, wash 10min every time；
（3）Magnetic bead is separated with purpose fragment：The NaOH adding 50 μ L 0.15mol/L reacts 30 min at room temperature, takes
Reset and add in the acetic acid of 5.5 μ L 10 × TBE and 3.25 μ L 1.25 mol/L and NaOH, at this moment in solution, contain single-stranded mesh
Mark DNA sequence, adsorbs tube wall with magnetic bead rapidly, and will move in new centrifuge tube containing target DNA fragment；
（4）The PCR amplification of the DNA segment containing SSR sequence：Target DNA after eluting is entered with performing PCR amplification, expands body
It is for 20 μ L, PCR response procedures are：95 DEG C of denaturations 2min；Then, 95 DEG C of degeneration 30s, 60 DEG C of annealing 50s, 72 DEG C of extensions
1min, carries out 35 circulations；Finally, 72 DEG C of extension 10min；4 μ L amplified production products are taken to use 1% sepharose electrophoresis detection,
Judge products distribution scope and product amount；
f）To above-mentioned steps e）The DNA segment that middle gained contains SSR sequence carries out amplification purification；
g）By above-mentioned steps f）The DNA segment of middle gained carries out cloning and sequencing；
h）On the basis of sequencing, with DNAstar software editing sequence, remove carrier sequence and joint sequence, use SSR
Hunter software is analyzed to insertion sequence, finds out microsatellite DNA region therein；
i）Using the conservative of the sequence of microsatellite DNA both sides, design specific primer with software Primer 5.0, be used for
Expand the microsatellite segment in this site, design of primers：Primer length is 18-23bp, and annealing temperature is 50-65 DEG C, and PCR expands
Product length is 120-150bp, and between positive anti-primer, Tm value difference is less than 3 DEG C, and GC content is 20%-80%, obtains 14 couples of SSR
Primer sequence, including primer pair MA1, MA2, MA3, MA4, MA5, MA6, MA7, MA8, MA9, MA10, MA11, MA12, MA13 and
MA14.
Described primer pair MA1 includes primer MA1F and primer MA1R, and described primer pair MA2 includes primer MA2F and draws
Thing MA2R, described primer pair MA3 includes primer MA3F and primer MA3R, and described primer pair MA4 includes primer MA4F and draws
Thing MA4R, described primer pair MA5 includes primer MA5F and primer MA5R, and described primer pair MA6 includes primer MA6F and draws
Thing MA6R, described primer pair MA7 includes primer MA7F and primer MA7R, and described primer pair MA8 includes primer MA8F and draws
Thing MA8R, described primer pair MA9 includes primer MA9F and primer MA9R, described primer pair MA10 include primer MA10F and
Primer MA10R, described primer pair MA11 includes primer MA11F and primer MA11R, and described primer pair MA12 includes primer
MA12F and primer MA12R, described primer pair MA13 includes primer MA13F and primer MA13R, described primer pair MA14 bag
Include primer MA14F and primer MA12R；
The nucleotide sequence of described MA1F as shown in SEQ ID No.1,
The nucleotide sequence of described MA1F as shown in SEQ ID No.2,
The nucleotide sequence of described MA2F as shown in SEQ ID No.3,
The nucleotide sequence of described MA2F as shown in SEQ ID No.4,
The nucleotide sequence of described MA3F as shown in SEQ ID No.5,
The nucleotide sequence of described MA3R as shown in SEQ ID No.6,
The nucleotide sequence of described MA4F as shown in SEQ ID No.7,
The nucleotide sequence of described MA4R as shown in SEQ ID No.8,
The nucleotide sequence of described MA5F as shown in SEQ ID No.9,
The nucleotide sequence of described MA5F as shown in SEQ ID No.10,
The nucleotide sequence of described MA6F as shown in SEQ ID No.11,
The nucleotide sequence of described MA6F as shown in SEQ ID No.12,
The nucleotide sequence of described MA7F as shown in SEQ ID No.13,
The nucleotide sequence of described MA7F as shown in SEQ ID No.14,
The nucleotide sequence of described MA8F as shown in SEQ ID No.15,
The nucleotide sequence of described MA8R as shown in SEQ ID No.16,
The nucleotide sequence of described MA9F as shown in SEQ ID No.17,
The nucleotide sequence of described MA9F as shown in SEQ ID No.18,
The nucleotide sequence of described MA10F as shown in SEQ ID No.19,
The nucleotide sequence of described MA10R as shown in SEQ ID No.20,
The nucleotide sequence of described MA11F as shown in SEQ ID No.21,
The nucleotide sequence of described MA11R as shown in SEQ ID No.22,
The nucleotide sequence of described MA12F as shown in SEQ ID No.23,
The nucleotide sequence of described MA12R as shown in SEQ ID No.24,
The nucleotide sequence of described MA13F as shown in SEQ ID No.25,
The nucleotide sequence of described MA13F as shown in SEQ ID No.26,
The nucleotide sequence of described MA14F as shown in SEQ ID No.27,
The nucleotide sequence of described MA14R is as shown in SEQ ID No.28.
Described preparation method is it is characterised in that described step c）Specifically include：
Take 20 μ g STb gene, in 100 μ L enzyme action systems, use restricted enzymeSau3AI in 37 DEG C of enzyme action 4 h, then 65
DEG C incubate 10min, enzyme action terminate after 1% mass volume ratio agarose gel electrophoresiies separate, reclaim 300-900 bp DNA piece
Section；
Reclaim fragment and connect top connection, coupled reaction is 50 μ L systems, and reaction connects overnight at 16 DEG C, is connected with the DNA of joint
Expand acquisition copy through PCR in advance, pre- amplimer isSau3AI F, described pre- amplimerSauThe nucleotide of 3AI F
Sequence as shown in SEQ ID No.29, PCR reaction system 20 μ L；PCR response procedures are：95 DEG C of denaturations 5min；Then, 95
DEG C degeneration 30s, 60 DEG C of annealing 50s, 72 DEG C of extension 1min, cycle-index 35；Finally, 72 DEG C extend 10min eventually；
Take 3 μ L amplified productions to use 1% mass volume ratio sepharose electrophoresis detection, judge products distribution scope and product amount, remaining
Bottom splits 4 DEG C and saves backup.
Described preparation method is it is characterised in that described enzyme action system is：20 μ g genomic DNAs, 40 USau3AI
Enzyme and 10 μ L 10 enzyme buffer.
Described preparation method is it is characterised in that described joint includes jointSau3AI F and jointSau3AI R,
Described jointSauThe nucleotide sequence of 3AI F as shown in SEQ ID No.29, described jointSauThe nucleotide of 3AI R
Sequence is as shown in SEQ ID No.30.
