CN106399343B - Glutaric acid biology improves synthetic method - Google Patents
Glutaric acid biology improves synthetic method Download PDFInfo
- Publication number
- CN106399343B CN106399343B CN201510456365.XA CN201510456365A CN106399343B CN 106399343 B CN106399343 B CN 106399343B CN 201510456365 A CN201510456365 A CN 201510456365A CN 106399343 B CN106399343 B CN 106399343B
- Authority
- CN
- China
- Prior art keywords
- gene
- seq
- coa
- glutaric acid
- acyl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
A kind of glutaric acid biology improvement synthetic method, by being realized in recombinant host expression in escherichia coli 2-Hydroxyglutarate dehydrogenase, glutaconyl- CoA-transferase, 2- hydroxyl glutaryl coenzyme A dehydratase, trans- enoyl CoA reductase and thioesterase.Fermenting and producing is carried out by the recombination bacillus coli to expression said gene, success detects target product glutaric acid and by-product glutaconate, the generation of 2- hydroxyl glutaric acid in fermentation liquid.Biosynthesis pathway constructed by the present invention is provides a kind of new method using renewable resource synthesizing glutaric acid.
Description
Technical field
The present invention relates to a kind of new glutaric acid route of synthesis, pass through 2-Hydroxyglutarate dehydrogenase, amylene two
The catalysis of sour CoA-transferase, 2- hydroxyl pentanedioyl acyl coenzyme dehydratase, enoyl CoA reductase and acyl-CoA thioesterase enzyme,
The intermediary α-ketoglutaric acid of intracellular tricarboxylic acid cycle is converted to glutaric acid, utilizes glucose or other carbon to realize
The purpose of source fermenting and producing glutaric acid.Clone, coordinate expression specifically related to the gene for encoding these types of enzyme, and recombination are big
Enterobacteria utilizes the application of the catalysis fermenting and producing glutaric acid of these enzymes.
Background technique
Glutaric acid is a kind of important industrial chemicals, it can aggregate into polyamide with the diamines of different length carbochain.As
Engineering plastics, polyamide have excellent performance, are widely used in various industries and field.List of the glutaric acid as polyamide
Body has the very big market demand.Mainly processing refinement obtains industrial glutaric acid from petroleum, in cracked C 5 fraction
Cyclopentadiene is raw material, and cyclopentene is made in partial hydrogenation, and then catalytically oxidizing cyclopentene prepares glutaric acid (Chen Hui et al., petroleum
Chemical industry, 2006,35 (2): 118-121).But it is increasingly in short supply due to petroleum resources, it is desirable to develop more utilizations
The method of renewable resource production glutaric acid.
Adkins et al. has reported raw using glucose in Escherichia coli by the synthesis of coupling lysine and degradation pathway
Produce glutaric acid method, using the approach, the yield and yield that they report at present be respectively 0.82 ± 0.03g/L, 68 ±
2mmol/mol (Adkins et al., Biotechnol Bioeng, 2013,110 (6): 1726-1734).In addition, Djurdjevic
Et al. report the method that glutaconate is produced by the reduction approach of α-ketoglutaric acid.This approach passes through alpha-hydroxypentyl first
α-ketoglutaric acid is converted 2- hydroxyl glutaric acid by two acidohydrogenase HgdH；Glutaconate CoA-transferase GctAB is by 2- hydroxyl
Glutaric acid is converted into 2- hydroxyl glutaryl coenzyme A；In addition, obtaining 2- from Clostridium symbiosum (Clostridium symbiosum)
Hydroxyl glutaryl coenzyme A dehydratase HgdAB is obtained from acidaminococcus fermentans (Acidaminococcus fermentans)
The activity factor HgdC, HgdABC of the dehydratase can convert glutaconyl- coacetylase for 2- hydroxyl glutaryl coenzyme A.Finally
Again by glutaconate CoA-transferase GctAB by glutaconyl- coacetylase catalysis become glutaconate (Djurdjevic et al.,
Appl Environ Microbiol, 2011,77 (1): 320-322).Glutaconate industrially may be used in α and β unsaturation
The method for being further employed chemical catalysis is reduced into glutaric acid, but there has been no in the cell directly convert glutaconate at present
At the method for glutaric acid.On the other hand, using lysine as when substrate synthesizing glutaric acid, every mol substrate can discharge one mole
Carbon dioxide, had lost in this way to carbon (sugar) yield, and will not then release carbon dioxide when α-ketoglutaric acid is as substrate.
Therefore α-ketoglutaric acid approach theoretically has more advantage to sugared yield.
It is found in research before, a kind of trans- 2- enoyl CoA from euglena Euglena gracilis is also
Protoenzyme Ter can be catalyzed 2,3- alkene adipyl coenzyme A reductase at adipyl coacetylase (Yu et al., Biotechnol Bioeng,
2014,111 (12): 2580-2586).And the precursor 2,3- alkene glutaryl coenzyme A and 2,3- alkene adipyl coenzyme of glutaric acid synthesis
A structure is similar, therefore speculates that trans- 2- enoyl CoA reductase Ter may also have catalytic activity to it.
Summary of the invention
The present invention In view of the above shortcomings of the prior art, proposes that a kind of glutaric acid biology improves synthetic method, passes through
Trans- 2- enoyl CoA reductase Ter is expressed, the conversion from α-ketoglutaric acid to glutaric acid may be implemented.
The present invention is achieved by the following technical solutions:
The present invention relates to a kind of glutaric acid biologies to improve synthetic method, first by coding for alpha-hydroxyglutarate dehydrogenase
HgdH, the gctAB for encoding glutaconate CoA-transferase, the hgdABC for encoding 2- hydroxyl glutaryl coenzyme A dehydratase, coding
At least one of ter or encoding acyl CoA thioesterase enzyme of enoyl CoA reductase or at least 50% similar homologous with it
At least one of sequence is expressed in recombinant microorganism, then by recombinant microorganism culture and ferment obtain glutaric acid.
The expression, specific steps include:
1) by coding for alpha-hydroxyglutarate dehydrogenase hgdH, the gctAB of coding glutaconate CoA-transferase, coding
The hgdABC of 2- hydroxyl glutaryl coenzyme A dehydratase, the ter or encoding acyl CoA thioesterase enzyme for encoding enoyl CoA reductase
At least one of tesB or at least one of its at least 50% similar homologous sequence using based on expression plasmid
Heterogenous expression mode, which introduces, realizes self-replacation, i.e. design primer sequence in microbial hosts, with corresponding bacterial strain full-length genome sequence
Column or full genome synthetic DNA are that template is expanded, and with endonuclease digestion and are connected to the expression matter through same endonuclease digestion
On grain carrier；
2) giving corresponding promoter makes foreign gene start transcription.
The expression plasmid is pTrc15C ' and pZS*27MCS, in which: egter gene, hgdH gene, gctA gene
With gctB gene in pTrc15C ' plasmid expression, hgdA gene, hgdB gene, hgdC gene and tesB gene are in pZS*27MCS
Plasmid expression.
The microbial hosts include as the E. coli MG1655 of expressive host and as cloning host
E. coli DH5 α.
The recombinant microorganism refers to: E.coli MG1655 recombination bacillus coli, wherein simultaneous with pTrc15C '-
EgTer-HgdH-GctAB plasmid and pZS*27-HgdABC-TesB plasmid.
The culture first passes around the activation of LB culture medium, is then OD with initial inoculum600=0.1 is linked into supplement
In Stand I culture medium, when 37 DEG C of cell cultures are about 1.0 to OD, 100 μM of IPTG is added and continue to cultivate a couple of days in 30 DEG C.
The supplement Stand I culture medium, the supplement Stand I culture medium of specially pH 7.4, component and content
Are as follows: 15g/L beef peptone, 3g/L yeast extract, 50mM 3- (N- morpholine) propane sulfonic acid, 3mM L-cysteine, 10mM
Sodium glutamate, 0.2mM riboflavin, 2mM ironic citrate.
The culture, including but not limited to aerobic, micro- oxygen and Anaerobic culturel.
The fermentation refers to: when recombination bacillus coli is after taking in nutrients, passing through the glycolytic pathway of cellular endogenous
And nutrients is converted to α-ketoglutaric acid by part krebs cycle pathway, is then successively passed through:
1. under the catalytic action by the Alpha-hydroxy glutatate dehydrogenase HgdH expressed in recombinant microorganism, α -one penta
Diacid is converted into 2- hydroxyl glutaric acid；
2. under the catalytic action of the glutaconate CoA-transferase GctAB expressed by recombinant microorganism, 2- hydroxyl
Glutaric acid is converted into 2- hydroxyl glutaryl coenzyme A；
3. under the catalytic action of the 2- hydroxyl glutaryl coenzyme A dehydratase HgdABC expressed by recombinant microorganism,
2- hydroxyl glutaryl coenzyme A is converted into 2,3- alkene glutaryl coenzyme A；
4. under the catalytic action of the enoyl CoA reductase Ter expressed by recombinant microorganism, a part 2,3- alkene
Glutaryl coenzyme A is converted into glutaryl coenzyme A, remaining 2,3- alkene glutaryl coenzyme A expressed by recombinant microorganism penta
Additional 2,3- alkene-glutaric acid is converted under the catalytic action of enedioic acid CoA-transferase GctAB；
5. the acyl-CoA thioesterase enzyme that glutaryl coenzyme A is expressed by recombinant microorganism turns by catalyzing hydrolysis
Turn to glutaric acid.
The nutrients includes but is not limited to glucose.
The acyl-CoA thioesterase enzyme includes: the acyl-CoA thioesterase enzyme expressed by recombinant microorganism
TesB, acyl-CoA thioesterase enzyme YciA, acyl-CoA thioesterase enzyme TesA, acyl-CoA thioesterase enzyme AcoT7, amino acid sequence
Leie time is as shown in No.8~11 Seq ID.
Technical effect
Compared with prior art, invention is by the way that heterogenous expression is based on α-in the form of plasmid in Escherichia coli
The glutaric acid route of synthesis of ketoglutaric acid, including 2-Hydroxyglutarate dehydrogenase, glutaconate CoA-transferase, 2- hydroxyl penta
Two acyl coenzyme dehydratases, anhydrase incitant, trans- 2- enoyl CoA reductase and acyl-CoA thioesterase enzyme, make large intestine
Bacillus success fermenting and producing glutaric acid.To propose new approach and method using renewable resource synthesizing glutaric acid.For from now on
Further large-scale production glutaric acid provides potentiality.
Detailed description of the invention
Fig. 1 is glutaric acid route of synthesis schematic diagram；
In figure: hgdH indicates that the encoding gene of 2-Hydroxyglutarate dehydrogenase, gctAB indicate the transfer of glutaconate coacetylase
The encoding gene of enzyme, hgdCAB indicate that the encoding gene of 2- hydroxyl pentanedioyl acyl coenzyme dehydratase, ter indicate trans- 2- enoyl CoA
The encoding gene of reductase, tesB indicate the encoding gene of acyl-CoA thioesterase enzyme.
Fig. 2 is plasmid map involved in glutaric acid route of synthesis；
Wherein: Fig. 2 a is the map of plasmid pTrc15C '-egTer-HgdH-GctAB, and Fig. 2 b is plasmid pZS*27-
The map of HgdABC-TesB.
Fig. 3 is the yield of the 48th hour final product and intermediate metabolites in Recombinant E. coli Fermentation Broth supernatant, wherein
Every group of sample has 3 Duplicate Samples.
Specific embodiment
It elaborates below to the embodiment of the present invention, the present embodiment carries out under the premise of the technical scheme of the present invention
Implement, the detailed implementation method and specific operation process are given, but protection scope of the present invention is not limited to following implementation
Example.
Embodiment 1
The building of biosynthesis pathway is the heterogenous expression mode based on expression plasmid, used bacterium in the present embodiment
Strain, plasmid, enzyme and culture medium etc. include: that expression plasmid is pTrc15C '-egTer-HgdH-GctAB and pZS*27-HgdABC-
TesB；Expressive host is E. coli MG1655；Cloning host is E. coli DH5 α；Genetic manipulation work
Tool includes: restriction enzyme, archaeal dna polymerase, T4DNA ligase；LB culture medium: every liter of 10g containing tryptone, yeast extract
Object 5g, sodium chloride 10g, chloramphenicol concentration 50mg/L, kanamycins concentration are 50mg/L, and specific steps include:
1) building of PCR amplification and recombinant plasmid: design primer sequence, with corresponding bacterial strain whole genome sequence or full genome
Synthetic DNA is that template is expanded, and with endonuclease digestion and is connected on the expression plasmid carrier through same endonuclease digestion,
In: egter, hgdH, gctA and gctB are in pTrc15C ' plasmid expression, hgdA, hgdB, hgdC and tesB in pZS*27MCS matter
Grain expression, it is as shown in Figure 2 a and 2 b respectively.
2) expression plasmid carrier is transferred to E. coli DH5 α, screens recombinant plasmid, and carry out sequence verification,
Wherein: hgdH is derived from the 2-Hydroxyglutarate dehydrogenase encoding gene of Acidaminococcus Fermentans, hgdA
Base is encoded with hgdB two subunits for being derived from the 2- hydroxyl pentanedioyl acyl coenzyme dehydratase of Clostridium symbiosum
Cause, hgdC are derived from the anhydrase incitant encoding gene of Acidaminococcus Fermentans, gctA and gctB
Two subunit coding genes of the glutaconate CoA-transferase of Acidaminococcus Fermentans are derived from,
Egter is derived from the trans- 2- enoyl CoA reduction enzyme coding gene of Euglena gracilis, and tesB is derived from
The acyl-CoA thioesterase enzyme coding gene of Escherichia coli MG1655, amino acid sequence is successively such as Seq ID
Shown in No.1~8.
The primer sequence is as follows:
Egter- upstream primer, as shown in Seq ID No.12, specifically: 5 '-tctgccatggcgcatatggcgatg
tttaccacgaccgc‐3’
Egter- downstream primer, as shown in Seq ID No.13, specifically: 5 '-
atctggtaccttattgctgcgcggcgctcg‐3’
HgdH- upstream primer, as shown in Seq ID No.14, specifically: 5 '-atctggtaccattacaggagaagcc
tgatgaaagtgctgtgctacgg‐3’
HgdH- downstream primer, as shown in Seq ID No.15, specifically: 5 '-cgtcggatccgtctgcggccgctta
tttaattttattaggac‐3’
GctAB- upstream primer, as shown in Seq ID No.16, specifically: 5 '-actcggatccattacaggagaagc
ctgatgagcaaagttatgaccc‐3’
GctAB- downstream primer, as shown in Seq ID No.17, specifically: 5 '-
gtggaagcttttatttggcttctgtcggca‐3’
HgdAB- upstream primer, as shown in Seq ID No.18, specifically: 5 '-
attcggtaccatggccaaacaggtgagtcc‐3’
HgdAB- downstream primer, as shown in Seq ID No.19, specifically: 5 '-
gcgtgaattcttatttctgcatttccagca‐3’
HgdC- upstream primer, as shown in Seq ID No.20, specifically: 5 '-gtgagaattcattacaggagaagcc
tgatgagcatttataccctggg‐3’
HgdC- downstream primer, as shown in Seq ID No.21, specifically: 5 '-atgtggatccacgcgtattgtcgac
ttatttggcggcttttttgt‐3’
TesB- upstream primer, as shown in Seq ID No.22, specifically: 5 '-attagtcgacattacaggagaagcc
tgatgagtcaggcgctaaaaaa‐3’
TesB- downstream primer, as shown in Seq ID No.23, specifically: 5 '-ctcgctacgcgtttaattgtgatta
cgcatca‐3’
Wherein dashed part is corresponding restriction enzyme site.
Plasmid pTrc15C '-egTer-HgdH-GctAB has Ptrc promoter in egter upstream region of gene, can pass through addition
IPTG induction starting transcriptional expression.Plasmid pZS*27-HgdABC-TesB has lacI in hgdABC upstream region of geneQGene opens
Mover, the promoter is without inducing spontaneous starting transcriptional expression at any time.
3) by plasmid the pTrc15C '-egTer-HgdH-GctAB of above-mentioned building together with pZS*27-HgdABC-TesB together
Conversion obtains the bacterial strain for fermenting and producing by screening and activating to E.coli MG1655 competent cell, i.e., simultaneous with
The recombination bacillus coli of this above-mentioned 2 kinds of plasmids, i.e. E.coli MG1655 recombination bacillus coli.
Embodiment 2
Utilize recombinant bacterial strain fermenting and producing glutaric acid
Bacterial strain and condition of culture:
The culture medium that the E.coli MG1655 recombination bacillus coli uses is fermentation medium, specially pH 7.4
Supplement Stand I culture medium, component and content are as follows: 15g/L beef peptone, 3g/L yeast extract, 50mM 3- (N-
Morpholine) propane sulfonic acid, 3mM L-cysteine, 10mM sodium glutamate, 0.2mM riboflavin, 2mM ironic citrate.
The E.coli MG1655 recombination bacillus coli first passes around the activation of LB culture medium, then with initial inoculum
For OD600=0.1 is linked into supplement Stand I culture medium, to 37 DEG C of cell cultures to OD600When about 1.0, it is added 100 μM
IPTG continues to cultivate a couple of days in 30 DEG C.
In above-mentioned incubation, for the difference of oxygen supply, it is divided into aerobic, micro- oxygen and Anaerobic culturel.Aerobic
Under the conditions of, cell is cultivated in the 100ml shaking flask that liquid amount is 20ml, and bottleneck covers 8 layers of gauze, and the cell in shaking flask can be just
Often and air exchange.Under micro-oxygen conditions, cell is cultivated in the special shaking flask of 100ml that liquid amount is 20ml, and shaking flask is in cell
It is completely sealed after inoculation, cell can not be exchanged with outside air and is only capable of utilizing a small amount of oxygen existing for script in bottle.?
Under anaerobic condition, cell culture carries out under stringent oxygen-free environment, i.e., all operations all carry out in anaerobism work station.
Product extracts and quantitative determination
Fermented liquid supernatant first passes around 2M HCl (1%, v/v) acidification, then passes through the ethyl acetate extraction 2 of 5 times of volumes
It is secondary, by concentration, it is dissolved in 1 times of volume of ethylacetate, the BSTFA derivatization reagent of 1/2 volume is added, after 60 DEG C are reacted 30 minutes
Carry out the detection of triple quadrupole bar gas chromatography mass spectrometry.Wherein: the model Thermo Scientific of gas-chromatographyTM TRACETM
1310, it is equipped with TR-5MS gas chromatographic column.Mass spectrum model TSQ8000.
By making quantitation curves, the signal of test sample 158/115 (m/z) fragments characteristic ion to glutaric acid mark product
Intensity can finally detect highest 1.39 ± 0.44mg/L glutaric acid in the fermentation liquid of recombination bacillus coli, as shown in figure 3,
And it does not import in the fermentation liquids of the wild Escherichia coli of corresponding approach and only detects 0.07 ± 0.01mg/L glutaric acid.It can from result
To see, the multistep enzyme through being overexpressed on glutaric acid route of synthesis, so that recombination bacillus coli obtains the energy of synthesizing glutaric acid
Power.The factor supplied oxygen in fermentation process simultaneously can influence the ability of bacterial strain glutaric acid synthesis to a certain extent.
In addition, during recombination bacillus coli while producing glutaric acid, can also accumulate in designed approach and be related to
Between metabolin, as shown in Figure 3.Although it is noted that glutaric acid it is final yield it is still relatively low, 2- hydroxyl glutaric acid
A large amount of accumulation have implied where the current bottleneck of this approach and further improved potentiality.
Embodiment 3
Hydrolyzation catalysis ability of the different thioesterases to glutaryl coenzyme A.
In example 2, final step reaction is that be hydrolyzed into glutaric acid be the thioesterase by Escherichia coli to glutaryl coenzyme A
TesB is responsible for catalysis.What TesB was catalyzed originally in Escherichia coli be in short-chain fat acyl coenzyme A hydrolysis, but it is also right simultaneously
Some other substrates, including glutaryl coenzyme A are active.On the other hand, there are a variety of different thioesterases in organism,
Their substrate selectivity and activity is different.It is therefore desirable to screen to have more high activity to glutaryl coenzyme A hydrolysis
Enzyme.
Bacterial strain and condition of culture:
Enzyme in the present embodiment purifies to obtain by heterogenous expression.Protein heterogenous expression host is E.coli BL21
(DE3), expression vector is pET-28a (+), and the gene for needing to express is inserted into expression vector by digestion with restriction enzyme
It is expressed.Specific molecular biology manipulations and strain culturing are the same as embodiment 1.
Expression, extraction and the purifying of enzyme:
E.coli BL21 (DE3) with corresponding expression vectors is first passed around into the activation of LB culture medium, then initially to connect
Kind amount is OD600=0.1 is linked into fresh LB, when 37 DEG C of cell cultures are about 0.4 to OD, is added 400 μM
IPTG continues to cultivate 12h in 30 DEG C.
Bacterium solution after collecting culture, precipitating that thalline were collected by centrifugation at 4 DEG C, under conditions of 10000g.Then with 1/5 volume
Buffer (100mM Tris-HCl, 200mM NaCl, 10mM imidazoles, 0.5mM dithiothreitol (DTT), pH 7.4) is resuspended and carries out weight
It is outstanding.Re-suspension liquid passes through ultrasonication lytic cell, then by 4 DEG C, supernatant crude enzyme liquid is collected by centrifugation in 10000g.
Enzyme is purified by the progress of histidine tag affinity chromatography.By above-mentioned crude enzyme liquid loading combination HisTrap-FF
Affinity chromatography is lived, wash away after foreign protein by elution buffer (100mM Tris-HCl, 200mM NaCl, 200mM imidazoles,
0.5mM dithiothreitol (DTT), pH7.4) elution.The albumen eluted passes through dialysis again, is concentrated by ultrafiltration, and it is slow to be finally stored in Tris
In fliud flushing (100mM Tris-HCl, 0.5mM dithiothreitol (DTT), pH7.4).
Thioesterase enzyme activity determination:
Thioesterase can release free coacetylase (CoA-SH) after catalyzing acyl CoA hydrolase, free coacetylase by
In containing free sulfhydryl groups, can react with 5,5'-, bis- thiobis (2- nitrobenzoic acid) (DTNB), the yellow substance of generation exists
There are apparent absorption, molar absorption coefficient ε under 412nm wavelength412=13600M‐1cm‐1.
First by 0.1mM DTNB, 100mM sodium phosphate buffer (pH 7.4) and a certain amount of enzyme solutions are incubated at 30 DEG C
It educates 1.5 minutes, the variation that substrate glutaryl coenzyme A monitors 412nm wavelength absorption light at 30 DEG C is added later.According to absorption light
Variation, molar absorption coefficient and protein concentration calculate the maximum reaction rate of enzyme.Again by under different concentration of substrate
Maximum reaction rate obtains the enzyme to the Michaelis constant of glutaryl coenzyme A by double-reciprocal plot.
As shown in table 1, other than TesB can be catalyzed the hydrolysis of glutaryl coenzyme A, some other thioesterases are same
It can be catalyzed the reaction, some thioesterases have higher activity compared with TesB.Wherein, TesA and YciA are derived from
Other two kinds of acyl-CoA thioesterase enzymes of Escherichia coli K12.AcoT7 is derived from the thioesterase of mouse b16.This
A little enzymes can be applied to the glutaric acid route of synthesis.
Table 1 is kinetic parameter of the different thioesterases for glutaryl coenzyme A.
Glutaryl coenzyme A
Claims (9)
1. a kind of glutaric acid biology improves synthetic method, which is characterized in that first by coding for alpha-hydroxyglutarate dehydrogenase
HgdH, the gctAB for encoding glutaconate CoA-transferase, hgdABC, the trans- 2- for encoding 2- hydroxyl glutaryl coenzyme A dehydratase
The egter of enoyl CoA reductase and the tesB of acyl-CoA thioesterase enzyme are expressed in recombinant microorganism, and then will
Recombinant microorganism culture and ferment obtain glutaric acid；
The microbial hosts include as the E. coli MG1655 of expressive host and as the big of cloning host
Enterobacteria E.coli DH5 α；
The hgdH is derived from the 2-Hydroxyglutarate dehydrogenase encoding gene of Acidaminococcus Fermentans,
HgdA and hgdB is derived from two subunits coding of the 2- hydroxyl pentanedioyl acyl coenzyme dehydratase of Clostridium symbiosum
Gene, hgdC are derived from the anhydrase incitant encoding gene of Acidaminococcus Fermentans, gctA and
GctB is derived from two subunits coding base of the glutaconate CoA-transferase of Acidaminococcus Fermentans
Cause, egter are derived from the trans- 2- enoyl CoA reduction enzyme coding gene of Euglena gracilis, and tesB is derived from
The acyl-CoA thioesterase enzyme coding gene of Escherichia coli K12, amino acid sequence successively as Seq ID No.1~
Shown in 8.
2. according to the method described in claim 1, it is characterized in that, the expression, specific steps include:
1) by coding for alpha-hydroxyglutarate dehydrogenase hgdH, the gctAB of coding glutaconate CoA-transferase, coding 2- hydroxyl
The hgdABC of base glutaryl coenzyme A dehydratase, the egter of trans- 2- enoyl CoA reductase and acyl-CoA thioesterase enzyme
TesB is introduced using the heterogenous expression mode based on expression plasmid and is realized self-replacation in microbial hosts, i.e. design primer sequence
Column, expanded using corresponding bacterial strain whole genome sequence or full genome synthetic DNA as template, with endonuclease digestion and be connected to through
On the expression plasmid carrier of same endonuclease digestion；
2) giving corresponding promoter makes foreign gene start transcription.
3. according to the method described in claim 2, it is characterized in that, the expression plasmid be pTrc15C '-egTer-HgdH-
GctAB and pZS*27-HgdABC-TesB, in which: egter gene, hgdH gene, gctA gene and gctB gene exist
PTrc15C ' plasmid expression, hgdA gene, hgdB gene, hgdC gene and tesB gene are in pZS*27MCS plasmid expression.
4. according to the method described in claim 2, it is characterized in that, the primer sequence includes:
Egter- upstream primer, as shown in Seq ID No.12, specifically: 5 '-tctgccatggcgcatatggcgatgttta
ccacgaccgc-3'；
Egter- downstream primer, as shown in Seq ID No.13, specifically: 5 '-
atctggtaccttattgctgcgcggcgctcg-3'；
HgdH- upstream primer, as shown in Seq ID No.14, specifically: 5 '-atctggtaccattacaggagaagcctgat
gaaagtgctgtgctacgg-3'；
HgdH- downstream primer, as shown in Seq ID No.15, specifically: 5 '-cgtcggatccgtctgcggccgcttattta
attttattaggac-3'；
GctAB- upstream primer, as shown in Seq ID No.16, specifically: 5 '-actcggatccattacaggagaagcctga
tgagcaaagttatgaccc-3'；
GctAB- downstream primer, as shown in Seq ID No.17, specifically: 5 '-
gtggaagcttttatttggcttctgtcggca-3'；
HgdAB- upstream primer, as shown in Seq ID No.18, specifically: 5 '-
attcggtaccatggccaaacaggtgagtcc-3'；
HgdAB- downstream primer, as shown in Seq ID No.19, specifically: 5 '-
gcgtgaattcttatttctgcatttccagca-3'；
HgdC- upstream primer, as shown in Seq ID No.20, specifically: 5 '-gtgagaattcattacaggagaagcctgat
gagcatttataccctggg-3'；
HgdC- downstream primer, as shown in Seq ID No.21, specifically: 5 '-atgtggatccacgcgtattgtcgacttat
ttggcggcttttttgt-3'；
TesB- upstream primer, as shown in Seq ID No.22, specifically: 5 '-attagtcgacattacaggagaagcctgat
gagtcaggcgctaaaaaa-3'；
TesB- downstream primer, as shown in Seq ID No.23, specifically: 5 '-ctcgctacgcgtttaattgtgattacgca
tca-3'；
Wherein dashed part is corresponding restriction enzyme site.
5. according to the method described in claim 1, it is characterized in that, the recombinant microorganism refers to: E.coli MG1655 recombination
Escherichia coli, wherein simultaneous with pTrc15C '-egTer-HgdH-GctAB plasmid and pZS*27-HgdABC-TesB plasmid.
6. according to the method described in claim 1, it is characterized in that, the culture, first pass around LB culture medium activation, then with
Initial inoculum is OD600=0.1 is linked into supplement Stand I culture medium, to 37 DEG C of cell cultures to OD600When being 1.0, add
Enter 100 μM of IPTG to continue to cultivate a couple of days in 30 DEG C.
7. according to the method described in claim 6, it is characterized in that, the supplement Stand I culture medium, specially pH's 7.4
Supplement Stand I culture medium, component and content are as follows: 15g/L beef peptone, 3g/L yeast extract, 50mM 3- (N-
Coffee quinoline) propane sulfonic acid, 3mM L-cysteine, 10mM sodium glutamate, 0.2mM riboflavin, 2mM ironic citrate.
8. according to the method described in claim 1, it is characterized in that, the fermentation refers to: when recombination bacillus coli intake seek
After supporting object, nutrients is converted to by α -one penta 2 by the glycolytic pathway and part krebs cycle pathway of cellular endogenous
Then acid successively passes through:
1. under the catalytic action by the Alpha-hydroxy glutatate dehydrogenase HgdH expressed in recombinant microorganism, α-ketoglutaric acid
It is converted into 2- hydroxyl glutaric acid；
2. under the catalytic action of the glutaconate CoA-transferase GctAB expressed by recombinant microorganism, 2- hydroxyl penta 2
Acid is converted into 2- hydroxyl glutaryl coenzyme A；
3. under the catalytic action of the 2- hydroxyl glutaryl coenzyme A dehydratase HgdABC expressed by recombinant microorganism, 2- hydroxyl
Base glutaryl coenzyme A is converted into 2,3- alkene glutaryl coenzyme A；
4. under the catalytic action of the enoyl CoA reductase Ter expressed by recombinant microorganism, 2,3- of a part alkene penta 2
Acyl coenzyme A is converted into glutaryl coenzyme A, the amylene two that remaining 2,3- alkene glutaryl coenzyme A is expressed by recombinant microorganism
Additional 2,3- alkene-glutaric acid is converted under the catalytic action of sour CoA-transferase GctAB；
5. the acyl-CoA thioesterase enzyme that glutaryl coenzyme A is expressed by recombinant microorganism is converted by catalyzing hydrolysis
Glutaric acid.
9. method according to claim 1 or 8, characterized in that the acyl-CoA thioesterase enzyme includes: to pass through recombination
Acyl-CoA thioesterase enzyme TesB that microorganism is expressed, acyl-CoA thioesterase enzyme YciA, acyl-CoA thioesterase enzyme TesA,
Acyl-CoA thioesterase enzyme AcoT7, amino acid sequence is successively as shown in No.8~11 Seq ID.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510456365.XA CN106399343B (en) | 2015-07-29 | 2015-07-29 | Glutaric acid biology improves synthetic method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510456365.XA CN106399343B (en) | 2015-07-29 | 2015-07-29 | Glutaric acid biology improves synthetic method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106399343A CN106399343A (en) | 2017-02-15 |
| CN106399343B true CN106399343B (en) | 2019-07-05 |
Family
ID=58009177
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510456365.XA Active CN106399343B (en) | 2015-07-29 | 2015-07-29 | Glutaric acid biology improves synthetic method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106399343B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109112090B (en) * | 2017-06-29 | 2021-07-27 | 江南大学 | Total biosynthesis method of glutaric acid |
| CN112939766B (en) * | 2019-12-10 | 2023-02-17 | 中国石油化工股份有限公司 | Method for preparing glutaric acid |
| CN114456957B (en) * | 2021-12-22 | 2023-07-25 | 南京脂禾生物科技有限公司 | Schizochytrium limacinum genetically engineered strain, construction method and application thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103937841A (en) * | 2014-05-13 | 2014-07-23 | 上海交通大学 | Application of enoyl coenzyme A hydratase in adipic acid biosynthesis |
| CN104120103A (en) * | 2014-07-31 | 2014-10-29 | 上海交通大学 | Engineering bacteria based on glutamate synthase and implementation method thereof |
| CN104152392A (en) * | 2014-07-31 | 2014-11-19 | 上海交通大学 | Hemicellulase-based engineering bacteria and realization method thereof |
| CN104152498A (en) * | 2014-07-31 | 2014-11-19 | 洛阳华荣生物技术有限公司 | Method for producing alpha-ketoglutaric acid by virtue of enzymic method |
| CN104328145A (en) * | 2014-10-20 | 2015-02-04 | 南京大学 | Method for producing unsaturated fatty acid from gene engineering Escherichia coli |
| CN104561142A (en) * | 2013-10-25 | 2015-04-29 | 中国科学院天津工业生物技术研究所 | Biosynthesis method of (R)-3-hydroxy glutaric acid monoester |
| CN105385702A (en) * | 2015-09-11 | 2016-03-09 | 天津科技大学 | Acid-resistant threonine production bacterium and establishment method and application thereof |
-
2015
- 2015-07-29 CN CN201510456365.XA patent/CN106399343B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104561142A (en) * | 2013-10-25 | 2015-04-29 | 中国科学院天津工业生物技术研究所 | Biosynthesis method of (R)-3-hydroxy glutaric acid monoester |
| CN103937841A (en) * | 2014-05-13 | 2014-07-23 | 上海交通大学 | Application of enoyl coenzyme A hydratase in adipic acid biosynthesis |
| CN104120103A (en) * | 2014-07-31 | 2014-10-29 | 上海交通大学 | Engineering bacteria based on glutamate synthase and implementation method thereof |
| CN104152392A (en) * | 2014-07-31 | 2014-11-19 | 上海交通大学 | Hemicellulase-based engineering bacteria and realization method thereof |
| CN104152498A (en) * | 2014-07-31 | 2014-11-19 | 洛阳华荣生物技术有限公司 | Method for producing alpha-ketoglutaric acid by virtue of enzymic method |
| CN104328145A (en) * | 2014-10-20 | 2015-02-04 | 南京大学 | Method for producing unsaturated fatty acid from gene engineering Escherichia coli |
| CN105385702A (en) * | 2015-09-11 | 2016-03-09 | 天津科技大学 | Acid-resistant threonine production bacterium and establishment method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106399343A (en) | 2017-02-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10865404B1 (en) | Aspartase mutant, recombinant expression vector and recombinant bacterium containing aspartase mutant, and use thereof | |
| JP2010535028A (en) | Mutant microorganism having high ability to produce putrescine and method for producing putrescine using the same | |
| CN108060114B (en) | A kind of Escherichia coli of fermenting and producing l-Alanine and its application | |
| CN112210524B (en) | Genetic engineering bacterium for co-production of 3-hydroxypropionic acid and 1, 3-propanediol and construction method and application thereof | |
| CN105899664A (en) | Recombinant microorganism for improved production of fine chemicals | |
| US12104189B2 (en) | Mutant of nitrile hydratase derived from Caldalkalibacillus thermarum | |
| CN105683378A (en) | Recombinant microorganism for improved production of fine chemicals | |
| CN106399343B (en) | Glutaric acid biology improves synthetic method | |
| CN1746301A (en) | Acid-proof and high-temperature resistant alpha-amylase and production thereof | |
| CN107881163A (en) | A kind of heat-resisting nitrile hydratase, engineering bacteria and its application in catalysis nitrile compound hydration reaction generation acid amides | |
| Ran et al. | Enhanced production of recombinant Thermobifida fusca isoamylase in Escherichia coli MDS42 | |
| CN117625581A (en) | N-acetylglucosaminidase mutant Ea2F and application thereof | |
| CN106591258B (en) | A kind of lipase gene, carrier, engineering bacteria and its application | |
| Hsiang et al. | Genetic design of co-expressing a novel aconitase with cis-aconitate decarboxylase and chaperone GroELS for high-level itaconic acid production | |
| Luo et al. | Gene cloning, overexpression, and characterization of the nitrilase from Rhodococcus rhodochrous tg1-A6 in E. coli | |
| CN105296513B (en) | A kind of ocean esterase and its encoding gene E22 and application | |
| CN104498466A (en) | Nitrile hydratase and application thereof | |
| WO2018100097A1 (en) | Alcohol acetyl transferases for ethyl acetate production | |
| CN104212850A (en) | Method for preparing 1-cyancyclohexylacetic acid by using nitrilase engineering bacterium | |
| CN106967662A (en) | A kind of recombinant bacterium of fixed carbon dioxide synthesizing succinic acid and its construction method and application | |
| Wang et al. | Expression and production of recombinant cis-epoxysuccinate hydrolase in Escherichia coli under the control of temperature-dependent promoter | |
| JP5713333B2 (en) | Method for producing dihydroxyacetone | |
| CN104762306B (en) | A kind of ocean esterase and its encoding gene E32 and application | |
| CN110872595A (en) | Acid-resistant expression cassette and application thereof in organic acid production by fermentation | |
| He et al. | Metabolic Engineering of Zymomonas moblis for Ethylene Production |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |