CN106399336A - Gene sequence for highly expressing GAD65 protein in drosophila cell and protein preparation method - Google Patents

Gene sequence for highly expressing GAD65 protein in drosophila cell and protein preparation method Download PDF

Info

Publication number
CN106399336A
CN106399336A CN201610771314.0A CN201610771314A CN106399336A CN 106399336 A CN106399336 A CN 106399336A CN 201610771314 A CN201610771314 A CN 201610771314A CN 106399336 A CN106399336 A CN 106399336A
Authority
CN
China
Prior art keywords
cell
gad65
protein
strepii
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201610771314.0A
Other languages
Chinese (zh)
Other versions
CN106399336B (en
Inventor
周智广
郑沛林
黄干
谢志国
易波
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Second Xiangya Hospital of Central South University
Original Assignee
Second Xiangya Hospital of Central South University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Second Xiangya Hospital of Central South University filed Critical Second Xiangya Hospital of Central South University
Priority to CN201610771314.0A priority Critical patent/CN106399336B/en
Publication of CN106399336A publication Critical patent/CN106399336A/en
Application granted granted Critical
Publication of CN106399336B publication Critical patent/CN106399336B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01015—Glutamate decarboxylase (4.1.1.15)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/103—Plasmid DNA for invertebrates
    • C12N2800/105—Plasmid DNA for invertebrates for insects
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention provides a gene sequence for highly expressing a GAD65 protein in a drosophila cell and a protein preparation method. A eukaryon host is a drosophila S2 cell. By discussing codon usage species preference, an original gene sequence of human GAD65 is subjected to codon optimization to obtain a brand-new GAD65 gene sequence capable of improving recombinant protein expression efficiency, wherein the brand-new GAD65 gene sequence is as shown in SEQ NO.1. The invention provides a drosophila cell high expression carrier bearing a brand-new human GAD65 sequence, wherein the brand-new human GAD65 sequence includes the GAD65 gene sequence as shown in the SEQ NO.1. GAD65 contains a StrepII tag, and a high-purity and high-immunogenicity GAD65 protein can be obtained through one-step affinity chromatography purification, so that the recombinant protein yield is greatly increased and the cost is reduced. According to the gene sequence and the protein preparation method, a conventional method for obtaining human GAD65 by using a yeast or insect baculovirus expression system is changed; the drosophila S2 cell, namely, a high-density continuous culture system is used for the first time to express a large amount of GAD65; and the high-purity and low-cost human GAD65 protein with good immunogenicity is quickly prepared through the StrepII tag.

Description

The gene order of high expression Human Glutamate Decarboxylase 65 albumen and albumen preparation in drosophila cell Method
Technical field：
The invention belongs to Human Glutamate Decarboxylase 65 albumen high efficient expression and preparing technical field are and in particular to carry GAD65 drosophila cell Cance high-expression gene sequence and the efficient technology of preparing of GAD65.
Research background：
Glutamate decarboxylase (Glutamic Acid Decarboxylase, GAD65) is that a kind of important islets of langerhans itself resists Former, its protein product can extensively be applied but be not limited to islet autoantibody (glutamic acid decarboxylase antibody, GADA) detection, antigen T lymphocyte specific detection and propagation, and autoimmune diabetes prevention and treatment.
The expression of foreign protein is often related to many factors, including the efficiency of transcription and translation.Table in drosophila cell Intelligent's GAD65 albumen, between kind, the difference of codon availability often reduces the expression of foreign protein.The present invention passes through Inquire into codon and use kind Preference, analyze and synthesize the optimal sequence expressing Human Glutamate Decarboxylase 65 albumen in insecticide S2 cell, Improve the expression efficiency of recombiant protein eventually.
By cultured cells, the expression obtaining recombiant protein remains one of a large amount of important method producing protein.Carefully Bacterium, yeast, the correlational study of insecticide, mammalian cell and the insect cell carried out at present all respectively have its restriction.? In antibacterial, the recombiant protein of expression lacks correct folding and post translational modification, and the immunogenicity often leading to recombiant protein is relatively low. The post translational processing of yeast expression foreign protein is different with mammal, and is difficult to carry out high density fermentation.In insecticide Expressed by Baculovirus-insect System foreign protein can be used in Sf9, Sf21 and High five cell, but can quilt after cell infection It is impossible to steady and continuous are cultivated, albumen differences between batches are larger for cracking.Expression foreign protein high cost and expression in mammalian cell Amount is low.The present invention uses Drosophila S 2 cells to express in Human Glutamate Decarboxylase 65 albumen, the post translational processing of albumen and mammal very phase Cultivate can high density seemingly, and continuously, substantially reduce cost and for subsequent purification technique batch between concordance provide safeguard.
The conventional label of purification of recombinant proteins is 6His, GST label etc., but often purity of protein is not high after purification, needs By means such as follow-up molecular sieve, ion exchange, hydrophobic chromatographies, target protein purity is promoted to more than 90%.In the present invention In by StrepII label mediation affinity chromatograph, can by one step affinity chromatograph obtain restructuring GAD65 albumen (purity More than 90% and there is good immunogenicity), substantially increase the yield of recombiant protein.
Content of the invention：
It is an object of the present invention to provide the Human Glutamate Decarboxylase 65 protein gene sequence of high expression and GAD65 albumen are high in drosophila cell The method of effect preparation, this improved gene order can greatly improve the expression of Human Glutamate Decarboxylase 65 albumen.After High Density Cultivation Insect cell cracking after can obtain the restructuring GAD65 albumen of purity more than 90%, effectively reduction by a step affinity chromatograph Loss in cost and purge process.The GAD65 albumen of purification has good immunogenicity through ELISA checking.
The gene order of present invention Human Glutamate Decarboxylase 65 albumen of high expression in drosophila cell, as shown in SEQ NO.1.
Sequence shown in SEQ NO.2 is the sequence before Human Glutamate Decarboxylase 65 gene order transformation as shown in SEQ NO.1 for the present invention Row.
The preparation method of Human Glutamate Decarboxylase 65 albumen, the sequence association StrepII label shown in SEQ NO.1 is cloned into expression and carries In body, then it is transfected into expression in drosophila cell with r plasmid simultaneously, GAD65-StrepII tag fusion protein will be obtained.
Described expression vector is pAc5.1/V5-His A.
Described affinity purification label is StrepII label；Described r plasmid is pCoBlast resistant vector.
Described drosophila cell is S2.
Specifically include following steps：
(1) according to kind preferential expression, with OptimumGene software, codon is carried out to the ORF sequence of Human Glutamate Decarboxylase 65 Optimize；
(2) synthetic complete sequence；
(3) primer and restriction enzyme site design：
Sequence according to synthesis and StrepII label design primer, and add KpnI and NotI restriction enzyme site, primer is as follows Shown：
forward primer：
5'-CGGGGTACCCAAACATGTGGTCGCATCCGCAGTTCGAGAAGGCCTCGCCAGGAAGCGG-3'；
reverse primer：5’-ATAAGAATGCGGCCGCTTATTACAGGTCCTGGCCCAGG-3’；
(4) PCR amplification obtains purpose GAD65-StrepII fragment；
(5) double digestion is carried out to purpose fragment and carrier；
(6) purpose fragment after enzyme action and carrier connect connection under enzyme effect in T4；
(7) recombinant conversion:Recombinant expression carrier is transfected antibacterial competent cell；
(8) after sequence verification, the carrier of GAD65-StrepII is expressed in a large amount of extractings
(9) by GAD65-StrepII carrier and pCoBlast resistant vector cotransfection drosophila cell expressing protein
(10) albumen that step (9) obtains is through obtaining high-purity GAD65 albumen after purification