Described preparation method is it is characterised in that described PCR reaction system 20 μ L is：100 mmol/L Tris-
HCl, 50 mmol/L KCl, 1UTaqArchaeal dna polymerase, 2.5 mmol/L MgCl2, 200 mol/L dNTPs, 200
Mol/L primerSau3AI F, 100 ng DNA profilings, ddH2O supplies volume to 20 μ L.
Described preparation method is it is characterised in that described step g）Specifically include：
The Ligation in vitro of target DNA segment：By the PCR product after recovery purifying, carried out using connecting test kit, reaction system
For 10 μ L, 16 DEG C connect overnight；
The conversion of connection product：Using heat shock method, the carrier of purpose segment is transformed intoDH-5αCompetent cell：Add 5 μ L even
Practice midwifery thing inDH-5αIn competent cell, ice bath 30min；42 DEG C of heat shock 90s, then ice bath 5min, are subsequently adding 1mL and do not contain ammonia
The liquid LB culture medium of benzyl, recovery culture 45min on the shaking table for 150rpm for 37 DEG C of the rotating speeds；Take 100 μ L bacterium solution coatings
On LB flat board, it is inverted in 37 DEG C overnight；
Select positive colony and be sequenced：With bacterium colony PCR technology screening positive colony, first by universal primer M13-47, its core
Nucleotide sequence as shown in SEQ ID No.31 and RV-M, its nucleotide sequence as shown in SEQ ID No.32, and without biotin
The three-primer of the repetitive sequence composition of probe labelling, enters performing PCR amplification screening, reaction system 20 μ L, PCR reaction interval to bacterium solution
Sequence is：95 DEG C of denaturations 5min；Then, 95 DEG C of degeneration 30s of 5 circulations, 60 DEG C of annealing 30s, 72 DEG C of extension 45s；Then, 30
92 DEG C of degeneration 30s of individual circulation, 60 DEG C of annealing 30s, 72 DEG C of extension 55s；Finally, 72 DEG C of extension 10min；Gained PCR primer exists
Electrophoresis on 1% agarose gel, selects different size of positive colony sample presentation sequencing.
Described preparation method is it is characterised in that described reaction system is：1UTaqArchaeal dna polymerase, 100 mmol/L
Tris-HCl、50 mmol/L KCl、2.5 mmol/L MgCl2、200 µmol/L dNTPs、200 µmol/L M13-47、
200 mol/L RV-M, 200 mol/L no biotin probe and 2 μ L bacterium solution.
Described preparation method is it is characterised in that described step i）Middle PCR reaction system is 10 L, containing 100 ng
DNA profiling, 200 mol/L upstream and downstream primers, 100 mmol/L Tris-HCl, 50 mmol/L KCl, 1U Taq DNA gather
Synthase, 2.5 mmol/L MgCl2, 200 mol/L dNTPs；Reaction condition is：95 DEG C of denaturation 5 min；95 DEG C of degeneration 30
S, 54-58 DEG C of annealing 30 s, 72 DEG C of extension 45 s, totally 30 circulations；72 DEG C of extension 10 min；Finally, 4 DEG C of preservations；Amplification is produced
Thing is according to 5:1 volume ratio adds sample-loading buffer, 95 DEG C of degeneration 5min, electrophoresis in 8% polyacrylamide gel, 80W
Invariable power electrophoresis 3h, is carried out with argentation dyeing, develops the color, is fixed, gel imaging instrument record gel images.
Beneficial effects of the present invention are：
Biological for most non-mode, SSR related data is little.Develop these biological SSR marker to population genetics
Research is particularly important.At present, the method for developing SSR primer mainly has four kinds：One is search microsatellite position from public database
Point；Two be using nearly edge species between primer versatility；Three is to build small insert genomic library；Four is to build microsatellite
Enriched library.Additionally, also being appeared in the newspapers successively based on the microsatellite locus screening strategy of transcript profile sequencing or genome sequencing.Its
In, magnesphere, because having the characteristics that efficient, fast enriching microsatellite DNA, is widely used in the screening of microsatellite locus.
The screening Rhizoctonia solani Kahn SSR sequence based on magnesphere set up in this research to develop it corresponding
SSR primer method, convenient and efficient, versatility preferably, can be developed substantial amounts of SSR marker at short notice, can not only use
In Rhizoctonia solani Kahn genetic diversity and Genetic relationship, it is also applied to the structure of Rhizoctonia solani Kahn genetic map
Build, in the clone of target gene.
Compared with other molecular markers, SSR has that allelic variation is many, rich polymorphism, information content high；Stability
Good, evolve suffered select pressure little, in codominant inheritance the advantages of；And have good versatility between kind；Amplified production energy
Detected by electrophoretic analysiss and according to clip size separation allele.Therefore, SSR labelling is by as important something lost
Pass labelling, be widely used in population genetics, relation, hybrid species is formed, genetic linkage mapses build, carry out pedigree and divide
In analysis, gene mapping and the field such as On the Origin of Species and evolutionary analysis, comparative genomics.Maize sheath blight is main as Semen Maydiss
One of disease, the research to this pathogen is less, be also not based in the world Rhizoctonia solani Kahn sequence exploitation proprietary point
Sub- labelling, the present invention provides for the population genetic diversity research of Rhizoctonia solani Kahn to obtain enough microsatellite locus
Strong technical support.
Brief description
Fig. 1 is Rhizoctonia solani Kahn genomic DNA detection electrophoretogram, the 1st hole in Fig. 1（From left to right）For λ dna/
HindIII DNA Marker, stripe size is from top to bottom：23130、9416、6557、4361、2322、2027、567bp；2-
8 holes are Rhizoctonia solani Kahn genome DNA sample.
Fig. 2 is bacterium solution PCR primer schematic diagram, the 1st hole in Fig. 2（From left to right）For 100bp DNA Marker, band is big
Little it is from top to bottom：1500、1200、1000、900、800、700、600、500、400、300、200、100bp；2-15 hole is bacterium
Liquid is the PCR primer of template.
Fig. 3 is SSR marker MA1（3-A）、MA3（3-B）、MA4（3-C）、MA8（3-D）、MA10（3-E）、MA11（3-F）、
MA12（3-G）、MA14（3-H）The polyacrylamide gel electrophoresis result figure of detection Rhizoctonia solani Kahn.
Specific embodiment
To further illustrate the present invention with reference to embodiments.
Embodiment 1：A kind of preparation method of Enrichment by Magnetic Beads Rhizoctonia solani Kahn SSR labelling
1st, material to be tested：60 maize sheath blight bacteria strains.
2nd, water agar method separating corn sheath blight fungus are adopted；Concrete grammar is with reference to Zhou Erxun, Yang Mei. from Diseased Plant Tissues
Middle quick, the easy technology separating Rhizoctonia solani Kuhn. Agricultural University Of South China's journal, 1998,19 (1):125-126.
3rd, take the mycelia of Rhizoctonia solani Kahn, genome DNA is extracted using CTAB method；Picking Rhizoctonia solani Kahn
Mycelium is inoculated in potato dextrose broth（PDB）In, constant-temperature table shaken cultivation（28 DEG C, 120 r/min）6 d
Afterwards, collect mycelium.CTAB method is extracted genome DNA concrete grammar and is translated with reference to Huang Peitang etc., Molecular Cloning:A Laboratory guide (the
Three editions) (in translate version), 2002.The DNA sample taking 5 μ L enters row agarose gel electrophoresis detection DNA mass（See Fig. 1）.
4、SauThe preparation of 3AI joint：WillSau3AIF（5 '-GGC CAG AGA CCC CAA GCT TCG -3 ', such as
Shown in SEQ ID No.29）WithSau3AI R（3’-CCG GTC TCT GGG GTT CGA AGC CTA G-PO4- 5 ', such as
Shown in SEQ ID No.30）Nucleotide chain is made into 200 pmol/ μ L solution；Equimolar solution is taken to mix respectively, 80 DEG C of degeneration 5-
10 min, natural cooling 1 hr formation at room temperature has the joint of viscous end, plus dd H2O is made into final concentration of 10 pmol/ μ
L solution.
5th, the hybridization of probe and purpose segment
（1）The enzyme action of Rhizoctonia solani Kahn genomic DNA fragment：Take about 20 μ g genomic DNAs, in 100 μ L enzyme action systems (40
USau3AI enzyme and 10 μ L 10 enzyme buffer) in, use restricted enzymeSau3AI in 37 DEG C of enzyme action 4h, so
65 DEG C of incubation 10min afterwards.
（2）Rhizoctonia solani Kahn genomic DNA fragment jointing：Enzyme action connects after terminatingSau3AI joint, connects
React for 50 μ L systems (the T4 DNA ligase and 10 of the enzyme action recovery fragment, the joint of 25 pmol and 4 μ L of 2.5 μ g
T4 DNA Buffer 5 μ L), reaction connects overnight at 16 DEG C.The DNA of union joint expands acquisition multicopy in advance through PCR, in advance
Amplimer isSau3AI F：5’- GGC CAG AGA CCC CAA GCT TCG -3’（As shown in SEQ ID No.29）,
PCR reaction system 20 μ L, containing 100 ng DNA profilings（Union joint product）, 100 mmol/L Tris-HCl, 50 mmol/L
KCl, 1U Taq archaeal dna polymerase, 2.5 mmol/L MgCl2, 200 mol/L dNTPs, 200 mol/L Sau 3AI F.
PCR response procedures are：95 DEG C of denaturations 5min；Then, 95 DEG C of degeneration 30s, 60 DEG C of annealing 50s, 72 DEG C of extension 1min, circulation
Number of times 35；Finally, 72 DEG C of extension 10min.3 μ L amplified production products are taken to use 1% (mass volume ratio) agarose electricity
Swimming detection, judges products distribution scope and product amount, remaining part is put 4 DEG C and saved backup.
（3）Genomic fragment is hybridized with biotinylated probes：In molecule hybrid heater, by pre- amplified production and 5 ' end biotin
The probe (AC) of labelling12、(TCG)8、(GTC)8And (GCT)8Hybridization 6-8h, hybridization is that (10 μ L contain joint to 100 μ L systems
DNA profiling（100 ng/μL）, 1 μ L biotinylated probes（10μM）；10 μL Sau3A L（10μM）；20 ´ SSC 15μL；
10% SDS 0.5 μ L), the hybridization solution of acquisition is put 4 DEG C and is saved backup.
6th, enrichment with magnetic bead contains the DNA segment of SSR sequence, and method is as follows：
（1）Magnetic bead pretreatment：Take 1-2mg to be coated with the magnetic bead of streptavidin, wash magnetic bead 3 times with 0.5 × SSC, every time
5min (300 μ L/ time), every time washing finishes and fixes magnetic bead with magnetic frame, to magnetic bead smooth, washed magnetic bead is placed in 6
×SSC（Containing 0.1% SDS）200 μ L in pipe resuspended magnetic bead with standby.
（2）Enrichment with magnetic bead：Standby hybridization solution is added in magnetic bead pipe, under room temperature, places 30min, every 3min overturns magnetic
, so as to mix homogeneously, action will be gently, it is to avoid magnetic bead precipitates for pearl.It is separately added into 200 μ L 6 × SSC afterwards（No SDS）With 200 μ
L 3×SSC（No SDS）Washing magnetic bead 2 times at room temperature, each 10min.
（3）Magnetic bead is separated with purpose fragment：The NaOH adding 50 μ L 0.15mol/L reacts 30 min at room temperature,
Take supernatant to add in the acetic acid of 5.5 μ L 10 × TBE and 3.25 μ L 1.25 mol/L and NaOH, now contain single-stranded in solution
Target dna sequence, with magnetic bead rapid adsorption tube wall, and will move in new centrifuge tube containing target DNA fragment.
（4）The PCR amplification of the DNA segment containing SSR sequence：Target DNA after eluting is entered with performing PCR amplification, expands
Increasing system be 20 μ L (single-stranded purpose fragment, the single-stranded primer of 10 pmol/ μ L Sau 3AI F, 1U Taq archaeal dna polymerase, 100
mmol/L Tris-HCl、50 mmol/L KCl、2.5 mmol/L MgCl2With 200 mol/L dNTPs).PCR response procedures
For：95 DEG C of denaturations 5min；Then, 95 DEG C of degeneration 30s, 60 DEG C of annealing 45s, 72 DEG C of extension 1min, carry out 35 circulations；?
Afterwards, 72 DEG C extend 10min eventually.Take 4 μ L amplified production products to use 1% (mass volume ratio) sepharose electrophoresis to detect, judge
Products distribution scope and product amount.
（5）The purification of amplified production：Product after PCR amplification, cuts in the DNA segment ranges of 300bp-900bp
Agarose gel is contained in the little centrifuge tube of 1.5mL, reclaims PCR amplification using the gel reclaims kit of TaKaRa company and produces
Thing, the electrophoresis on 1% (mass volume ratio) agarose gel that EB dyes of the DNA after recovery, the matter of DNA is reclaimed in detection
Amount, is placed in -20 DEG C and saves backup.
7th, the cloning and sequencing of the DNA segment containing SSR sequence
（1）The Ligation in vitro of target DNA segment：By the PCR product after recovery purifying, using the connection reagent of TaKaRa company
Box is carried out, and reaction system is 10 μ L (DNA of 4.5 μ L enrichments, 0.5 μ L pMD-18T carrier and 5 μ L Solution I solution),
16 DEG C connect overnight.
（2）The conversion of connection product：Using heat shock method, the carrier of purpose segment is transformed intoDH-5αCompetent cell.Plus
Enter 5 μ L connection products inDH-5αIn competent cell, ice bath 30min.42 DEG C of heat shock 90s, then ice bath 5m, are subsequently adding 1mL
Liquid LB culture medium (without ammonia benzyl), in 37 DEG C of shaking tables (150rpm) upper recovery culture 45min.Take 100 μ L bacterium solution coatings
On LB flat board, it is inverted in 37 DEG C overnight (12-16hr)；
（3）Select positive colony and be sequenced：With bacterium colony PCR technology screening positive colony, first by M13-47（5’-
CGCCAGGGTTTTCCCAGTCACGAC -3 ', as shown in SEQ ID No.31）And RV-M（5’-
GAGCGGATAACAATTTCACACAGG -3 ', as shown in SEQ ID No.32）Sieved with the three-primer of repetitive sequence composition
Select positive colony.Reaction system is 20 μ L (1UTaqArchaeal dna polymerase, 100 mmol/L Tris-HCl, 50 mmol/L KCl,
2.5 mmol/L MgCl2、200 µmol/L dNTPs、200 µmol/L M13-47、200 µmol/L RV-M、200 µmol/
L probe（No biotin）With 2 μ L bacterium solution).Reaction condition is：95 DEG C of denaturations 5min；Then, 95 DEG C of degeneration of 5 circulations
30s, 60 DEG C of annealing 30s, 72 DEG C of extension 45s；Then, 92 DEG C of degeneration 30s of 30 circulations, 60 DEG C of annealing 30s, 72 DEG C of extensions
55s；Finally, 72 DEG C of extension 10min.Gained PCR product electrophoresis on the agarose gel of 1% (mass volume ratio)（Figure
2）, judge that product has or not and its size, select the different size of positive colony sample presentation having band limpid in sight and be sequenced.
8th, use DNAstar software (http://www.dnastar.com/) editor's sequence, remove carrier sequence and joint sequence
Row, with SSR Hunter software (Li Qiang, Wan Jianmin. SSRHunter, the opening of SSR site search software of a localization
Send out. heredity, 2005,27（5）：808-810) insertion sequence is analyzed, finds out microsatellite DNA region therein.
9th, design primer amplification genomic DNA：According to the conservative of microsatellite DNA both sides sequence, with software
Primer Premier 5.0（Rozen S, Skaletsky H J. PRIMER 3 on the WWW for general
users and for biologist programmers [M]//KRAWETZ S, MISENER S. Bioinformatics
Methods and Protocols: Methods in Molecular Biology. Totowa, New Jersey:
Humana Press, 2000, 365-386.）, design specific primer, expand the microsatellite segment in this site, design of primers
Using following rigor：Primer length is 18-23bp, and annealing temperature is 50-65 DEG C, and PCR amplified production length is 120-
150bp, between positive anti-primer, Tm value difference is less than 3 DEG C, and GC content is 20%-80%.Obtain 14 pairs of primers as shown in table 1
（MA1, MA2, MA3, MA4, MA5, MA6, MA7, MA8, MA9, MA10, MA11, MA12, MA13 and MA14）, wherein 8 pairs primers
（MA1, MA3, MA4, MA8, MA10, MA11, MA12 and MA14）PCR amplified band has polymorphism.
Described primer pair MA1 includes primer MA1F and primer MA1R, and described primer pair MA2 includes primer MA2F and draws
Thing MA2R, described primer pair MA3 includes primer MA3F and primer MA3R, and described primer pair MA4 includes primer MA4F and draws
Thing MA4R, described primer pair MA5 includes primer MA5F and primer MA5R, and described primer pair MA6 includes primer MA6F and draws
Thing MA6R, described primer pair MA7 includes primer MA7F and primer MA7R, and described primer pair MA8 includes primer MA8F and draws
Thing MA8R, described primer pair MA9 includes primer MA9F and primer MA9R, described primer pair MA10 include primer MA10F and
Primer MA10R, described primer pair MA11 includes primer MA11F and primer MA11R, and described primer pair MA12 includes primer
MA12F and primer MA12R, described primer pair MA13 includes primer MA13F and primer MA13R, described primer pair MA14 bag
Include primer MA14F and primer MA12R；
The nucleotide sequence of described MA1F as shown in SEQ ID No.1,
The nucleotide sequence of described MA1F as shown in SEQ ID No.2,
The nucleotide sequence of described MA2F as shown in SEQ ID No.3,
The nucleotide sequence of described MA2F as shown in SEQ ID No.4,
The nucleotide sequence of described MA3F as shown in SEQ ID No.5,
The nucleotide sequence of described MA3R as shown in SEQ ID No.6,
The nucleotide sequence of described MA4F as shown in SEQ ID No.7,
The nucleotide sequence of described MA4R as shown in SEQ ID No.8,
The nucleotide sequence of described MA5F as shown in SEQ ID No.9,
The nucleotide sequence of described MA5F as shown in SEQ ID No.10,
The nucleotide sequence of described MA6F as shown in SEQ ID No.11,
The nucleotide sequence of described MA6F as shown in SEQ ID No.12,
The nucleotide sequence of described MA7F as shown in SEQ ID No.13,
The nucleotide sequence of described MA7F as shown in SEQ ID No.14,
The nucleotide sequence of described MA8F as shown in SEQ ID No.15,
The nucleotide sequence of described MA8R as shown in SEQ ID No.16,
The nucleotide sequence of described MA9F as shown in SEQ ID No.17,
The nucleotide sequence of described MA9F as shown in SEQ ID No.18,
The nucleotide sequence of described MA10F as shown in SEQ ID No.19,
The nucleotide sequence of described MA10R as shown in SEQ ID No.20,
The nucleotide sequence of described MA11F as shown in SEQ ID No.21,
The nucleotide sequence of described MA11R as shown in SEQ ID No.22,
The nucleotide sequence of described MA12F as shown in SEQ ID No.23,
The nucleotide sequence of described MA12R as shown in SEQ ID No.24,
The nucleotide sequence of described MA13F as shown in SEQ ID No.25,
The nucleotide sequence of described MA13F as shown in SEQ ID No.26,
The nucleotide sequence of described MA14F as shown in SEQ ID No.27,
The nucleotide sequence of described MA14R is as shown in SEQ ID No.28.
Table 1：Upstream, downstream primer sequence
Embodiment 2：A kind of Enrichment by Magnetic Beads Rhizoctonia solani Kahn SSR is marked at analysis Rhizoctonia solani Kahn genetic diversity
Application in property
（1）With designed 60 Rhizoctonia solani Kahn materials of SSR primer amplification；
Material to be tested all picks up from Hangzhou, Zhejiang province China Paddy Rice Inst Fuyang proving ground.From 60 Rhizoctonia solani Kahn
STb gene is extracted, performing PCR of going forward side by side expands in mycelium.The cumulative volume of PCR reaction is 10 μ L (DNA：10ng ；On 10pmol/L
Downstream primer：Each 0.5 μ L；10×Taq Buffer ：1μL；25mmol/L MgCl2：1μL；10mmol/L dNTPs：1μL ；
5U/ μ L Taq enzyme：0.1μL).PCR amplified reaction program is：94 DEG C of denaturations 5min；Then, 94 DEG C of degeneration 30s, 55 DEG C are moved back
Fiery 30s, 72 DEG C of extension 45s, carry out 30 circulations；Finally, 72 DEG C of extension 10min.PCR product passes through 8% polyacrylamide and coagulates
Gel electrophoresis are pressed molecular size range and are separated, and deposition condition is 80W 3h.Gel component is：8% denaturing polyacrylamide solution 60mL,
TEMED50 μ L, 10% Ammonium Persulfate 98.5 500 μ L；1 × TBE buffer electrophoresis 3h；Dyeing course is：10% glacial acetic acid solution is fixed
20min, ultra-pure water is washed rapidly, 0.2% silver nitrate solution silver staining 30min, washes rapidly again, and developer solution colour developing is up to band
Clearly, 10% glacial acetic acid solution terminates 5min, and ultra-pure water is washed again；Band or no band is had to be recorded as 1 or 0 respectively in gel.
（2）Calculate each pair primer polymorphism information content, using popgene32 software (Yeh F C, Yang R C,
Boyle T. Popgene Version 1.31 Quick User Guide. Canada: University of Alberta
and Centre for International Forestry Research, 1999:1-29.) to step（1）Shown material
Material carries out the analysis of genetic diversity, main inclusion：Observation alleleNa, effective number of alleleNe, observe heterozygosityHo,
Expect heterozygosityHe.
（3）Concrete outcome is：When analysis of genetic diversity is carried out to 60 Rhizoctonia solani Kahn materials, 8 pairs of primer tools
Have polymorphism, coamplification 41 to allele, such as Fig. 3.The number of alleles that each site primer arrives（Na）For 3-8, put down
All number of alleles 5.13；Effective number of allele（Ne）Highest site is MA1（3.38）, minimum site is 1.41
（MA3）, meansigma methodss are 2.16；Observation heterozygosity（Ho）Minima be 0.31（MA14）, maximum is 1.50（MA10）, averagely
It is worth for 0.90；Expect heterozygosity（He）Minima be 0.06（MA1）, maximum is 0.70（MA10）, meansigma methodss are 0.41（Table
2）.8 pairs of primers are MA1, MA3, MA4, MA8, MA10, MA11, MA12 and MA14.
The number of alleles of table 2 Rhizoctonia solani Kahn microsatellite locus and heterozygosity
SEQUENCE LISTING
<110>China Paddy Rice Inst
<120>A kind of Rhizoctonia solani Kahn SSR marker and preparation method thereof, application
<130> 1
<160> 33
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> DNA
<213>Synthetic
<400> 1
tgccgcttca gctgctgc 18
<210> 2
<211> 18
<212> DNA
<213>Synthetic
<400> 2
gccccgcaac cctccatt 18
<210> 3
<211> 18
<212> DNA
<213>Synthetic
<400> 3
cggtgccccg atgttgag 18
<210> 4
<211> 18
<212> DNA
<213>Synthetic
<400> 4
ccctcggttt tgatgttt 18
<210> 5
<211> 18
<212> DNA
<213>Synthetic
<400> 5
caatgccgcc ctccaaaa 18
<210> 6
<211> 19
<212> DNA
<213>Synthetic
<400> 6
cggtggatgc gttcaactt 19
<210> 7
<211> 21
<212> DNA
<213>Synthetic
<400> 7
tcgaaaactc atcaccaagc a 21
<210> 8
<211> 18
<212> DNA
<213>Synthetic
<400> 8
cccgacccga tgtccact 18
<210> 9
<211> 20
<212> DNA
<213>Synthetic
<400> 9
tgctgctgag actgttgttg 20
<210> 10
<211> 19
<212> DNA
<213>Synthetic
<400> 10
gcctggtgcc atgtatttt 19
<210> 11
<211> 21
<212> DNA
<213>Synthetic
<400> 11
gcctgctact cttcctcctc c 21
<210> 12
<211> 20
<212> DNA
<213>Synthetic
<400> 12
gccgtcgttg ctgttgttgt 20
<210> 13
<211> 20
<212> DNA
<213>Synthetic
<400> 13
ggctaaggct aaggcacagg 20
<210> 14
<211> 19
<212> DNA
<213>Synthetic
<400> 14
aactccgagt ccgaatcca 19
<210> 15
<211> 20
<212> DNA
<213>Synthetic
<400> 15
taagcctata agcctcatca 20
<210> 16
<211> 18
<212> DNA
<213>Synthetic
<400> 16
ggcggctggt aggtctgt 18
<210> 17
<211> 18
<212> DNA
<213>Synthetic
<400> 17
tgattccgag gcgtcttc 18
<210> 18
<211> 22
<212> DNA
<213>Synthetic
<400> 18
cgaaactgag gctataccag ac 22
<210> 19
<211> 18
<212> DNA
<213>Synthetic
<400> 19
agcatgattc tcatttgt 18
<210> 20
<211> 18
<212> DNA
<213>Synthetic
<400> 20
gtaagaggca aggtaaaa 18
<210> 21
<211> 19
<212> DNA
<213>Synthetic
<400> 21
ccacctcgtt ccaatcaca 19
<210> 22
<211> 18
<212> DNA
<213>Synthetic
<400> 22
accgccctct tcctcaca 18
<210> 23
<211> 18
<212> DNA
<213>Synthetic
<400> 23
cgtcgcaagg ccattgaa 18
<210> 24
<211> 18
<212> DNA
<213>Synthetic
<400> 24
tccgagtccg aatccact 18
<210> 25
<211> 25
<212> DNA
<213>Synthetic
<400> 25
tcgagttcga cctgtcgcag agtca 25
<210> 26
<211> 25
<212> DNA
<213>Synthetic
<400> 26
tgactctgcg acaggtcgaa ctcga 25
<210> 27
<211> 21
<212> DNA
<213>Synthetic
<400> 27
tcgaaaactc atcaccaagc a 21
<210> 28
<211> 18
<212> DNA
<213>Synthetic
<400> 28
cccgacccga tgtccact 18
<210> 29
<211> 21
<212> DNA
<213>Synthetic
<400> 29
ggccagagac cccaagcttc g 21
<210> 30
<211> 25
<212> DNA
<213>Synthetic
<400> 30
ccggtctctg gggttcgaag cctag 25
<210> 31
<211> 24
<212> DNA
<213>Synthetic
<400> 31
cgccagggtt ttcccagtca cgac 24
<210> 32
<211> 24
<212> DNA
<213>Synthetic
<400> 32
gagcggataa caatttcaca cagg 24
Claims (10)
1. a kind of Rhizoctonia solani Kahn SSR marker it is characterised in that include primer pair MA1, MA3, MA4, MA8, MA10, MA11,
MA12 and MA14, described primer pair MA1 includes primer MA1F and primer MA1R, and described primer pair MA3 includes primer MA3F
With primer MA3R, described primer pair MA4 includes primer MA4F and primer MA4R, and described primer pair MA8 includes primer MA8F
With primer MA8R, described primer pair MA10 includes primer MA10F and primer MA10R, and described primer pair MA11 includes primer
MA11F and primer MA11R, described primer pair MA12 includes primer MA12F and primer MA12R, described primer pair MA14 bag
Include primer MA14F and primer MA12R,
The nucleotide sequence of described MA1F as shown in SEQ ID No.1,
The nucleotide sequence of described MA1F as shown in SEQ ID No.2,
The nucleotide sequence of described MA3F as shown in SEQ ID No.5,
The nucleotide sequence of described MA3R as shown in SEQ ID No.6,
The nucleotide sequence of described MA4F as shown in SEQ ID No.7,
The nucleotide sequence of described MA4R as shown in SEQ ID No.8,
The nucleotide sequence of described MA8F as shown in SEQ ID No.15,
The nucleotide sequence of described MA8R as shown in SEQ ID No.16,
The nucleotide sequence of described MA10F as shown in SEQ ID No.19,
The nucleotide sequence of described MA10R as shown in SEQ ID No.20,
The nucleotide sequence of described MA11F as shown in SEQ ID No.21,
The nucleotide sequence of described MA11R as shown in SEQ ID No.22,
The nucleotide sequence of described MA12F as shown in SEQ ID No.23,
The nucleotide sequence of described MA12R as shown in SEQ ID No.24,
The nucleotide sequence of described MA14F as shown in SEQ ID No.27,
The nucleotide sequence of described MA14R is as shown in SEQ ID No.28.
2. as claimed in claim 1 a kind of Rhizoctonia solani Kahn SSR marker analysis Rhizoctonia solani Kahn genetic diversity in
Application.
3. as claimed in claim 1 a kind of preparation method of Rhizoctonia solani Kahn SSR marker it is characterised in that including following walking
Suddenly：
a）Using water agar method separating corn sheath blight fungus；
b）Genome DNA is extracted from Rhizoctonia solani Kahn mycelium；
c）Using digestion with restriction enzyme above-mentioned steps b）The STb gene being extracted, and obtain genomic DNA segment；
d）Probe and the hybridization of purpose segment：
By the probe (AG) of pre- amplified production and 5 ' end biotin labelings in molecule hybrid heater12、(TCG)8、(GTC)8、(GCT)8
Hybridization 6-8h, hybridization is 100 μ L systems：20×SSC：15μL；10% mass volume ratio SDS：0.5μL；10 μL
Sau3A L（10μM）；10 μ L contain the DNA profiling of joint（100 ng/μL）；Biotinylated probes：1μL（10μM）；ddH2O ：
67.6 μ L, the hybridization temperature of each probe is：(AC)1255℃、(TCG)865℃、(GTC)865 DEG C and (GCT)865 DEG C, obtain
Hybridization solution put 4 DEG C and save backup；
e）Using magnetic bead to above-mentioned steps d）In the DNA fragment containing SSR sequence be enriched with：
（1）Magnetic bead pretreatment：Take a pipe to be coated with the magnetic bead of streptavidin, pat ttom of pipe, then with rifle piping and druming until magnetic bead divides
Leave, collected with magnetic frame, magnetic bead hovering 30s, siphon away supernatant；Wash magnetic bead 3 times with 0.5 × SSC, each 5min, every time
Washing finishes and fixes magnetic bead with magnetic frame, to magnetic bead smooth；Finally, add 6 × SSC 200 μ containing 0.1% SDS
L in pipe resuspended magnetic bead with standby；
（2）Enrichment with magnetic bead：Standby hybridization solution is added in magnetic bead pipe, places 1h under room temperature, overturn magnetic bead every 3min, make
Its mix homogeneously；Collected with magnetic frame and remove supernatant；Wash magnetic bead 2 times with 6 × SSC containing 0.1%SDS, each 10min,
It is separately added into 200 μ L 6 × SSC and 200 μ L 3 × SSC afterwards and washs magnetic bead 2 times at room temperature, wash 10min every time；
（3）Magnetic bead is separated with purpose fragment：The NaOH adding 50 μ L 0.15mol/L reacts 30 min at room temperature, takes
Reset and add in the acetic acid of 5.5 μ L 10 × TBE and 3.25 μ L 1.25 mol/L and NaOH, at this moment in solution, contain single-stranded mesh
Mark DNA sequence, adsorbs tube wall with magnetic bead rapidly, and will move in new centrifuge tube containing target DNA fragment；
（4）The PCR amplification of the DNA segment containing SSR sequence：Target DNA after eluting is entered with performing PCR amplification, expands body
It is for 20 μ L, PCR response procedures are：95 DEG C of denaturations 2min；Then, 95 DEG C of degeneration 30s, 60 DEG C of annealing 50s, 72 DEG C of extensions
1min, carries out 35 circulations；Finally, 72 DEG C of extension 10min；4 μ L amplified production products are taken to use 1% sepharose electrophoresis detection,
Judge products distribution scope and product amount；
f）To above-mentioned steps e）The DNA segment that middle gained contains SSR sequence carries out amplification purification；
g）By above-mentioned steps f）The DNA segment of middle gained carries out cloning and sequencing；
h）On the basis of sequencing, with DNAstar software editing sequence, remove carrier sequence and joint sequence, use SSR
Hunter software is analyzed to insertion sequence, finds out microsatellite DNA region therein；
i）Using the conservative of the sequence of microsatellite DNA both sides, design specific primer with software Primer 5.0, be used for
Expand the microsatellite segment in this site, design of primers：Primer length is 18-23bp, and annealing temperature is 50-65 DEG C, and PCR expands
Product length is 120-150bp, and between positive anti-primer, Tm value difference is less than 3 DEG C, and GC content is 20%-80%, obtains 14 couples of SSR
Primer sequence, including primer pair MA1, MA2, MA3, MA4, MA5, MA6, MA7, MA8, MA9, MA10, MA11, MA12, MA13 and
MA14.
Described primer pair MA1 includes primer MA1F and primer MA1R, and described primer pair MA2 includes primer MA2F and primer
MA2R, described primer pair MA3 includes primer MA3F and primer MA3R, and described primer pair MA4 includes primer MA4F and primer
MA4R, described primer pair MA5 includes primer MA5F and primer MA5R, and described primer pair MA6 includes primer MA6F and primer
MA6R, described primer pair MA7 includes primer MA7F and primer MA7R, and described primer pair MA8 includes primer MA8F and primer
MA8R, described primer pair MA9 includes primer MA9F and primer MA9R, and described primer pair MA10 includes primer MA10F and draws
Thing MA10R, described primer pair MA11 includes primer MA11F and primer MA11R, and described primer pair MA12 includes primer
MA12F and primer MA12R, described primer pair MA13 includes primer MA13F and primer MA13R, described primer pair MA14 bag
Include primer MA14F and primer MA12R；
The nucleotide sequence of described MA1F as shown in SEQ ID No.1,
The nucleotide sequence of described MA1F as shown in SEQ ID No.2,
The nucleotide sequence of described MA2F as shown in SEQ ID No.3,
The nucleotide sequence of described MA2F as shown in SEQ ID No.4,
The nucleotide sequence of described MA3F as shown in SEQ ID No.5,
The nucleotide sequence of described MA3R as shown in SEQ ID No.6,
The nucleotide sequence of described MA4F as shown in SEQ ID No.7,
The nucleotide sequence of described MA4R as shown in SEQ ID No.8,
The nucleotide sequence of described MA5F as shown in SEQ ID No.9,
The nucleotide sequence of described MA5F as shown in SEQ ID No.10,
The nucleotide sequence of described MA6F as shown in SEQ ID No.11,
The nucleotide sequence of described MA6F as shown in SEQ ID No.12,
The nucleotide sequence of described MA7F as shown in SEQ ID No.13,
The nucleotide sequence of described MA7F as shown in SEQ ID No.14,
The nucleotide sequence of described MA8F as shown in SEQ ID No.15,
The nucleotide sequence of described MA8R as shown in SEQ ID No.16,
The nucleotide sequence of described MA9F as shown in SEQ ID No.17,
The nucleotide sequence of described MA9F as shown in SEQ ID No.18,
The nucleotide sequence of described MA10F as shown in SEQ ID No.19,
The nucleotide sequence of described MA10R as shown in SEQ ID No.20,
The nucleotide sequence of described MA11F as shown in SEQ ID No.21,
The nucleotide sequence of described MA11R as shown in SEQ ID No.22,
The nucleotide sequence of described MA12F as shown in SEQ ID No.23,
The nucleotide sequence of described MA12R as shown in SEQ ID No.24,
The nucleotide sequence of described MA13F as shown in SEQ ID No.25,
The nucleotide sequence of described MA13F as shown in SEQ ID No.26,
The nucleotide sequence of described MA14F as shown in SEQ ID No.27,
The nucleotide sequence of described MA14R is as shown in SEQ ID No.28.
4. right wants preparation method as described in 3 it is characterised in that described step c）Specifically include：
Take 20 μ g STb gene, in 100 μ L enzyme action systems, use restricted enzymeSau3AI in 37 DEG C of enzyme action 4 h, then 65
DEG C incubate 10min, enzyme action terminate after 1% mass volume ratio agarose gel electrophoresiies separate, reclaim 300-900 bp DNA piece
Section；
Reclaim fragment and connect top connection, coupled reaction is 50 μ L systems, and reaction connects overnight at 16 DEG C, is connected with the DNA of joint
Expand acquisition copy through PCR in advance, pre- amplimer isSau3AI F, described pre- amplimerSauThe nucleotide of 3AI F
Sequence as shown in SEQ ID No.29, PCR reaction system 20 μ L；PCR response procedures are：95 DEG C of denaturations 5min；Then, 95
DEG C degeneration 30s, 60 DEG C of annealing 50s, 72 DEG C of extension 1min, cycle-index 35；Finally, 72 DEG C extend 10min eventually；
Take 3 μ L amplified productions to use 1% mass volume ratio sepharose electrophoresis detection, judge products distribution scope and product amount, remaining
Bottom splits 4 DEG C and saves backup.
5. preparation method as claimed in claim 4 is it is characterised in that described enzyme action system is：20 μ g genomic DNAs, 40 USau3AI enzyme and 10 μ L 10 enzyme buffer.
6. preparation method as claimed in claim 4 is it is characterised in that described joint includes jointSau3AI F and jointSau3AI R, described jointSauThe nucleotide sequence of 3AI F as shown in SEQ ID No.29, described jointSau3AI
The nucleotide sequence of R is as shown in SEQ ID No.30.
7. preparation method as claimed in claim 4 is it is characterised in that described PCR reaction system 20 μ L is：100 mmol/L
Tris-HCl, 50 mmol/L KCl, 1UTaqArchaeal dna polymerase, 2.5 mmol/L MgCl2, 200 mol/L dNTPs, 200
Mol/L primerSau3AI F, 100 ng DNA profilings, ddH2O supplies volume to 20 μ L.
8. preparation method as claimed in claim 3 is it is characterised in that described step g）Specifically include：
The Ligation in vitro of target DNA segment：By the PCR product after recovery purifying, carried out using connecting test kit, reaction system
For 10 μ L, 16 DEG C connect overnight；
The conversion of connection product：Using heat shock method, the carrier of purpose segment is transformed intoDH-5αCompetent cell：Add 5 μ L even
Practice midwifery thing inDH-5αIn competent cell, ice bath 30min；42 DEG C of heat shock 90s, then ice bath 5min, are subsequently adding 1mL and do not contain ammonia
The liquid LB culture medium of benzyl, recovery culture 45min on the shaking table for 150rpm for 37 DEG C of the rotating speeds；Take 100 μ L bacterium solution coatings
On LB flat board, it is inverted in 37 DEG C overnight；
Select positive colony and be sequenced：With bacterium colony PCR technology screening positive colony, first by universal primer M13-47, its core
Nucleotide sequence as shown in SEQ ID No.31 and RV-M, its nucleotide sequence as shown in SEQ ID No.32, and without biotin
The three-primer of the repetitive sequence composition of probe labelling, enters performing PCR amplification screening, reaction system 20 μ L, PCR reaction interval to bacterium solution
Sequence is：95 DEG C of denaturations 5min；Then, 95 DEG C of degeneration 30s of 5 circulations, 60 DEG C of annealing 30s, 72 DEG C of extension 45s；Then, 30
92 DEG C of degeneration 30s of individual circulation, 60 DEG C of annealing 30s, 72 DEG C of extension 55s；Finally, 72 DEG C of extension 10min；Gained PCR product exists
Electrophoresis on 1% agarose gel, selects different size of positive colony sample presentation sequencing.
9. preparation method as claimed in claim 8 is it is characterised in that described reaction system is：1UTaqArchaeal dna polymerase,
100 mmol/L Tris-HCl、50 mmol/L KCl、2.5 mmol/L MgCl2、200 µmol/L dNTPs、200 µmol/
L M13-47,200 mol/L RV-M, 200 mol/L no biotin probe and 2 μ L bacterium solution.
10. preparation method as claimed in claim 8 is it is characterised in that described step i）Middle PCR reaction system is 10 L,
Containing 100 ng DNA profilings, 200 mol/L upstream and downstream primers, 100 mmol/L Tris-HCl, 50 mmol/L KCl, 1U
Taq archaeal dna polymerase, 2.5 mmol/L MgCl2, 200 mol/L dNTPs；Reaction condition is：95 DEG C of denaturation 5 min；95
DEG C degeneration 30 s, 54-58 DEG C of annealing 30 s, 72 DEG C of extension 45 s, totally 30 circulations；72 DEG C of extension 10 min；Finally, 4 DEG C of guarantors
Deposit；Amplified production is according to 5:1 volume ratio adds sample-loading buffer, and 95 DEG C of degeneration 5min, in 8% polyacrylamide gel
Electrophoresis, 80W invariable power electrophoresis 3h, carried out with argentation dyeing, develop the color, be fixed, gel imaging instrument record gel images.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610841026.8A CN106399508B (en) | 2016-09-22 | 2016-09-22 | SSR (simple sequence repeat) marker for rhizoctonia solani as well as preparation method and application of SSR marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610841026.8A CN106399508B (en) | 2016-09-22 | 2016-09-22 | SSR (simple sequence repeat) marker for rhizoctonia solani as well as preparation method and application of SSR marker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106399508A true CN106399508A (en) | 2017-02-15 |
| CN106399508B CN106399508B (en) | 2019-12-10 |
Family
ID=57996889
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610841026.8A Active CN106399508B (en) | 2016-09-22 | 2016-09-22 | SSR (simple sequence repeat) marker for rhizoctonia solani as well as preparation method and application of SSR marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106399508B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111455088A (en) * | 2020-05-18 | 2020-07-28 | 中国水稻研究所 | SSR molecular marker of Fusarium proliferatum and application thereof |
| CN116240216A (en) * | 2023-02-02 | 2023-06-09 | 义翘神州(泰州)科技有限公司 | Antibody construction sequencing method using bacterial liquid as template |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102080130A (en) * | 2010-12-09 | 2011-06-01 | 湖北光芒能源植物有限公司 | Preparation method and use of simple sequence repeat (SSR) marker for screening miscanthus by magnetic bead enrichment process |
| WO2015168097A1 (en) * | 2014-04-28 | 2015-11-05 | Quest Diagnostics Investments Incorporated | Molecular detection of enterovirus and parechovirus |
-
2016
- 2016-09-22 CN CN201610841026.8A patent/CN106399508B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102080130A (en) * | 2010-12-09 | 2011-06-01 | 湖北光芒能源植物有限公司 | Preparation method and use of simple sequence repeat (SSR) marker for screening miscanthus by magnetic bead enrichment process |
| WO2015168097A1 (en) * | 2014-04-28 | 2015-11-05 | Quest Diagnostics Investments Incorporated | Molecular detection of enterovirus and parechovirus |
Non-Patent Citations (1)
| Title |
|---|
| 王玲: "中国南方水稻纹枯菌和稻瘟菌种群遗传多样性", 《中国学术文献网络出版总库》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111455088A (en) * | 2020-05-18 | 2020-07-28 | 中国水稻研究所 | SSR molecular marker of Fusarium proliferatum and application thereof |
| CN116240216A (en) * | 2023-02-02 | 2023-06-09 | 义翘神州(泰州)科技有限公司 | Antibody construction sequencing method using bacterial liquid as template |
| CN116240216B (en) * | 2023-02-02 | 2024-01-23 | 义翘神州(泰州)科技有限公司 | Antibody construction sequencing method using bacterial liquid as template |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106399508B (en) | 2019-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Silfverberg-Dilworth et al. | Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome | |
| CN105112504B (en) | A kind of molecular marker identification method of the high nitrogen use efficiency gene of rice | |
| CN109762812B (en) | Wheat growth potential related SNP and application thereof as target point in identification of wheat growth potential traits | |
| CN113308562B (en) | Cotton whole genome 40K single nucleotide site and application thereof in cotton genotyping | |
| CN107723378A (en) | The seedless main effect QTL site SDL of grape fruit SNP marker and application | |
| CN112159858A (en) | Molecular marker closely linked with purple cauliflower gene and application thereof | |
| CN108642201B (en) | SNP (Single nucleotide polymorphism) marker related to millet plant height character as well as detection primer and application thereof | |
| CN106399508A (en) | Rhizoctonia solani kuha SSR mark, as well as preparation method and application thereof | |
| CN111471790B (en) | Molecular marker closely linked with wheat grain filling rate QTL QGfr. sicau-7D.1 and application thereof | |
| CN113684300A (en) | SNP loci obviously associated with wheat ear number and application thereof in wheat genetic breeding | |
| CN108251554A (en) | Molecular labeling and its application with peach weeping branch gene close linkage | |
| CN110029174B (en) | SSR (simple sequence repeat) marker related to quality of macrobrachium rosenbergii bodies | |
| CN107619875B (en) | Insertion deletion marker locus for identifying watermelon fruit shape, primer and application | |
| CN107365873B (en) | Molecular marker linked with foxtail sheath color characteristic of millet and application thereof | |
| CN108396026A (en) | The exploitation and application of the Chang Miho couchgrass indigo plant kernel Characters of decaploid special chemoattractant molecule label and fluorescence in situ hybridization probe | |
| CN111647677B (en) | Molecular marker closely linked with wheat grain filling rate QTL QGfr. sicau-6D and application | |
| CN108642199B (en) | SNP (Single nucleotide polymorphism) marker related to growth of millet flag leaves as well as detection primer and application thereof | |
| CN108707684B (en) | SNP (Single nucleotide polymorphism) marker related to millet flag leaf length and detection primer and application thereof | |
| CN108642203B (en) | SNP (Single nucleotide polymorphism) marker related to millet stem thickness character as well as detection primer and application thereof | |
| CN108715901B (en) | SNP marker related to millet plant height character and detection primer and application thereof | |
| CN108913784B (en) | Detection method of EC12 SNP marker of exopalaemon carinicauda | |
| CN108707685B (en) | SNP (Single nucleotide polymorphism) marker related to tillering number character of millet as well as detection primer and application thereof | |
| Doležalová et al. | Karyotype differentiation in cultivated chickpea revealed by Oligopainting fluorescence in situ hybridization | |
| CN108179198A (en) | A kind of method for digging of pig genome molecules label being combined based on LINE1 transposons with micro-satellite primers | |
| CN108642198B (en) | SNP (Single nucleotide polymorphism) marker related to tillering number character of millet as well as detection primer and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |