CN106399364B - Zebra fish model for thrombocytopenia - Google Patents

Abstract

Provided herein is a zebrafish model of thrombocytopenia. In particular, an mpl is provided herein^smu40Use of a mutant zebrafish in the preparation of an animal model for thrombocytopenia. The zebra fish Mpl mutant provided by the invention can be used for researching human thrombocytopenia and screening candidate drugs for treating thrombocytopenia on a large scale.

Description

Zebra fish model for thrombocytopenia

Technical Field

The application relates to the field of biotechnology, in particular to a zebrafish model for platelet development research, thrombocytopenia research and large-scale candidate drug screening thereof.

Background

Platelets are an indispensable part of the blood system, and their main functions are coagulation and hemostasis, repairing damaged blood vessels. When a problem occurs in platelets, the body may assume a disease state, such as a platelet disease, caused by poor formation of a hemostatic plug and bleeding due to a decrease in platelet number (thrombocytopenia) or hypofunction (platelet insufficiency). Thrombocytopenia is a disease in which peripheral blood platelets are reduced to cause bleeding of skin mucosa and internal organs, and is a group of diseases characterized by blood coagulation dysfunction and bleeding which are common in clinic.

In order to better research the development and function of the platelets, a gene capable of specifically marking the platelets needs to be found, so that a transgenic line of the platelet-specific marker is constructed, and the source and differentiation of the platelets are tracked in real time.

MPL (MPL proto-oncogene, thrombopoietin receptor) is a thrombopoietin TPO receptor, a hematopoietic growth factor that regulates the production of a variety of hematopoietic progenitor cells and platelets in humans and mice.

In order to better study the function of MPL and understand the mechanism related to human thrombocytopenia, especially thrombocytopenia in embryonic development stage, it is necessary to construct thrombocytopenia mutants to establish corresponding disease models. In particular, there is a lack in the prior art of an animal model for thrombocytopenia at embryonic development stage and an animal model suitable for large-scale stable screening of candidate drugs for thrombocytopenia. In order to better study the related mechanism of platelets, particularly platelets in embryonic development stage, a transgenic zebrafish specifically marking platelets needs to be constructed, and the transgenic zebrafish can be used for observing the generation and development of the platelets in embryonic stage in real time. The study of platelets is very necessary.

The zebra fish spawns more, is fertilized in vitro, develops in vitro and has transparent early embryo, and is suitable for observation in the embryonic development period and large-scale high-flux screening of alternative drugs. The similarity of blood composition and gene regulation mechanism between zebrafish and human allows zebrafish to be used for studying hematopoietic development¹. Zebra fish has been used as a disease model animal to elucidate some novel molecular mechanisms of hematopoietic diseases²And screening for novel drugs³。

CD41 has been reported as a marker of platelets⁴A transgenic zebrafish which can mark platelets has been constructed in the literature and cell sorting experiments have demonstrated CD41: GFP^highThe fluorescently labeled cells of (1) are all platelets. Therefore, the transgenic zebra fish line can be used for mutant screening of thrombocytopenia and experimental proof of drug therapy.

Interleukin-11 (IL-11) is a hematopoietic growth factor that promotes the proliferation of hematopoietic stem cells and macrophage progenitors and induces macrophageThe cells mature, thereby increasing platelet numbers. The application of the medicine in increasing the number of platelets in mice has been proved in experiments and has also been successfully applied to the clinical treatment of thrombocytopenia in human ^_,56。

In order to facilitate the study of platelets, monitor the treatment effect of platelet-related diseases and the like, the zebra fish transgenic line capable of specifically labeling platelets is particularly important.

Disclosure of Invention

The following is a summary of the subject matter described in detail herein. This summary is not intended to limit the scope of the claims.

In a first aspect of the present application there is provided the use of a mutant zebrafish in the preparation of an animal model of thrombocytopenia, wherein the mutant zebrafish is mpl^smu40And (3) mutants. In some embodiments, the thrombocytopenia is caused by a knockout of the mpl gene. In a further embodiment, the thrombocytopenia may be alleviated following treatment with a hematopoietic growth factor, preferably interleukin-11 (IL-11).

The first aspect of the present application also provides a use of a mutant zebrafish in screening for a drug effective for thrombocytopenia, wherein the mutant zebrafish is mpl^smu40And (3) mutants. In some embodiments, the thrombocytopenia is caused by a knockout of the mpl gene. In a further embodiment, the thrombocytopenia may be alleviated following treatment with a hematopoietic growth factor, preferably interleukin-11 (IL-11). In still further embodiments, the screening may comprise the steps of: (a) treating the mutant zebrafish and wild type synephrine control embryos 1 to 2.5 days, preferably 2 days after fertilization with the same concentration of the candidate drug; (b) observing the number of platelets after one to two days to determine the therapeutic effect of the drug candidate on the thrombocytopenia.

The first aspect of the present application also provides a method for screening a drug effective for thrombocytopenia using the mutant zebrafish, which isWherein the mutant zebrafish is mpl^smu40And (3) mutants. In some embodiments, the thrombocytopenia is caused by a knockout of the mpl gene. In a further embodiment, the thrombocytopenia may be alleviated following treatment with a hematopoietic growth factor, preferably interleukin-11 (IL-11). In still further embodiments, the screening may comprise the steps of: (a) treating the mutant zebrafish and wild type synephrine control embryos 1 to 2.5 days, preferably 2 days after fertilization with the same concentration of the candidate drug; (b) observing the number of platelets after one to two days to determine the therapeutic effect of the drug candidate on the thrombocytopenia.

The first aspect of the application also provides the use of a mutant zebrafish in the preparation of an animal model of coagulation dysfunction, wherein the mutant zebrafish is mpl^smu40And (3) mutants. In some embodiments, the coagulation disorder is caused by a knockout of the mpl gene.

The first aspect of the present application relates primarily to, but is not limited to:

a. obtaining the mutant zebra fish with mpl gene sequence deletion by TALEN targeted gene knockout technology.

b. In the embryonic period, changes in the number of detailed platelets were detected by a WISH assay using probes that label cells of different stages of the myeloid lineage, mature platelet cells were labeled with CD41, and the clotting function of mutant juvenile fish was detected by a clotting assay.

c. Drug screening for thrombocytopenia was performed as an animal model of thrombocytopenia.

Mpl mutant by the Mpl obtained^smu40The following phenotypes were found:

① Mpl mutant Mpl^smu40Zebrafish embryonic platelet numbers were significantly reduced.

② Simultaneous in juvenile Fish stage, Mpl mutant Mpl^smu40Significantly influences the coagulation mechanism in the organism. The clotting time of the mutant was significantly prolonged and the amount of bleeding was significantly increased.

③ Interleukin 11 has been usedFor mutant mpl^smu40The results of the treatment prove that the interleukin 11 can effectively improve the mutant mpl^smu40Zebrafish platelet number.

The first aspect of the present application represents an advance over the prior art:

the zebra fish can be used for researching embryonic-stage platelet diseases; and can carry out long-term disease tracking and high-throughput drug screening due to the characteristic of stable inheritance. The zebrafish Mpl mutant Mpl of the invention is utilized^smu40The study of thrombocytopenia, particularly at embryonic development stage, and the large-scale screening of drug candidates for the treatment of thrombocytopenia can be carried out.

In a first aspect of the application, the Mpl mutant Mpl^smu40Has a stably inherited thrombocytopenic phenotype, and can be used for researching thrombocytopenia, particularly thrombocytopenia in an embryonic development stage. Furthermore, the Mpl mutant Mpl of the present application^smu40Can also be used for expanding and researching various disease mechanisms related to blood platelets, such as thrombus, blood coagulation dysfunction, and the like.

In a second aspect, the present application provides the use of a transgenic zebrafish in the preparation of an animal model specifically labeled for platelets and their precursor cells, wherein the transgenic zebrafish is Tg (mpl: eGFP). In some embodiments, the transgenic zebrafish, myeloid lineage cells and mature red blood cells are not specifically labeled. In some embodiments, the transgenic zebrafish highly express platelet marker genes, lowly express myeloid genes including cd41, lrrc32, gp9, kif1b, nfe2, and hemoglobin genes including mpo, lyz, mfap4, including hbbe1, hbae 1. In some embodiments, the transgenic zebrafish comprises GFP⁺Is significantly increased in response to thrombopoietin.

The second aspect of the application also provides the use of transgenic zebrafish in the preparation of an animal model for coagulation experiments, wherein the transgenic zebrafish is Tg (mpl: eGFP). In some embodiments, the transgeneIn zebrafish, myeloid cells and mature erythrocytes are not specifically labeled. In some embodiments, the transgenic zebrafish highly express platelet marker genes, lowly express myeloid genes including cd41, lrrc32, gp9, kif1b, nfe2, and hemoglobin genes including mpo, lyz, mfap4, including hbbe1, hbae 1. In some embodiments, the transgenic zebrafish comprises GFP⁺Is significantly increased in response to thrombopoietin.

The second aspect of the present application also provides the use of a transgenic zebrafish in the preparation of an animal model for screening for a drug that increases platelet number, wherein the transgenic zebrafish is Tg (mpl: eGFP). In some embodiments, the transgenic zebrafish, myeloid lineage cells and mature red blood cells are not specifically labeled. In some embodiments, the transgenic zebrafish highly express platelet marker genes, lowly express myeloid genes including cd41, lrrc32, gp9, kif1b, nfe2, and hemoglobin genes including mpo, lyz, mfap4, including hbbe1, hbae 1. In some embodiments, the transgenic zebrafish comprises GFP⁺Is significantly increased in response to thrombopoietin.

The second aspect of the application further provides a transgenic zebrafish marked with mpl genes, which can specifically mark platelets and can be used for observing the generation, maturation, differentiation, thrombosis and the like of the platelets in real time. The transgenic zebra fish marked by the mpl gene can also be used for monitoring the drug effect of various treatments aiming at platelet-related diseases, and the unique advantages of the zebra fish can be utilized to observe the drug curative effect in real time. The transgenic zebra fish marked by the mpl gene is used as an extremely convenient and rapid animal model and has more advantages for researching the development and the function of platelets. The transgenic zebrafish is Tg (mpl: eGFP).

A second aspect of the present application relates generally to:

a. pTol2-mpl promoter-eGFP transgenic zebrafish were obtained by the Tol2 transposon mediated technique.

b. In the embryonic period, different transgenic zebra fish cell markers are used for antibody staining co-staining to detect whether the mpl eGFP marked cells are platelets. Meanwhile, the difference of cell specific marker genes of different blood cell transgenic lines is compared by using a fluorescent cell sorting method. And compared to known Tg (CD41: eGFP) transgenic line-labeled platelet cells and hematopoietic stem cells.

c. Examination of mpl whether eGFP is labeled as a platelet cell, a vascular injury experiment, and a Tpo (thrombopoietin) -induced proliferation experiment were performed.

By means of the Tg (mpl: eGFP) transgenic zebrafish obtained, the following phenotypes were found:

① mpl, eGFP transgenic line obtains heritable F0 generation transgenic zebra fish (F0 generation refers to the first generation heritable transgenic female parent or male parent selected), and the marked cell is located at the same position as the position of the mpl probe in situ hybridization expression.

② cell sorting results, mpl: eGFP, by comparison with the medullary transgenic line and the erythroid transgenic line zebra fish⁺The cells highly express the platelet surface protein gene and lowly express genes of other lineages. The antibody staining result shows that mpl is eGFP⁺Not co-expressed with myeloid or hemoglobin. With the known CD41 eGFP⁺Comparison of cells, mpl: eGFP⁺The cells of (a) express the platelet marker gene more highly.

③ Damage experiments showed that mpl: eGFP in case of injury⁺The cells of (a) can reach the wound as one of the functional manifestations of the platelet. Stimulation with Tpo, mpl: eGFP⁺In response to Tpo signaling, exhibit a significantly elevated state.

④ drug treatment experiments showed that following administration of the thrombocythemia drug interleukin-11 treatment, mpl: eGFP was expressed⁺Increase cells, and prove the effectiveness of the thrombocytosis medicine.

The application can well show the advantages of real-time observation of the zebra fish, specifically marks the platelet, and provides a good animal model for later platelet development research, related disease research and clinical drug screening for increasing the number of platelets.

In the present application, the Tg (mpl: eGFP) transgenic zebrafish line is capable of specifically labeling zebrafish platelet precursor cells and platelets as green. The transgenic line has stable genetic platelet fluorescent marker, and may be used in developing platelet producing, differentiating, maturing, function, thrombus forming, various disease mechanism related to platelet and medicine screening.

The obtained Tg (mpl: eGFP) transgenic zebra fish is found to have the following application that ① green fluorescence specifically marks zebra fish platelets, ② fluorescence signals appear from 2 days after fertilization of zebra fish embryos, and are gradually increased thereafter, ③ the transgenic line becomes a transgenic zebra fish line which is most specifically marked with platelets so far, and an extremely simple tool is provided for development, function and drug screening of the platelets.

The term "dpf" as used herein refers to the number of days after fertilization. For example, "3 dpf" refers to the third day after fertilization and "8 dpf" refers to the eighth day after fertilization. The term "hpf" as used herein refers to the number of hours after fertilization. For example, "72 hpf" refers to 72 hours after fertilization.

The term "GFP" as used herein⁺"refers to cells that have green fluorescence.

The terms "wild type" or "WT" as used herein both refer to wild type zebrafish.

Drawings

FIG. 1: obtaining zebra fish mutant mpl by TALEN targeted gene knockout technology^smu40Is a thrombocytopenic mutant

(A) TALEN targeting gene knockout design scheme, zebrafish mpl gene transcript mpl-001(ENSDART00000124917), No. 1 exon sequence is selected as target spot for gene knockout. (B) Obtaining mutant mpl by sequencing^smu40Mutation at the target site sequence-8 bp +48bp, and premature termination of the Mpl protein after mutation, deletion of important functional regions. (C) Results of immunochemical staining. The tail signal point is CD41 eGFP^highLabeled mature platelets. Mutant mpl^smu40In the middle, the signal points decreased significantly, indicating a significant decrease in the number of mature platelets. (D) WISH detection of wild-type sibling fish and mutant mpl^smu40Mpl Gene expression, mutant mpl^smu40The mRNA expression amount of the middle mpl gene is obviously reduced. The tail part local magnification frame is 100 multiplied by magnification. (E) Results of the expression amount of mRNA of the platelet-related gene, the black column represents the wild type sibling fish, and the gray column represents the mutant mpl^smu40. The mRNA expression levels of these genes in the mutant mpl are shown on the abscissa^smu40All are significantly down-regulated (30 n per group). Statistical differences were determined by t-test with no significant differences in ns,. P<0.05，**P<0.01，***P<0.001。

FIG. 2: zebra fish mutant mpl^smu40The blood coagulation dysfunction is shown in the blood coagulation experiment

(A) The tail blood vessels of the zebrafish embryos were needled at 3dpf, and shown as wild type synephrine tails (WT, left column) and mutant (mpl) in the tail field when blood flow stopped^smu40Right column), mutant mpl^smu40The amount of bleeding is large and the wound has a large clot. (B) Coagulation experiments treatment of wild type synechocystis and mutant mpl^smu40At least 10 of each group were observed microscopically for the time from the onset of injury to the cessation of bleeding. Treatment at 3dpf and 6dpf respectively, statistical analysis of blood coagulation duration, mutant mpl^smu40The tail blood vessel clotting time is significantly longer than that of wild type siblings (n.gtoreq.10 in each group). Statistical differences were determined by t-test with no significant differences in ns,. P<0.05，**P<0.01，***P<0.001。

FIG. 3: interleukin-11 (IL-11) can effectively increase mutant mpl of zebra fish^smu40Platelet count of

(A) The upper panel shows the mutant mpl without IL-11 injection^smu40Control group, bottom panel shows mutant mpl after IL-11 injection^smu40Treatment groups, signal points shown as CD41: eGFP^highRepresents the number of platelets. Mutant mpl following IL-11 injection^smu40The signal points are increased significantly. (B, C) for wild-type and mutant mpl^smu40IL-11 injection was performed simultaneously, black columns represent the control group (distilled water only injection), and gray columns represent the IL-11 injection group (IL-11 injection). (B) The results in (a) show that the injection of IL-11 increases the mRNA expression level of the cd41 gene in wild type sibling fish by about 40% relative to the control group (P ═ 0.016); (C) the results show that injection of IL-11 results in mutant mpl^smu40The expression level of cd41 gene mRNA was increased by about 97% relative to the control group (P ═ 0.005). The results indicate that the mutant mpl^smu40In response to treatment with IL-11, and compared to its effect in wild type siblings, IL-11 is able to elevate mutant mpl significantly more^smu40The number of platelets.

FIG. 4: obtaining of pTol2-mpl promoter-eGFP transgenic zebrafish Using the Tol2 transposon mediated technique

(A) Tol2 transposon mediated technology design scheme, selecting zebrafish mpl gene transcript mpl-201(ENSDART00000057297), exon II ATG sequence, and using forward 4641bp as mpl promoter region. (B) The upper small picture marks the hemopoietic part of zebra fish in embryonic period. AGM, aortic-gonadal-mesonephros; CHT: tail blood island; FIG. 2.5dpf AGM region of wild type embryos and a schematic representation of the in situ hybridization of the mpl gene at the 2.5dpf and 5dpf CHT regions; the right side shows the result of GFP antibody staining of Tg (mpl: eGFP) embryos. The results of the expression sites were the same. (C) Results of GFP co-staining with Lcp1 (myeloid cell expressing gene) antibody in Tg (mpl: eGFP) embryos, supra: red color Lcp1⁺A cell, wherein: green is GFP⁺Cells, see below: graphic representation of the two superimposed together, without any overlapping cells, indicating that cells with Lcp1 not co-expressed with GFP, i.e., cells of GFP unlabeled myeloid lineage (D) were co-stained with antibodies to Hbae1(α hemoglobin, labeling all mature red blood cells) in Tg (mpl: eGFP) embryos stained red for Hbae1⁺A cell, wherein: green is GFP⁺Cells, the following: the results are without any overlapping cells, as shown by the superposition of the two. Indicating that the cells in which Hbae1 is not co-expressed with GFP, i.e., the mature erythrocytes were not labeled with GFP. (E) The Tg (mpl: eGFP) and Tg (coronin1a: eGFP) embryos of example 5 of the present application were separately subjected to GFP flow cytometric sorting, in which coronin1a labeled all myeloid linesA cell. Both GFP⁺And (5) carrying out qPCR detection on the cells. Results show mpl-GFP⁺Cells with coronin1a-GFP⁺In contrast to the cells, the platelet gene cd41 is highly expressed, while the gene expressed by the myeloid cells is low or absent. (F) Tg (mpl: eGFP) and Tg (gata1: DsRed) embryos were subjected to green fluorescent GFP and red fluorescent DsRed flow cell sorting, respectively, with gata1 labeling all erythroid cells. Both GFP⁺And DsRed⁺And (5) carrying out qPCR detection on the cells. Results show mpl-GFP⁺Cells with gata1-DsRed⁺In contrast to the cells, the platelet genes cd41 and lrrc32 were highly expressed, while the hemoglobin genes (hbbe1, hbae1) were less expressed (n ═ 30 per group). Statistical differences were determined by t-test with no significant differences in ns,. P<0.05，**P<0.01，***P<0.001. (G) Tg (mpl: eGFP) and Tg (CD41: eGFP) embryos were separately subjected to GFP flow cytometric sorting, with CD41 labeling zebrafish hematopoietic stem cells and platelet cells. Both GFP⁺And (5) carrying out qPCR detection on the cells. Results show mpl-GFP⁺Cells and CD41-GFP⁺The cells, although all highly expressing the platelet marker genes (from left to right: gp9, kif1b, lrrc32, nfe2), are mpl-GFP⁺Cell specific CD41-GFP⁺Expression in cells is significantly higher.

FIG. 5: tg (mpl: eGFP) transgenic zebrafish marker cells are platelet cells and can respond to a lesion response as well as Tpo and interleukin-11.

(A) Vascular injury experiments were performed in 4dpf Tg (mpl: eGFP) embryos with neck vessels as the injury site, GFP⁺The cells respond to the injury and can reach the injury site, which is one of the platelet functions. (B) Microinjection of tpo mRNA in Tg (mpl: eGFP) embryos, 3dpf embryos, showed that GFP antibody staining significantly increased the amount of GFP in tpo mRNA-injected embryos⁺The number of cells of (a). (C) At a thrombocytopenic mpl compared to wild type Tg (mpl: eGFP) of a sibling fish that has been transferred to a Tg (mpl: eGFP) transgenic background^smu40(ii) a mpl-GFP in Tg (mpl: eGFP) mutants⁺The cells were significantly reduced. (D) Interleukin-11 can significantly increase mpl-GFP in Tg (mpl: eGFP)⁺CellsNumber of the cells. N is more than or equal to 10 in each group, the statistical difference is obtained by t-test, ns has no significant difference, P<0.05，**P<0.01，***P<0.001。

Other aspects will be apparent upon reading and understanding the attached drawings and detailed description.

Detailed Description

The present application is described in further detail below by way of examples to enable those skilled in the art to practice the present application. It is to be understood that other embodiments may be utilized and that changes may be made without departing from the spirit or scope of the present application. To avoid detail not necessary to enable those skilled in the art to practice the application, the description may omit certain information known to those skilled in the art. The following detailed description is, therefore, not to be taken in a limiting sense, and the scope of the present invention is defined only by the appended claims.

The following examples are presented to facilitate a better understanding of the present application and are not intended to limit the scope of the present application.

The respective raw materials used in the following examples are commercially available except for those specifically mentioned.

Materials and methods

TALEN targeting gene knockout technology

The TALEN target spot recognition module is constructed by Beijing Weishanglide biotechnology limited, and the target gene knockout can be realized by injecting TALEN plasmid pairs into zebra fish embryo single cells through a microinjection method⁷. In the experiment, a zebra fish mpl gene transcript mpl-001 is designed, a sequence TTTGGGATGCACCT (SEQ ID NO:1) on the first exon is used as a TALEN interval region, target recognition TALEN module plasmids on the left side and the right side are synthesized, and directional knockout is carried out on the target recognition TALEN module plasmids.

Tol2 transposon mediated technology

The promoter sequence is obtained from NCBI, and 4641bp forward from the transcription of the zebra fish mpl gene until the second exon ATG sequence of mpl-201 is used as the mpl promoter region. The promoter sequence and the eGFP sequence are connected with the transposon sequence, cloned and transformed, and finally, pTol2-mpl promoter-eGFP plasmid is prepared.

Zebra fish mutant screening

The first generation mutant obtained by TALEN microinjection is F0 generation, each F0 generation individual is hybridized with wild type to obtain F1 generation, F1 generation fish tail-cutting sequencing is carried out to obtain mutant with different sequence insertions or deletions, phenotype screening is carried out by utilizing whether mpl in situ hybridization signals are reduced or not and whether CD41: GFP fluorescence signals are reduced or not, and the mpl of target point interval region sequence mutation (-8bp +48bp) (TTTGAAAAGACTTTGAAGACTTGAAAAGACTTTTGCTTTTGAAAAGACTTTGCT) (SEQ ID NO:2) is obtained through sequencing^smu40Mutant zebrafish.

Zebra fish transgenic line screening

The first generation of mutants obtained by pTol2-mpl promoter-eGFP microinjection is F0 generation, F0 generation selects embryos which are provided with fluorescent markers and have correct fluorescent expression positions from 3dpf to 4dpf, and each GFP is used⁺F0 generation individual is cultured until the individual is mature, the F1 generation is obtained by hybridization with wild type, and whether the F1 generation 3-4dpf embryo is stable genetic fluorescence labeling is detected. And obtaining the transgenic zebra fish strain Tg (mpl: eGFP) of stably inherited marked zebra fish platelets by fluorescent marker phenotype screening.

Breeding and reproduction of zebra fish

Wild type, mutant mpl^smu40Zebra fish and transgenic Zebra fish lines Tg (mpl: eGFP) were cultured as described in the prior art⁸. For all experiments mentioned herein, zebrafish embryos were placed in embryo culture broth containing 0.003% Phenylthiourea (PTU) and 0.002% methylene to remove embryo pigments.

Whole In Situ Hybridization (WISH)

The synthesis and WISH operation of digoxin-labeled antisense RNA probe are completed according to the standard experimental operation flow⁹. The mpl probe sequence used was:

AACAGCAGGTGACATAGAGTTCAGGTGCCACACTTCTGATCTGATTCAAATCATTTGCAAATGGAGGGGAGACTTATATAAGGACAATACATACAGCTTCTACTATAAACAATTAAACAGAAGTTCATGGAGCAGTTGGAAGTTGTGTCCCAATTGCAATAACTCCATCCATCAGTGTGTCCTGTATGGCCAGAAGTCCAATGTCTTTAAGTTTTACCTCAATACAGGGTTGCAACCATTCAGCCGAACATTTTATGCAGAGACTTTCTATATGAACAGTAAAGTTCAGACAAGGCCTCCAGAAGGTCTGAAGGTACAGATTGGGGAAGAAAGGCTTTGTTTGACATGGGATTCACCATTTCTGATCATTTCTAAGCATCTAATGTACCAGATCCGTTATCAGCATCATGAAGAGAATCAGTGGAAGGGTTTTAAAGCTTCTGGATCCAAGACCAGCACTTGTCTAGATGTGCACAGAGGGGGTCGATACACCATCCAGGTTCGAGCACAACCCAATGGATCTGTGTACAGCGGAAACTGGAGTGACTGGTCAAAACCTGTTACAACCAACCTACCTTTAAGCAAAGAGTGGATTATTTTTGTTTGCATACCAGTGGCTCTGATCATCATTGCAACTGCAGTCATCTCTTTCTTCTCCAGATACTTCCGAAAGGTCAAGAGGTCCCTGTGGCCACCAGTACCAAACCTTAACAAGGTCCTGGAAAACATCCTGACTGATATCAGTGGATCACACTGGGAGCCAACCTTCAACATTAAGCAATGTGATGATGACACTGCTACATCAGTGGTGGAGGTTCTCACTGAGGGGGAATCTGCGGTCAAAACCTGTAAGAACACCTGTCCTCTGCTCTCTGAGCACAGTGAAAAACATGGAGAACATTTCAGAGAGGACTTGGAAATGGCGCAAGATTATGTGATTTTGAACAACAATATAATCCCCTGCCTTACGGGAAACGACTACGTGTATAAGGATGTTGCTTCAACACATCTGGCCAATGAAAAACAACACTCTTGCTCCAGCACTTCTTACACCTCCCTACCAGATCACACCACAGATATTCTCAACCAATCCTATCTCCTTTTGGCAGAACAATCCGATCTTGGGGCGTATCAAACAACCTGTGGCCAGTACACCAATCTGGAGATCACAGCAGTATCATGTGTAGCAATTGGAGAGTGAGGTTTACTGTCAAAATGAAGCTCATAATCATGTATATATTAAGGGTTCTCTCACAAATGTAAAAAAGACATTCAGTTTCTGTGGAATGAATGAGAAACAAAGGAAAAGCAAAGCTTACGTTAATGGAGCACTTATGAAGGTAATC(SEQ ID NO:17)。

immunochemical staining (Immunochemistry staining)

Anti-GFP Antibody (Biotin) (ab6658) primary Antibody (purchased from abcam, Inc.), Donkeyanti-Goat IgG (H + L) Secondary Antibody, Alexa

488conjugate secondary antibody (purchased from Invitrogen corporation), donkey anti-rabbitAlexa-555 (purchased from Invitrogen), and Lcp1 and Hbae1 primary antibodies (presented by hong Kong university of science and technology)¹⁰The mutant mpl^smu40Mating with transgenic Zebra fish Tg (CD41: eGFP)⁴Thus obtaining a mutant mpl with a Tg (CD41: eGFP) transgenic background^smu40. Subjecting it to immunochemical staining, procedures such as are known in the art¹¹(ii) a The zebra fish line with Tg (mpl: eGFP) transgenic background is subjected to immunochemical staining by the same method, and the thin line with high-brightness green fluorescence is observed under a fluorescence microscopeCells, the number of which will represent the number of platelet cells.

qRT-PCR

Total RNA from zebrafish embryos was extracted using Roche Tripure RNA Isolation Reagent (purchased from Roche Inc.), whose procedures were performed according to the relevant instructions.M-MLV reverse transcriptase (Promega) was used to prepare cDNA, whose procedures were performed according to the relevant instructions.qRT-PCR was performed using zebrafish gene β -actin as an internal reference, as is known in the art¹²。

qRT-PCR primer sequences

Blood coagulation test on the tail of zebra fish

Tail clotting experiments were performed on zebrafish embryos 72 to 84 hours after fertilization using a 0.03mm diameter microinjection needle (born glass calillaries 1B100F-4, available from World Precision Instruments Inc) as the trauma instrument. Zebrafish embryos were anesthetized in embryo culture medium containing 0.02% tricaine (tricaine) and then placed on agarose plates. Needle lesions were made from the area of the vessels inside the tail using microinjection. The number of wild type siblings and mutant mpl^smu40More than 110 each. The time was measured under a microscope, and bleeding stopped from the beginning of the lesion to the formation of a clot.

Drug experiments

Recombinant human interleukin-11 for megakaryocyte injection produced by Qilu pharmaceutical Co., Ltd is selected, and 48-52hpf zebra fish embryos after fertilization are selected for medicine injection. Selecting the surface blood vessel of neck or yolk sac for injection. The concentration was 6. mu.g/. mu.L and approximately 5ng was administered per embryo. One day after observation, the zebrafish embryos were subjected to platelet counting.

Zebra fish neck coagulation test

A4 dpf post-fertilized zebrafish embryo was used for a cervical coagulation test using a 0.03mm diameter microinjection needle (born glass calillaries 1B100F-4, available from World Precision Instruments Inc.) as a lesion tool. Zebrafish embryos were anesthetized in embryo culture medium containing 0.02% tricaine (tricaine) and then placed on agarose plates. Needle lesions were made from the upper vascular area of the neck yolk sac by microinjection. The number is more than 10. Thrombus formation from the beginning of the injury to the time the platelets reach the injury was monitored under a microscope.

Tpo experiment

Selected from mMSSAGE mMACHINE SP6Kit (AM1340)

Company, in vitro synthesized tpomRNA, selected Tg (mpl: eGFP) zebrafish embryos at 1 cell stage after fertilization, and subjected to single cell microinjection. The concentration was 800 g/. mu.L, and about 400pg per embryo was used. After 3 days of observation, zebrafish embryos were stained with GFP antibody.

Flow cytometric sorting

Selecting zebrafish of each transgenic line, namely Tg (mpl: eGFP) and Tg (coronin1a: eGFP)¹⁰Whole myeloid cell-specific markers transgenic lines, Tg (gata1: DsRed)¹³Total erythroid cell-specific marker transgenic line, Tg (CD41: eGFP)⁴Labeling transgenic zebra fish with blood platelet and hematopoietic stem cell, performing green fluorescence or red fluorescence cell sorting experiment on more than 200 zebra fish embryos of each transgenic line at 4dpf period, and making reference to the specific method of the experiment¹⁴。

Example 1 obtaining of mutant Zebra fish with deletion of mpl Gene sequence

In the experiment, a zebrafish Mpl gene transcript Mpl-001ENSDART00000124917 is designed, a sequence TTTGGGATGCACCT on the first exon is used as a TALEN interval region, target spot recognition TALEN module plasmids on the left side and the right side are synthesized and directionally knocked out, and a mutant Mpl which deletes 8bp of deletion and is inserted with 48bp of Mpl protein and terminates in advance is obtained^smu40(see FIG. 1A, FIG. 1B).

mpl geneExpression of

To examine the effectiveness of the mutation, mpl was used as a marker gene for labeling platelets and platelet precursor cells. Detection of wild type siblings and mpl at 3dpf by in situ hybridization^smu40mRNA expression of the mpl gene in the mutant.

The results are shown in FIG. 1D, with signal points representing mRNA expression for the mpl gene. The results show that the mutant mpl^smu40The mRNA expression level of the mpl gene in the fish is obviously reduced compared with that of wild type sibling fish.

Example 2 the mutant zebrafish of example 1 of the present invention can be used as an animal model for thrombocytopenia

Number of platelets

Taking 5dpf zebra fish embryo, and adding mutant mpl^smu40Mating with transgenic Zebra fish Tg (CD41: eGFP)⁴Mutants with a Tg (CD41: eGFP) transgenic background were obtained. Wild type siblings were treated in the same way. For mpl with Tg (CD41: eGFP) transgenic background^smu40The mutant and wild type sibling fish are subjected to immunochemical staining, bright fluorescent cells in platelets flowing in blood are observed under a fluorescence microscope, and the signal point is CD41: eGFP^highThe number of signal points in (c) will represent the number of platelet cells.

The results are shown in FIG. 1C, mpl^smu40The number of platelets in the mutant is greatly reduced compared with that in the wild type sibling fish.

mRNA expression of multiple platelet-associated genes

Selecting mpl, cd41, lrrc32, gp1bb, fog1 and nfe2 which have been reported to be related to the platelet^15-18For 5-dpf wild type sibling fish and mutant mpl^smu40Carrying out fluorescence quantitative PCR experiment on zebra fish embryos. Of these genes, Lrrc32 and Gp1bb are both platelet membrane proteins; fog1 and Nfe2 are transcriptional regulators associated with mammalian megakaryocyte production and maturation.

The results are shown in FIG. 1E, indicating that these genes are present in mutant mpl^smu40The mRNA level in the fish is obviously lower than that in the wild type sibling fish,description of the mutant mpl^smu40Indeed, it is a thrombocytopenic mutant.

In summary, the above results show that in mutant mpl^smu40In (c), the number of platelets decreased significantly due to the knockout of the mpl gene. Thus, mpl of example 1 of the invention^smu40The mutant can be used as an animal model of thrombocytopenia.

Example 3. construction of a coagulation dysfunction model caused by thrombocytopenia was performed using the mutant zebrafish of example 1 of the present invention.

Due to the mutant mpl^smu40The mutant is shown as thrombocytopenia, so that the mutant can be used for researching the effect of the thrombocyte on stopping blood coagulation of the zebra fish, and further constructing an experimental model of the zebra fish blood coagulation dysfunction¹⁹. Firstly, using 3dpf zebra fish embryo with at least 10 pieces in each group, respectively carrying out comparison on wild type sib fish group and mutant mpl^smu40The zebrafish of the group were subjected to tail vascular needle-stick injury, the wound clot size after vascular injury was observed by 20 times under an optical microscope, and the time from the time of injury starting bleeding to the time of bleeding stopping for each zebrafish embryo was recorded.

FIG. 2A shows the size of a wound clot after vascular injury, with wild type sibling fish on the left and mutant mpl on the right^smu40The mpl can be obviously distinguished compared with the wild type synechocystis^smu40The mutant has more bleeding from the wound after being damaged, and the blood clot formed nearby the wound is larger. Specific experimental data for clotting time are shown in the following table. Experiments were performed on 3-dpf and 6-dpf zebrafish, respectively, and two sample t-tests were performed on the data to determine the wild type sib group and mutant mpl^smu40Whether there is a significant difference between the two groups. The results are shown in FIG. 2B, which is a statistical plot of the length of clotting time for each group. mpl^smu40The clotting time of the mutant was significantly longer than that of the wild type siblings.

The above results show that mpl^smu40The mutant can be used as coagulation work caused by thrombocytopeniaCan be used as a barrier model for subsequent research.

Example 4 screening of drug candidates Using the mutant Zebra fish of example 1 of the present invention

Due to mpl^smu40The mutant shows thrombocytopenia, so the common clinical medicines aiming at thrombocytopenia are selected for carrying out the medicine treatment. IL-11 was selected, which has the effect of increasing platelets by increasing the proliferation of blood lineage progenitor cells. As shown in FIG. 3A, one day after IL-11 injection, the number of platelets in the mutant was observed. The control group (distilled water only) in the upper panel and the IL-11 group in the lower panel, CD41: eGFP is clearly seen^highThe number of signal points increases. Quantitative analysis was also performed using qPCR experiments, and the results are shown in FIGS. 3B-C for wild type siblings and mutant mpl^smu40After IL-11 injection, the expression level of CD41 gene mRNA was up-regulated, but in the mutant mpl^smu40Up-regulation fold in (b) was significantly greater by 97% (P ═ 0.005) compared to 40% (P ═ 0.016) in wild-type siblings. The results of FIGS. 3B-C illustrate that the mutant mpl^smu40In response to treatment with IL-11, and compared to its effect in wild type siblings, IL-11 is able to elevate mutant mpl significantly more^smu40The number of platelets.

The above results show that mpl of the present invention can be utilized^smu40The mutant is used as an animal model for carrying out drug screening on candidate therapeutic drugs aiming at the thrombocytopenia caused by the defect of the mpl gene.

Example 5 acquisition of Tg (mpl: eGFP) transgenic Zebra fish

In the experiment, until an mpl-201 exon II ATG sequence of zebra fish mpl gene transcript is designed, 4641bp forward is used as an mpl promoter region, the sequence (SEQ ID NO:30) is inserted into pTol2 transposon plasmid to synthesize pTol2-mpl promoter-eGFP, and gene insertion is carried out on wild zebra fish embryo DNA to obtain a transgenic zebra fish line Tg (mpl: eGFP) capable of specifically marking platelets.

FIG. 4A shows the design of the Tol2 transposon-mediated technology. FIG. 4B, top panel, shows a schematic representation of the embryonic hematopoietic site of zebrafish, wherein AGM is aortic-gonadal-mesonephron; CHT: tail blood island. In the lower panel, the results of in situ hybridization of the mpl gene in the 2.5-dpf AGM region and the 2.5-dpf and 5-dpf CHT regions of the wild-type embryos are shown on the left, and the results of staining with GFP antibody for transgenic zebrafish line Tg (mpl: eGFP) embryos are shown on the right. The results of the expression sites were the same, indicating that the fluorescence expression site of GFP is indeed the site of mpl gene expression.

The above results indicate that a transgenic zebrafish line Tg (mpl: eGFP) was obtained.

Example 6 study of the characteristics of the transgenic Zebra fish of example 5 of the invention

mpl does not label mature red blood cells and myeloid cells

4dpf of zebrafish embryo Tg (mpl: eGFP) was taken, immunochemical staining was carried out, and Lcp1 (myeloid cells) was observed under a fluorescent microscope²⁰And Hbae1 (mature red blood cells)²¹As a result of staining, signal points are Lcp1, Hbae1 and mpl-GFP⁺The number of signal points in (c) will represent the number of each type of cell.

The results are shown in FIGS. 4C-D, where cells co-expressed with mpl and lcp1 or with hbae1 were absent from Tg (mpl: eGFP) transgenic zebrafish embryos. It is shown that in the Tg (mpl: eGFP) transgenic zebrafish line Tg (mpl: eGFP) of the present invention, myeloid cells and mature erythrocytes were not specifically labeled.

⁺Compared with the existing zebra fish transgenic line, the mpl-GFP cell has high expression of the platelet marker gene and low expression Other lineage genes.

Using mpl as a marker gene for labeling platelets and platelet precursor cells, coronin1a as a marker gene for labeling myeloid cells, gata1 as a marker gene for labeling all erythroid cells, and flow cytometric sorting technique, Tg of 4dpf was measured (coronin1a: eGFP)¹⁰，Tg(gata1:DsRed)¹³，Tg(CD41：eGFP)⁴And DsRed in Tg (mpl: eGFP) of example 5 of the present invention⁺Cells and GFP⁺mRNA expression of (1).

The results are shown in FIGS. 4E-F, GFP in Tg (mpl: eGFP)⁺The cells of (2) all highly express the platelet gene (cd41, l)rrc32), low or no expression of myeloid genes (mpo, lyz, mfap4)^22-24And hemoglobin gene (hbbe1, hbae1)²¹. The results show that mpl does not label mature red blood cells and myeloid cells.

Further, gp9, lrrc32, kif1b, nfe2 are selected^15,17,18,25These prior art documents report platelet-associated genes for 4-dpf Tg (CD41: eGFP)⁴And the Tg (mpl: eGFP) zebra fish embryos of the embodiment 5 are respectively subjected to green fluorescent protein GFP flow sorting, and the cells obtained by sorting are subjected to a fluorescent quantitative PCR experiment.

The results are shown in FIG. 4G, which shows that these platelet-associated genes are present in mpl-GFP⁺Has a cell specific ratio of CD41-GFP⁺Shows significantly higher expression in the cells of (1), indicating that the Tg (mpl: eGFP) transgenic zebrafish of example 5 of the invention is indeed a transgenic zebrafish that is more specifically labeled with platelets.

Example 7 construction of a coagulation model and a Tpo and interleukin-11 proliferation platelet response mechanism using the transgenic zebrafish of example 5 of the present invention.

The transgenic zebra fish can well fluoresce and visually mark the platelets, so that the transgenic zebra fish can be used for researching the effect of the platelets on the blood coagulation prevention of the zebra fish, and a zebra fish blood coagulation experimental model is constructed¹⁹. Firstly, 4dpf zebra fish embryos are used, at least 10 zebra fish embryos are per group, neck vascular needle puncture injury is carried out on the Tg (mpl: eGFP) transgenic zebra fish embryos of the embodiment 5, and GFP after vascular injury is observed by 64 times under an optical microscope⁺Whether the cells reached the lesion.

As shown in FIG. 5A, mpl-GFP following vascular injury⁺The cells of (a) can reach the lesion as one of the functions of platelets, the left figure is 1min after the lesion, the right figure is 3min, and the thrombus area is larger than that of the 1min thrombus area in 3min, which shows that the thrombus area increases with time.

Since the main production pathway of platelets is Tpo/Mpl, when Tpo is administered, platelets proliferate in large amounts in response to Tpo²⁶. By immunofluorescence staining technique, after injection of tpo mRNA in Tg (mpl: eGFP), the observationInspection of mpl-GFP⁺Whether the number of cells in (a) will increase significantly.

As shown in FIG. 5B, the single cell stage Tg (mpl: eGFP) was microinjected with tpo mRNA and 3dpf Tg (mpl: eGFP) zebrafish embryo GFP was detected⁺Cell proliferation conditions. The results show that Tpo enables GFP⁺The number of cells is increased significantly.

Mutant zebrafish mpl of the invention example 1 was utilized^smu40We observed mpl-GFP in the thrombocytopenia model⁺Whether cells will be reduced.

As shown in FIG. 5C, mpl was detected by immunofluorescence staining technique^smu40(ii) a Tg (mpl: eGFP) (mpl from example 1^smu40The homozygous mutant was crossed with the Tg (mpl: eGFP) transgenic line zebrafish of example 5, and its progeny were screened for the presence of mpl^smu40A zebrafish line with a genetic mutation and a Tg (mpl: eGFP) transgenic background was designated as mpl^smu40(ii) a Tg (mpl: eGFP)) 4-dpf zebrafish embryo GFP⁺Statistical results of the comparison of cells with wild type siblings that have been transformed with a background of the Tg (mpl: eGFP) transgene show that GFP is present⁺The number of cells was significantly reduced.

We also investigated whether interleukin-11, one of the platelet-increasing drugs, can also act on Tg (mpl: eGFP) such that GFP⁺Increase in number of cells.

As shown in FIG. 5D, GFP was detected in IL-11-injected zebrafish embryo Tg (mpl: eGFP) by immunofluorescence staining technique, compared to control group⁺The cells are remarkably increased, and the result shows that the Tg (mpl: eGFP) transgenic zebra fish can be used as a platelet drug screening model.

The above results show that the Tg (mpl: eGFP) transgenic line can be used as a visualization model of the platelet-specific marker, which is beneficial to subsequent research.

Therefore, any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the protection scope of the present application.

Reference to the literature

1.Orkin SH,Zon LI.Hematopoiesis:an evolving paradigm for stem cellbiology.Cell.2008；132:631-644.

2.Stoletov K,Klemke R.Catch of the day:zebrafish as a human cancermodel.Oncogene.2008；27:4509-4520.

3.Suzanne R,Heaton WL,Deepa J,et al.Zebrafish screen identifies novelcompound withselective toxicity against leukemia.Blood.2012；119:5621-5631.

4.Lin HF.Analysis of thrombocyte development in CD41-GFP transgeniczebrafish.Blood.2005；106:3803-3810.

5.Peeters K,Stassen J,Collen D,Van Geet C,Freson K.Emergingtreatments for thrombocytopenia:Increasing platelet production.Drug DiscovToday.2008；13:798-806.

6.

Thrombocytopenia in the newborn.Curr Opin Pediatr.1992；88:217-218.

7.Huang P,Xiao A,Zhou M,Zhu Z,Lin S,Zhang B.Heritable gene targetingin zebrafish using customized TALENs.Nat Biotechnol.2011；29:699-700.

8.Westerfield M.The zebrafish book:a guide for the laboratory use ofzebrafish(Danio rerio):M.Westerfield；2007.

9.Thisse C,Thisse B.Thisse,C.&Thisse,B.High-resolution in situhybridization to whole-mount zebrafish embryos.Nat.Protoc.3,59-69.NatureProtocol.2008；3:59-69.

10.Li L,Yan B,Shi YQ,Zhang WQ,Wen ZL.Live Imaging Reveals DifferingRoles of Macrophages and Neutrophils during Zebrafish Tail Fin Regeneration.JBiol Chem.2012；287:25353-25360.

11.Jin H,Sood R,Xu J,et al.Definitive hematopoietic stem/progenitorcells manifest distinct differentiation output in the zebrafish VDA andPBI.Development.2009；136:1397.

12.Wang K,Fang X,Ma N,et al.Myeloperoxidase-deficient zebrafish showan augmented inflammatory response to challenge with Candida albicans.FishShellfish Immun.2015；44:109-116.

13.Yaqoob N,Holotta M,Prem C,Kopp R,Schwerte T.Ontogeneticdevelopment of erythropoiesis can be studied non-invasively in GATA-1:DsRedtransgenic zebrafish.Comparative Biochemistry and Physiology Part A:Molecular&Integrative Physiology.2009；154:270-278.

14.Du L,Xu J,Li X,et al.Rumba and Haus3are essential factors for themaintenance of hematopoietic stem/progenitor cells during zebrafishhematopoiesis.Development.2011；138:619-629.

15.LANG MR,GIHR G,GAWAZ MP,M LLER II.Hemostasis in Danio rerio:is thezebrafish a useful model for platelet research？J Thromb Haemost.2010；8:1159-1169.

16.Timme-Laragy AR,Karchner SI,Franks DG,et al.Nrf2b,Novel ZebrafishParalog of Oxidant-responsive Transcription Factor NF-E2-related Factor 2(NRF2).J Biol Chem.2012；287:4609-4627.

17.Amigo JD,Ackermann GE,Cope JJ,et al.The role and regulation offriend of GATA-1(FOG-1)during blood development in the zebrafish.Blood.2009；114:4654-4663.

18.O'Connor MN,Salles II,Cvejic A,et al.Functional genomics inzebrafish permits rapid characterization of novel platelet membraneproteins.Blood.2009；113:4754-4762.

19.Jagadeeswaran P,Liu YC.A hemophilia model in zebrafish:analysis ofhemostasis.Blood Cells Mol Dis.1997；23:52-57.

20.Jin H,Sood R,Xu J,et al.Definitive hematopoietic stem/progenitorcells manifest distinct differentiation output in the zebrafish VDA andPBI.Development.2009；136:1397.

21.Alison B,Candace H,Oates AC,et al.Characterization of embryonicglobin genes of the zebrafish.Dev Biol.2003；255:48-61.

22.Berman JN,Kanki JP,A Thomas L.Zebrafish as a model formyelopoiesis during embryogenesis.Exp Hematol.2005；33:997-1006.

23.Lieschke GJ,Oates AC,Crowhurst MO,Ward AC,Layton JE.Macrophages inembryonic and adult zebrafish:morphologic and functionalcharacterization.Blood.2001；98:3087-3096.

24.Zakrzewska A,Cui C,Stockhammer OW,Benard EL,Spaink HP,MeijerAH.Macrophage-specific gene functions in Spi1-directed innateimmunity.Blood.2010；116:e1-e11.

25.Shivdasani RA,Rosenblatt MF,Zucker-Franklin D,et al.Transcriptionfactor NF-E2 is required for platelet formation independent of the actions ofthrombopoietin/MGDF in megakaryocyte development.Cell.1995；81:695-704.

26.Svoboda O,Stachura DL,Macho Ova O,et al.Dissection of vertebratehematopoiesis using zebrafish thrombopoietin.Blood.2014；124:220-228.

Claims (18)

1. Use of a mutant zebrafish in the preparation of an animal model for thrombocytopenia, wherein the mutant zebrafish is mpl^smu40Mutant, wherein the mutant zebrafish is mpl of target spacer region sequence mutation TTTGAAAAGACTTTGAAGACTTGAAAAGACTTTTGCTTTTGAAAAGACTTTGCT (SEQ ID NO:2)^smu40And (3) mutants.

2. The use of claim 1, wherein the thrombocytopenia is due to a knockout of the mpl gene.

3. The use of claim 1, wherein the thrombocytopenia is alleviated after treatment with hematopoietic growth factors.

4. The use of claim 3, wherein the hematopoietic growth factor is interleukin-11 (IL-11).

5. Use of a mutant zebrafish in screening for a drug effective for thrombocytopenia, wherein the mutant zebrafish is mpl^smu40Mutant, wherein the mutant zebrafish is mpl of target spacer region sequence mutation TTTGAAAAGACTTTGAAGACTTGAAAAGACTTTTGCTTTTGAAAAGACTTTGCT (SEQ ID NO:2)^smu40And (3) mutants.

6. The use of claim 5, wherein the thrombocytopenia is due to a knockout of the mpl gene.

7. The use of claim 5, wherein the thrombocytopenia is alleviated after treatment with hematopoietic growth factors.

8. The use of claim 7, wherein said hematopoietic growth factor is interleukin-11 (IL-11).

9. The use of claim 5, wherein the screening comprises the steps of:

(a) treating the mutant zebrafish and wild type synephrine control embryos 1 to 2.5 days after fertilization with the same concentration of the candidate drug;

(b) observing the number of platelets after one to two days to determine the therapeutic effect of the drug candidate on the thrombocytopenia.

10. The use of claim 9, wherein the mutant zebrafish and wild type sibling fish control embryos 2 days after fertilization are treated with the same concentration of the drug candidate.

11. A method for screening a drug effective for thrombocytopenia using mutant zebrafish, wherein the mutant zebrafish is mpl^smu40Mutant, wherein the mutant zebrafish is mpl of target spacer region sequence mutation TTTGAAAAGACTTTGAAGACTTGAAAAGACTTTTGCTTTTGAAAAGACTTTGCT (SEQ ID NO:2)^smu40And (3) mutants.

12. The method of claim 11, wherein the thrombocytopenia is due to a knockout of the mpl gene.

13. The method of claim 11, wherein the thrombocytopenia is alleviated after treatment with hematopoietic growth factors.

14. The method of claim 13, wherein the hematopoietic growth factor is interleukin-11 (IL-11).

15. The method of claim 11, wherein the screening comprises the steps of:

(a) treating the mutant zebrafish and wild type synephrine control embryos 1 to 2.5 days after fertilization with the same concentration of the candidate drug;

(b) observing the number of platelets after one to two days to determine the therapeutic effect of the drug candidate on the thrombocytopenia.

16. The method of claim 15, wherein the mutant zebrafish and wild type sib fish control embryos are treated 2 days after fertilization with the same concentration of the drug candidate.

17. Use of a mutant zebrafish in the preparation of an animal model of coagulation dysfunction, wherein the mutant zebrafish is mpl^smu40Mutant, wherein the mutant zebrafish is mpl of target spacer region sequence mutation TTTGAAAAGACTTTGAAGACTTGAAAAGACTTTTGCTTTTGAAAAGACTTTGCT (SEQ ID NO:2)^smu40And (3) mutants.

18. The use of claim 17, wherein the coagulation dysfunction is caused by a knockout of the mpl gene.

Images