Carrier in step (5) is pAc5.1/V5-His A.
Step (6) carries out restructuring using ligase and connects：Junction fragment 100ng, adds 50ng pAc5.1/V5-His A Plasmid, 5 μ l 2 × reaction buffer and 1 μ l T4 ligase, supply water to 10 μ l；Connect 1h at 22 DEG C, transformed competence colibacillus are thin Born of the same parents.
The detailed process of step (9)：
Choose the S2 cell of cultured health, by 3 × 106Individual cell is seeded in 60mm tissue culture dishes, culture medium It is the Sf-900 II SFM Medium for S2 cell, every ware adds the culture medium of 3ml, train in constant temperature under 28 DEG C of aseptic conditions Cultivated in foster case；
Carry out cell transfecting using calcium phosphate transfection test kit K2780-01：
1. sequentially add distilled water 233 μ l, calcium chloride 240mM 36 μ l, 1 μ g/ μ l in the centrifuge tube of aseptic 1.5ml GAD65-StrepII-pAc5.1/V5-His A plasmid 19 μ l, 0.5 μ g/ μ l pCoBlast plasmid 2 μ l；
2. transfer to after being slowly mixed together 1min in the centrifuge tube of the 2 × HEPES HBS containing 200 μ l, mix；
3. mixture is placed 30-40min in room temperature；
4. slowly add mixture in cell culture medium, slow rotating and culturing ware is mixed with abundant；
5. cultivate 1 day in 28 DEG C of constant incubator；
6. cell culture medium is carried out changing liquid：
7. culture medium is sucked together with cell in the centrifuge tube of 15ml；
8., after 1000rpm centrifugation 3min, remove supernatant, and add 1ml fresh culture in the centrifuge tube of 15ml；
9. mixture is rejoined in new centrifuge tube；
Again cleaned once with 2ml culture medium；
With 2ml culture medium suspension cell, and go to culture in culture dish；
28 DEG C of cultures add 20 μ g/ml Blasticidin screening and cloning to set up stably transfected cell line two days later.
Cell culture after step (9) transfection is in the Sf-900 II SFM Medium containing 20 μ g/ml Blasticidin In, it is divided into 10 cell triangle culture bottles, every bottle of 200ml culture medium culturing；After cell culture collects cracking, then pass through a step StrepII label affinity purification chromatograph targeting obtains.
GAD65 of the present invention high expression optimisation strategy and experimental verification
Kind preferential expression is studied
First pass through OptimumGene algorithm, according to the open reading frame of sequence, proprietary algorithm optimization adopted to sequence, Substituted for codon and the parameter that the aspect such as can optimize for mRNA structure, screen the gene of expression cloning codon optimization. Software according to translational selection (pressure of selection be present in translation gene during, that is, codon preference different loci (synonymous, In non-synonymous and gene regions) polymorphism and difference between relation, the G that constitutes gene, C content, mrna length, species The abundance of tRNAs, conservation of amino acids, encoding gene are in the context relation of the position of genomic DNA, codon base composition Build preferential expression sequence Deng 7 factors, Human Glutamate Decarboxylase 65 codon is optimized.Codon adaptation indexI after optimization (Codon Adaptation Index, CAI) rises to 0.96 from 0.63, optimizing codon frequency (Frequency of Optimal Codons, FOP) it is greatly improved, G/C content is optimized to 61.93% (Fig. 1) from 48.22%.
Experimental verification
Western blotting result shows, the GAD65 protein expression level after sequence alterations is apparently higher than original sequence Row (Fig. 2).Prove that codon preference optimization is remarkably improved the expression of restructuring Human Glutamate Decarboxylase 65 albumen.By the affine layer of a step Analysis can obtain high-purity GAD65 albumen (Fig. 3), and albumen has good immunogenicity (Fig. 4).
Brief description
Fig. 1 .GAD65 gene order codon is greatly optimized after being directed to fruit bat host transformation；
Before after optimization, codon adaptation indexI (A), optimizing codon frequency (C) and G/C content (E) relatively optimize, (B, D, F) has It is greatly improved.
Fig. 2. codon optimization can be greatly improved the yield of Human Glutamate Decarboxylase 65 albumen in Drosophila S 2 cells；
Carry the plasmid transfection Drosophila S 2 cells of sequence or original series after GAD65 codon optimization, detect cell cracking The expression of GAD65 and actin in thing.
Fig. 3. a step affinity chromatograph obtains high-purity restructuring GAD65 albumen；
GAD65 albumen after A, western blotting checking before purification；
B, coomassie brilliant blue staining detection GAD65 purity of protein after purification；
C, LC/MS mass spectrum is to albumen n end the obtained sequence of sequencing；
D, the obtained sequence of mass spectrum is fitted like a glove with GAD65 protein sequence in ncbi database.
Fig. 4. the Human Glutamate Decarboxylase 65 albumen of purification has good immunogenicity；
The GAD65 of purification or commercialization GAD65 albumen are coated 96 orifice plates, and ELISA detects negative serum and basic, normal, high Degree GADA serum.The GAD65 albumen of purification can not only distinguish GADA feminine gender and positive serum, and can effectively distinguish GADA Basic, normal, high titer serum.
Fig. 5 .pAc5.1/V5-His A and pCoBlast plasmid (Life Technologies) collection of illustrative plates.
Specific embodiment：
Detailed description below is intended to further illustrate the present invention, and the unrestricted present invention.Do not violating structure of the present invention Any replacement made on the basis of think of and improvement, all belong to protection scope of the present invention.
(1) embodiment 1：Build GAD65-StrepII label protein expression vector
1. with OptimumGene, codon optimization is carried out to the albumen coded sequence of Human Glutamate Decarboxylase 65；
2. design primer and restriction enzyme site
According to the sequence after optimizing and StrepII sequence label design primer, and add KpnI, NotI restriction enzyme site.Draw Thing is as follows：
P1:
5'-CGGGGTACCCAAACATGTGGTCGCATCCGCAGTTCGAGAAGGCCTCGCCAGGAAGCG G-3'
P2：5’-ATAAGAATGCGGCCGCTTATTACAGGTCCTGGCCCAGG-3’
Design primer according to original series and StrepII sequence label, and add KpnI, NotI restriction enzyme site.Primer is such as Shown in lower：P3:
5'-CGGGGTACCCAAACATGTGGTCGCATCCGCAGTTCGAGAAGGCTAGCCCAGGCTCCGGATTTTG- 3'
P4:5’-ATAAGAATGCGGCCGCTTATTATAAATCTTGTCCAAGGC-3’
3.PCR amplification obtains purpose fragment
The DNA of synthesis is expanded with PCR and obtains purpose fragment, and concrete operations are as follows：
Reaction condition：94 DEG C of degeneration 5min, enter 40 circulations afterwards, and cycling condition is 94 DEG C of degeneration 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 2min.After 40 circulate, 72 DEG C of final extension 10min.The product of PCR with 1% agarose gel Electrophoresis detection.
4.PCR product glue reclaim
(1) after PCR reaction, remove pcr template using gel electrophoresiss, and other unwanted product；
(2) prepare 500ml 1 × TAE (50 times of TAE of 10ml are diluted in the distilled water of 500ml)；
(3) prepare 1% agarose gel.When being heated to nearly seething with excitement, after mixing, continue heating, until naked eyes are seen not To the granule of floating (high fire heating 1-2min on microwave oven).Carefully take out the triangle equipped with agarose gel Bottle, when temperature is cooled to 50 DEG C, adds 3 μ l ethidium bromides, imports into sealing rubber die and insert canine tooth comb；
(4) add the loading dye of sample 1/6 volume in proportion in the sample；
(5) loading dye and sample blending loading, on careful point sample to agarose gel, 90 volts of electrophoresis is about 30min；
(6) gel imaging, then cuts out and predicts the band of size position consistency, puts into 2ml Eppendorf centrifuge tube In (EP pipe).Purpose band is positioned using Burdick lamp during cutting；
(7) need to weigh immediately after gel excision, and remove the weight of the EP pipe of empty 2ml, and remembered label；
(8) use the glue reclaim extracts kit recovery sample band of Shanghai raw work biology company limited；
(9) add 600 μ l binding Buffer in centrifuge tube, put into 55 DEG C of thermostatic drying chambers and dissolved.Every 1min jiggles centrifuge tube.After about 10min, blob of viscose is completely dissolved；
(10) the solution liquid-transfering gun after dissolving is added in the filter tube of test kit offer, places 2min；
(11) high speed frozen centrifugation, 10000rpm is centrifuged 1min；
(12) discard liquid, add wash buffer 600 μ l, High speed refrigerated centrifuge 10000r/min is centrifuged 1min；
(13) 12 steps are repeated once；
(14) discard liquid, 13000rpm is centrifuged 2min；
(15) filter membrane is nested in centrifuge tube, adds 30 μ l distilled waters with dissolving DNA in filter membrane central authorities, place 2min Afterwards, 13000rpm centrifugation 1min.In centrifuge tube, remaining liquid contains the DNA fragmentation reclaiming.
5. double digestion
Double digestion reaction is carried out to PCR primer and pAc5.1/V5-His A plasmid vector：Glue reclaim fragment 2.0 μ g or load Body 2.0 μ g, adds 10 × buffer 5 μ l, each 1 μ l of two kinds of enzymes, supplies aseptic double-distilled water to reaction system 50 μ l.37 DEG C of reactions 2 Hour, and reclaim endonuclease bamhi using gel electrophoresiss.Fragment after recovery is defined as target fragment by sequence verification.
6. carry out restructuring using ligase to connect
Junction fragment 100ng, adds 50ng pAc5.1/V5-His A plasmid, 5 μ l 2 × reaction buffer and 1 μ l T4 Ligase, supplies water to 10 μ l；Connect 1h at 22 DEG C, for transformed competence colibacillus cell.
7. transformation experiment
Take out the DH5 α escherichia coli being stored in -80 DEG C, thaw on ice.There is the competence of 100 μ l in each centrifuge tube Cell.For each conversion reaction, the plasmid drawing 5 μ l is in the centrifuge tube equipped with competent cell, and is incubated on ice 20-25min is so that DNA is adsorbed onto cell surface.Prepare 42 DEG C of water-baths.After competent cell is ready, in 42 DEG C of water-baths Heat shock 90s.Immediately put in ice bath, add the LB culture medium of 1ml on ice after 2min, and vibrate mixing, allow cell from Heat shock is recovered and is restarted to grow.45-60min is cultivated on 37 DEG C of shaking tables, liquid occurs muddiness.It is coated with 100 μ l to containing Have on the flat board of ampicillin.Overnight incubation in 37 DEG C of constant incubators.Single bacterium colony after overnight incubation is careful with pipette tips Choose in the EP pipe containing 800 μ l LB culture medium.Cultivate 4 hours on 37 DEG C of shaking tables, subsequently detected whether using round pcr Purpose fragment.Be accredited as the positive serves the sequencing of sea raw work biology company limited.
8. plasmid extracts in a large number
(1) incubated overnight 100ml antibacterial；
(2) resuspended antibacterial is in 10ml P1 buffer.Guarantee that ribonuclease A is added in buffer P1；
(3) add 10ml buffer P2, gently overturn mixing 4-6 time, must not whirlpool shake, because this will lead to genome The fracture of DNA.If it is necessary, continue reverse EP pipe becoming sticky and transparent until solution, the cracking reaction time must not be allowed more than 5min；
(4) add 10ml buffer P3, and gently overturn test tube 4-6 time immediately, 20 minutes on ice, compact white precipitate Will be formed；
(5) 4 degree >=20,000g is centrifuged 30 minutes, and supernatant is transferred to QIAGEN-tip 500；
(6) 2 30ml QC solution washings；
(7) add 15ml QF eluant solution DNA, add the isopropanol of 10.5ml；
(8) 4 degree >=15,000g is centrifuged 30 minutes；
(9) supernatant is outwelled, add 5ml 70% washing with alcohol DNA, 4 degree >=15,000g is centrifuged 30 minutes；
(10) outwell supernatant, residual solution adds distilled water dissolving DNA after air-drying.
(2) embodiment 2：The recombinant expressed and identification of Human Glutamate Decarboxylase 65 in insecticide S2 cell
1. Drosophila S 2 cells are recovered and are passed on
Take out frozen cell strain to thaw at room temperature from liquid nitrogen container；With 70% ethanol and sterilize outside cell bottle Side, in the transfer complete medium under 4ml room temperature for the Cell sap, re-suspended cell is simultaneously centrifuged 2-3 minute in 1000g, removes culture DMSO. inoculating cell in base in 5ml fresh complete medium 28 DEG C, no CO2In incubator cultured cells to density 6～ 20x106cells/ml.
Cell density reaches 5x106During cells/ml, cell becomes tufted to grow, and this has no effect on the growth of cell, passes on During can blow and beat open packed cell.By 1：2 to 1：5 ratio passage cells.28 DEG C of cultured cells until density reach 6～ 20x106cells/ml.
2. recombinant vector transfected Drosophila cells
Operation scheme with reference to DES Drosophila expression system and calcium phosphate transfection test kit (K2780-01) carries out (Life Technology company), concrete operations are as follows:
(1) choose the S2 cell of cultured health, by 3 × 106Cell kind in 60mm tissue culture dishes.Culture medium It is the Sf-900II SFM for S2 cell, every ware adds the culture medium of 3ml.Enter in constant incubator under 28 DEG C of aseptic conditions Row culture.
(2) sequentially add distilled water 233 μ l, calcium chloride 240mM 36 μ l, 1 μ g/ μ l in the centrifuge tube of aseptic 1.5ml GAD65-StrepII-pAc5.1/V5-His A plasmid 19 μ l, 0.5 μ g/ μ l pCoBlast plasmid 2 μ l；
(3) transfer to after being slowly mixed together 1min in the centrifuge tube of the 2 × HEPES HBS containing 200 μ l, mix；
(4) mixture is placed 30-40min in room temperature；
(5) slowly add mixture in cell culture medium, slow rotating and culturing ware is mixed with abundant；
(6) cultivate 1 day in 28 DEG C of constant incubator；
(7) cell culture medium is carried out changing liquid；
(8) 28 DEG C of cultures add 20 μ g/ml Blasticidin screening and cloning to set up stably transfected cell line two days later.
3. a small amount of expression of recombiant protein and identification
Screen stable expression cell strain with blasticidin S and cultivate after 3 or 4 weeks, cell cracking is collected by centrifugation.With The expression (Fig. 2) of GAD65 albumen before and after the son optimization of western blotting password comparison.
(1) preparation of western blotting separation gel
1. glass plate soap and water clean up, and are then cleaned once with ethanol again.And assemble；
2. prepare 6% separation gel 10ml first.Add prepare separation gel (comprise 0.008ml TEMED and 0.1ml10%APS).Separation gel is poured in the middle of two glass plates, and fluid sealant, pour isobutanol into above separation gel so that The top of separation gel is smooth.Prepare to pour concentration glue into after sealing 10min.
(2) western blotting concentrates the preparation of glue
1. pour out the isobutanol of separation gel upper end.And wash isobutanol with water.Dry inner surface with filter paper；
2. add APS/TEMED in concentrating glue, mix, be then poured on above separation gel；
3. it is inserted perpendicularly into comb, then pour a little concentration glue in comb both sides, to fully seal the both sides of comb, and go Bubble removing；
4. wait 20-30min so that concentrating glue to repeat coagulation.
(3) western blotting gel electrophoresiss
1. glue mould is put into electrophresis apparatuses, pour Tris- glycine running buffer into；
2. carefully remove the bubble around electrophoresis tank；
3. carefully extract comb, and remove the bubble around hole with syringe；
4. sample and the common heated and boiled of loading buffer are with degeneration 5min；
5. carry out prerunning with the electric current of 20mA at the beginning.When stainable bands go to separation gel, electric current is gone to 30mA.Stop electrophoresis when developed band is gone near gel bottom；
6. gel is dyeed with Coomassie brilliant blue.Gel is put in Coomassie brilliant blue, dyes 1h.Afterwards, add and take off Toner (40% ethanol, 10% acetic acid and 50% distilled water), decolours in three times, each 1h.After having decoloured, observation of taking pictures.
(4) transferring film
1. gel is taken out, put into transferring film instrument.(transferring film used by this experiment turns skill for wet to pour transferring film liquid on transferring film instrument into Art).Lay 6 metafiltration paper in bottom, acetate film is put in centre, and gel is put on upper strata, and afterwards, upper strata repaves 6 metafiltration paper；
2. with electric current 0.25A, 250V voltage transferring film 40min；
3. the film after taking a turn for the better carefully takes out.With the careful cleaning of TBST solution 3 times, each 5min.Subsequently enter subsequent operation.
(5) antibody incubation and colour developing
1. closed with skim milk first.Add 5% skim milk, close 30min；
2. acetate film film sealing machine is closed；
3. add 1ml 1 in closing bag:GAD65 antibody after 1000 dilutions or actin antibody are incubated, at -4 DEG C Overnight incubation；
4. acetate film TBST cleans three times, each 10min；
5. add 1ml 1 in closing bag:Goat anti-rabbit igg two after 5000 dilutions resists, 1 hour of room temperature；
6. acetate film TBST cleans three times, each 10min；
7. developed the color using HRP method.After the mixing of A, B liquid, put into acetate film with chemical colour reaction.
4. the great expression of recombiant protein, purification and identification
After the optimum condition having groped protein purification, by the S2 cell culture of stable expression GAD65 in 10 triangles Tissue Culture Flask, in every bottle of 200ml culture medium.Cell culture is collected and after cracking, passes through StrepII label affinity purification color Spectrum targeting obtains GAD65.Affinity chromatograph uses GE Healthcare company StrepTrap HP detached dowel (GE Healthcare, 28-9075-47).Its principle is that StrepTactin can specifically bind with StrepII label, makes albumen It is fixed on solid phase carrier, after eluting impurity, use the desthiobiotin eluting target protein of 2.5mM.Albumen is used after purification Western blotting, coomassie brilliant blue staining and LC/MS Mass Spectrometric Identification (Fig. 3).
5. the mensure of protein concentration
Determination of protein concentration adopts dihomocinchonine acid (BCA) method, carries out (Pierce, 23227) according to kit specification.
Sample reads light absorption value at 562nm, prepares the standard curve of absorbance and protein first, and determines that matching is bent Line formula.
According to the extension rate of sample, determine original protein concentration.
(3) embodiment 3：The immunogenicity of purification GAD65 albumen
The incomplete antigen epi-position of GAD65 is space conformation type epi-position, and GAD65 albumen after purification must be able to correctly fold simultaneously Form correct space conformation to be identified by GADA autoantibody.GAD65 albumen for determining purification has good immunogen Property, we choose commercially available best GAD65 albumen in the world and compare.The GAD65 of purification and commercialization GAD65 albumen are coated 96 Orifice plate overnight, is closed 1 hour with 1%BSA after washing, is subsequently adding negative serum, the basic, normal, high titer serum of GADA is fed, and washes Biotinylated GAD65 (RSR) is added, nurture adds the Streptavidin that POD is coupled after 1 hour, add after washing after washing Substrate TMB shows, 2M H2SO4Terminating reaction.The GAD65 albumen of purification has good immunogenicity, can not only distinguish GADA feminine gender and positive serum, and can effectively distinguish the serum (Fig. 4) of the basic, normal, high titre of GADA.
SEQ NO.1 (GAD65 optimize after sequence, optimizing codon with underscore indicate)：
ATGGCCTCGCCAGGAAGCGGATTCTGGTCCTTCGGATCGGAGGATGGAAGCGGCGACTCCGAGAACCCA GGAACCGCCCGCGCCTGGTGCCAGGTGGCCCAGAAGTTCACCGGCGGCATCGGCAATAAGCTGTGCGCCCTGCTGTA CGGCGATGCCGAGAAGCCCGCCGAGTCGGGAGGAAGCCAGCCACCACGCGCCGCCGCCCGCAAGGCCGCCTGCGCCT GCGATCAGAAGCCATGCAGCTGCTCCAAGGTGGACGTGAACTACGCCTTCCTGCACGCCACCGATCTGCTGCCAGCC TGCGACGGAGAGCGCCCAACCCTGGCCTTCCTGCAGGATGTGATGAATATCCTGCTGCAGTACGTGGTGAAGAGCTT CGATCGCTCCACCAAGGTCATCGACTTCCACTACCCCAACGAGCTGCTGCAGGAGTACAATTGGGAGCTGGCCGACC AGCCACAGAACCTGGAGGAGATCCTGATGCACTGCCAGACCACCCTGAAGTACGCCATCAAGACCGGCCACCCGCGC TACTTCAATCAGCTGAGCACCGGACTGGATATGGTGGGACTGGCCGCCGACTGGCTGACCTCCACCGCCAACACCAA TATGTTCACCTACGAGATCGCCCCCGTGTTCGTGCTGCTGGAGTACGTGACCCTGAAGAAGATGCGCGAGATCATCG GATGGCCAGGAGGATCGGGCGACGGAATCTTCAGCCCAGGAGGAGCCATCTCCAACATGTACGCCATGATGATCGCC CGCTTCAAGATGTTCCCGGAGGTGAAGGAGAAGGGAATGGCCGCCCTGCCACGCCTGATCGCCTTCACCTCCGAGCA CTCGCACTTCAGCCTGAAGAAGGGAGCCGCCGCCCTGGGAATCGGAACCGATAGCGTGATCCTGATCAAGTGCGACG AGCGCGGCAAGATGATCCCGAGCGATCTGGAGCGCCGCATCCTGGAGGCCAAGCAGAAGGGCTTCGTGCCATTCCTG GTGTCGGCCACCGCCGGAACCACCGTGTACGGAGCCTTCGATCCACTGCTGGCCGTGGCCGACATCTGCAAGAAGTA CAAGATCTGGATGCACGTGGACGCCGCCTGGGGAGGAGGACTGCTGATGAGCCGCAAGCACAAGTGGAAGCTGTCGG GAGTGGAGCGCGCCAACAGCGTGACCTGGAATCCCCACAAGATGATGGGCGTGCCGCTGCAGTGCTCCGCCCTGCTGGTGCGCGAGGAGGGACTGATGCAGAACTGCAATCAGATGCACGCCTCCTACCTGTTCCAGCAGGATAAGCACTACGA CCTGTCGTACGATACCGGCGACAAGGCCCTGCAGTGCGGACGCCACGTGGATGTGTTCAAGCTGTGGCTGATGTGGC GCGCCAAGGGAACCACCGGATTCGAGGCCCACGTGGACAAGTGCCTGGAGCTGGCCGAGTACCTGTACAACATCATC AAGAATCGCGAGGGCTACGAGATGGTGTTCGATGGCAAGCCACAGCACACCAACGTGTGCTTCTGGTACATCCCACC CTCCCTGCGCACCCTGGAGGACAATGAGGAGCGCATGTCCCGCCTGTCCAAGGTGGCCCCCGTGATCAAGGCCCGCA TGATGGAGTACGGCACCACCATGGTGTCCTACCAGCCACTGGGCGATAAGGTGAACTTCTTCCGCATGGTCATCTCG AATCCCGCCGCCACCCACCAGGATATCGACTTCCTGATCGAGGAGATCGAGCGCCTGGGCCAGGACCTGTAA
SEQ NO.2 (GAD65 original series)：
ATGGCATCTCCGGGCTCTGGCTTTTGGTCTTTCGGGTCGGAAGATGGCTCTGGGGATTCCGAGAATCCCGGCACAGC GCGAGCCTGGTGCCAAGTGGCTCAGAAGTTCACGGGCGGCATCGGAAACAAACTGTGCGCCCTGCTCTACGGAGACG CCGAGAAGCCGGCGGAGAGCGGCGGGAGCCAACCCCCGCGGGCCGCCGCCCGGAAGGCCGCCTGCGCCTGCGACCAG AAGCCCTGCAGCTGCTCCAAAGTGGATGTCAACTACGCGTTTCTCCATGCAACAGACCTGCTGCCGGCGTGTGATGG AGAAAGGCCCACTTTGGCGTTTCTGCAAGATGTTATGAACATTTTACTTCAGTATGTGGTGAAAAGTTTCGATAGAT CAACCAAAGTGATTGATTTCCATTATCCTAATGAGCTTCTCCAAGAATATAATTGGGAATTGGCAGACCAACCACAA AATTTGGAGGAAATTTTGATGCATTGCCAAACAACTCTAAAATATGCAATTAAAACAGGGCATCCTAGATACTTCAA TCAACTTTCTACTGGTTTGGATATGGTTGGATTAGCAGCAGACTGGCTGACATCAACAGCAAATACTAACATGTTCA CCTATGAAATTGCTCCAGTATTTGTGCTTTTGGAATATGTCACACTAAAGAAAATGAGAGAAATCATTGGCTGGCCA GGGGGCTCTGGCGATGGGATATTTTCTCCCGGTGGCGCCATATCTAACATGTATGCCATGATGATCGCACGCTTTAA GATGTTCCCAGAAGTCAAGGAGAAAGGAATGGCTGCTCTTCCCAGGCTCATTGCCTTCACGTCTGAACATAGTCATT TTTCTCTCAAGAAGGGAGCTGCAGCCTTAGGGATTGGAACAGACAGCGTGATTCTGATTAAATGTGATGAGAGAGGG AAAATGATTCCATCTGATCTTGAAAGAAGGATTCTTGAAGCCAAACAGAAAGGGTTTGTTCCTTTCCTCGTGAGTGC CACAGCTGGAACCACCGTGTACGGAGCATTTGACCCCCTCTTAGCTGTCGCTGACATTTGCAAAAAGTATAAGATCT GGATGCATGTGGATGCAGCTTGGGGTGGGGGATTACTGATGTCCCGAAAACACAAGTGGAAACTGAGTGGCGTGGAG AGGGCCAACTCTGTGACGTGGAATCCACACAAGATGATGGGAGTCCCTTTGCAGTGCTCTGCTCTCCTGGTTAGAGA AGAGGGATTGATGCAGAATTGCAACCAAATGCATGCCTCCTACCTCTTTCAGCAAGATAAACATTATGACCTGTCCT ATGACACTGGAGACAAGGCCTTACAGTGCGGACGCCACGTTGATGTTTTTAAACTATGGCTGATGTGGAGGGCAAAG GGGACTACCGGGTTTGAAGCGCATGTTGATAAATGTTTGGAGTTGGCAGAGTATTTATACAACATCATAAAAAACCG AGAAGGATATGAGATGGTGTTTGATGGGAAGCCTCAGCACACAAATGTCTGCTTCTGGTACATTCCTCCAAGCTTGC GTACTCTGGAAGACAATGAAGAGAGAATGAGTCGCCTCTCGAAGGTGGCTCCAGTGATTAAAGCCAGAATGATGGAG TATGGAACCACAATGGTCAGCTACCAACCCTTGGGAGACAAGGTCAATTTCTTCCGCATGGTCATCTCAAACCCAGC GGCAACTCACCAAGACATTGACT TCCTGATTGAAGAAATAGAACGCCTTGGACAAGATTTATAA.

Claims (10)

1. in drosophila cell the gene order of the Human Glutamate Decarboxylase 65 albumen of high expression it is characterised in that as shown in SEQ NO.1.
2. the preparation method of Human Glutamate Decarboxylase 65 albumen is it is characterised in that by the sequence association shown in SEQ NO.1 in claim 1 StrepII label is cloned in expression vector, then is transfected into expression in drosophila cell with r plasmid simultaneously, will obtain GAD65- StrepII tag fusion protein.
3. method according to claim 2 is it is characterised in that described expression vector is pAc5.1/V5-His A.
4. method according to claim 2 is it is characterised in that described affinity purification label is StrepII label；Described R plasmid is pCoBlast resistant vector.
5. method according to claim 2 is it is characterised in that described drosophila cell is S2.
6. the method according to Claims 2 or 3 or 4 or 5 is it is characterised in that specifically include following steps：
(1) according to kind preferential expression, with software, codon optimization is carried out to the ORF sequence of Human Glutamate Decarboxylase 65；
(2) synthetic complete sequence；
(3) primer and restriction enzyme site design：
Sequence according to synthesis and StrepII label design primer, and add KpnI and NotI restriction enzyme site, the following institute of primer Show：
forward primer：
5'-CGGGGTACCCAAACATGTGGTCGCATCCGCAGTTCGAGAAGGCCTCGCCAGGAAGCGG-3'；
reverse primer：5’-ATAAGAATGCGGCCGCTTATTACAGGTCCTGGCCCAGG-3’；
(4) PCR amplification obtains purpose GAD65-StrepII fragment；
(5) double digestion is carried out to purpose fragment and carrier；
(6) purpose fragment after enzyme action and carrier connect connection under enzyme effect in T4；
(7) recombinant conversion:Recombinant expression carrier is transfected antibacterial competent cell；
(8) after sequence verification, the carrier of GAD65-StrepII is expressed in a large amount of extractings；
(9) by GAD65-StrepII carrier and pCoBlast resistant vector cotransfection drosophila cell expressing protein；
(10) albumen that step (9) obtains is through obtaining high-purity GAD65 albumen after purification.
7. method according to claim 6 is it is characterised in that the carrier in step (5) is pAc5.1/V5-His A.
8. method according to claim 6 is it is characterised in that step (6) carries out restructuring connection using ligase：Connection sheet Section 100ng, adds the pAc5.1/V5-His A plasmid after 50ng enzyme action, 5 μ l 2 × reaction buffer and 1 μ l T4 ligase, Supply water to 10 μ l；Connect 1h, transformed competence colibacillus cell at 22 DEG C.
9. method according to claim 6 is it is characterised in that the detailed process of step (9)：
Choose the S2 cell of cultured health, by 3 × 106Individual cell is seeded in 60mm tissue culture dishes, culture medium be for The Sf-900II SFM Medium of S2 cell, every ware adds the culture medium of 3ml, under 28 DEG C of aseptic conditions in constant incubator Cultivated；
Carry out cell transfecting using calcium phosphate transfection test kit K2780-01:
1. sequentially add distilled water 233 μ l, calcium chloride 240mM 36 μ l, 1 μ g/ μ l GAD65- in the centrifuge tube of aseptic 1.5ml StrepII-pAc5.1/V5-His A plasmid 19 μ l, 0.5 μ g/ μ l pCoBlast plasmid 2 μ l；
2. transfer to after being slowly mixed together 1min in the centrifuge tube of the 2 × HEPES HBS containing 200 μ l, mix；
3. mixture is placed 30-40min in room temperature；
4. slowly add mixture in cell culture medium, slow rotating and culturing ware is mixed with abundant；
5. cultivate 1 day in 28 DEG C of constant incubator；
6. cell culture medium is carried out changing liquid；
7. culture medium is sucked together with cell in the centrifuge tube of 15ml；
8., after 1000rpm centrifugation 3min, remove supernatant, and add 1ml fresh culture in the centrifuge tube of 15ml；
9. mixture is rejoined in new centrifuge tube；
10. again cleaned once with 2ml culture medium；
With 2ml culture medium suspension cell, and go to culture in culture dish；
28 DEG C of cultures add 20 μ g/ml Blasticidin screening and cloning to set up stably transfected cell line two days later.
10. method according to claim 6 is it is characterised in that the cell culture after step (9) transfection is containing 20 μ g/ml In the Sf-900II SFM Medium of Blasticidin, it is divided into 10 cell triangle culture bottles, every bottle of 200ml culture medium training Support；After cell culture collects cracking, then obtained by StrepII label affinity purification chromatograph targeting.
CN201610771314.0A 2016-08-30 2016-08-30 The gene order and protein preparation method of high expression Human Glutamate Decarboxylase 65 albumen in drosophila cell Active CN106399336B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610771314.0A CN106399336B (en) 2016-08-30 2016-08-30 The gene order and protein preparation method of high expression Human Glutamate Decarboxylase 65 albumen in drosophila cell

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610771314.0A CN106399336B (en) 2016-08-30 2016-08-30 The gene order and protein preparation method of high expression Human Glutamate Decarboxylase 65 albumen in drosophila cell

Publications (2)

Publication Number Publication Date
CN106399336A true CN106399336A (en) 2017-02-15
CN106399336B CN106399336B (en) 2017-12-05

Family

ID=58002335

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610771314.0A Active CN106399336B (en) 2016-08-30 2016-08-30 The gene order and protein preparation method of high expression Human Glutamate Decarboxylase 65 albumen in drosophila cell

Country Status (1)

Country Link
CN (1) CN106399336B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105087619A (en) * 2015-05-29 2015-11-25 苏州大学 Ubiquitin-like modified protein substrate identifying method
CN105861530A (en) * 2016-04-06 2016-08-17 中南大学湘雅二医院 I-Ag7 drosophila cell high-expression gene sequence bearing GAD65 p271-284 peptide fragment and constructed Tetramer

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105087619A (en) * 2015-05-29 2015-11-25 苏州大学 Ubiquitin-like modified protein substrate identifying method
CN105861530A (en) * 2016-04-06 2016-08-17 中南大学湘雅二医院 I-Ag7 drosophila cell high-expression gene sequence bearing GAD65 p271-284 peptide fragment and constructed Tetramer

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
无: "Predicted:oryctolagus cuniculus glutamate decarboxylase 2(GAD2),mRNA", 《GENBANK》 *
陈盛强等: "谷氨酸脱羧酶65重组杆状病毒表达载体的构建及其在昆虫细胞中的表达", 《解剖学研究》 *

Also Published As

Publication number Publication date
CN106399336B (en) 2017-12-05

Similar Documents

Publication Publication Date Title
CN106868008A (en) CRISPR/Cas9 targeting knock outs people Lin28A genes and its specificity gRNA
CN108384762B (en) Porcine alpha-enterocoronavirus and culture method and application thereof
CN111471089A (en) Recombinant African swine fever virus CD2V subunit protein and preparation method and application thereof
CN108627648A (en) A kind of ELISA antibody assay kits of 3 type of novel pig circular ring virus and its application
CN116375847A (en) Yeast recombinant XVII type humanized collagen and preparation method thereof
CN114853883B (en) Qinghai blood tick serine protease inhibitor and polyclonal antibody thereof
CN111139224B (en) Monoclonal cell strain resisting SWP2 protein and application thereof
CN111875676A (en) P49 mutant protein of African swine fever virus immunogen, recombinant vector, Escherichia coli genetic engineering bacteria, preparation method and application
CN112961865B (en) Recombinant trastuzumab expressed by gene editing chicken bioreactor and application
CN106520779A (en) Method for improving 1L-2 protein expression efficiency of chicken through codon optimization of chicken 1L-2 gene
CN105348374A (en) Method for acquiring high-activity Cry1Ai protein mutants and mutants
CN106399336B (en) The gene order and protein preparation method of high expression Human Glutamate Decarboxylase 65 albumen in drosophila cell
CN112142827B (en) gB subunit recombinant protein of porcine pseudorabies virus, and preparation method and application thereof
CN110156878B (en) Porcine pseudorabies virus gE-gI protein, expression plasmid thereof, preparation method and application
CN112341525A (en) Recombinant African swine fever virus pE120R subunit soluble protein and preparation method and application thereof
CN113735943A (en) Recombinant African swine fever virus p72 subunit protein, preparation method and application thereof
CN105861530B (en) Carry the Tetramer of I-Ag7 the drosophila cell cance high-expression gene sequence and building of GAD65 p271-284 peptide fragment
CN115109782A (en) Expression and renaturation method of recombinant human CXCL16 protein
CN1803846A (en) Hybrid protein of p53 protein epitope(SQAMDDLMLS) and filobactivirus gene 8 protein and application thereof
CN109337887B (en) Nucyep coding gene, recombinant expression vector, recombinant engineering bacterium, and preparation method and application thereof
CN115073559A (en) Prokaryotic soluble expression method and application of recombinant African swine fever virus EP153R subunit transmembrane protein
CN106191044A (en) A kind of gene engineering method improving lactein plnK yield
CN117567591B (en) Preparation method and application of novel murine Tmem247 antibody for researching Tmem247 protein
CN109402174B (en) Method for exogenously expressing BAK1 protein
CN111777775B (en) Amide type cross-linked polymer, preparation method thereof and application thereof in biological protein precipitation

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant