CN106397796B - A kind of preparation method and applications of magnetic DNA supramolecular hydrogel - Google Patents

A kind of preparation method and applications of magnetic DNA supramolecular hydrogel Download PDF

Info

Publication number
CN106397796B
CN106397796B CN201610860783.XA CN201610860783A CN106397796B CN 106397796 B CN106397796 B CN 106397796B CN 201610860783 A CN201610860783 A CN 201610860783A CN 106397796 B CN106397796 B CN 106397796B
Authority
CN
China
Prior art keywords
dna
magnetic
graphene oxide
hydrogel
monomer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610860783.XA
Other languages
Chinese (zh)
Other versions
CN106397796A (en
Inventor
毕赛
岳淑珍
王宗花
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qingdao University
Original Assignee
Qingdao University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qingdao University filed Critical Qingdao University
Priority to CN201610860783.XA priority Critical patent/CN106397796B/en
Publication of CN106397796A publication Critical patent/CN106397796A/en
Application granted granted Critical
Publication of CN106397796B publication Critical patent/CN106397796B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08J—WORKING-UP; GENERAL PROCESSES OF COMPOUNDING; AFTER-TREATMENT NOT COVERED BY SUBCLASSES C08B, C08C, C08F, C08G or C08H
    • C08J3/00—Processes of treating or compounding macromolecular substances
    • C08J3/24—Crosslinking, e.g. vulcanising, of macromolecules
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/02—Inorganic compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/26—Carbohydrates, e.g. sugar alcohols, amino sugars, nucleic acids, mono-, di- or oligo-saccharides; Derivatives thereof, e.g. polysorbates, sorbitan fatty acid esters or glycyrrhizin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0002—Galenical forms characterised by the drug release technique; Application systems commanded by energy
    • A61K9/0009—Galenical forms characterised by the drug release technique; Application systems commanded by energy involving or responsive to electricity, magnetism or acoustic waves; Galenical aspects of sonophoresis, iontophoresis, electroporation or electroosmosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/06—Ointments; Bases therefor; Other semi-solid forms, e.g. creams, sticks, gels
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08J—WORKING-UP; GENERAL PROCESSES OF COMPOUNDING; AFTER-TREATMENT NOT COVERED BY SUBCLASSES C08B, C08C, C08F, C08G or C08H
    • C08J3/00—Processes of treating or compounding macromolecular substances
    • C08J3/02—Making solutions, dispersions, lattices or gels by other methods than by solution, emulsion or suspension polymerisation techniques
    • C08J3/03—Making solutions, dispersions, lattices or gels by other methods than by solution, emulsion or suspension polymerisation techniques in aqueous media
    • C08J3/075—Macromolecular gels
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08K—Use of inorganic or non-macromolecular organic substances as compounding ingredients
    • C08K3/00—Use of inorganic substances as compounding ingredients
    • C08K3/02—Elements
    • C08K3/04—Carbon
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08K—Use of inorganic or non-macromolecular organic substances as compounding ingredients
    • C08K9/00—Use of pretreated ingredients
    • C08K9/04—Ingredients treated with organic substances
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
    • G01N33/5735—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes co-enzymes or co-factors, e.g. NAD, ATP
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08K—Use of inorganic or non-macromolecular organic substances as compounding ingredients
    • C08K2201/00—Specific properties of additives
    • C08K2201/01—Magnetic additives

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Polymers & Plastics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Dispersion Chemistry (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Food Science & Technology (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Inorganic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a kind of preparation method and applications of magnetic DNA supramolecular hydrogel.The magnetic DNA hydrogel is made of magnetic oxygenated graphene and two kinds of DNA monomers (Y type DNA monomer (Y-DNA) and connector DNA monomer (L-DNA)).Wherein, Y-DNA and L-DNA forms DNA hydrogel by cohesive end Complementary hybridization；At the same time, the exposed cohesive end of DNA hydrogel is adsorbed on magnetic oxygenated graphene surface by the effect of π-π stacking and forms magnetic DNA supramolecular hydrogel.Using magnetic DNA supramolecular hydrogel prepared by this method have many advantages, such as low in cost, operation simply, be easily isolated, rapid reaction, versatile.Further, this method is successfully applied to the colorimetric method and ultraviolet-ray visible absorbing quantitative detection of pharmaceutical carrier and atriphos (ATP).Compared with the existing detection method, this method is easy to operate, low in cost, and testing result is intuitive, is not necessarily to complex instrument equipment, has broad application prospects.

Description

Preparation method and application of magnetic DNA supermolecule hydrogel
Technical Field
The invention belongs to the field of biological medicine, and particularly relates to a preparation method and application of magnetic DNA supermolecule hydrogel.
Background
Nanomaterials are materials whose three-dimensional spatial dimensions of the particles are at least one dimension in the nanometer range (typically 0.1-100 nm). The magnetic nano material is an important nano material and has the following characteristics: (1) the material has small size and can freely permeate blood vessels; (2) can produce corresponding thermal effect along with the change of the external magnetic field; (3) the biological compatibility and targeting property of the product can be enhanced according to the functionalization of the use purpose; (4) the material shows special physical and chemical properties such as quantum size effect, surface effect, macroscopic quantum tunneling effect, good biocompatibility and the like, and can be used as a magnetic carrier for drug delivery and the like. In recent years, magnetic nano materials have been widely applied to cell magnetic separation, targeted drug loading, tumor thermomagnetic therapy and the like, and have wide application prospects in the fields of disease diagnosis and treatment and the like.
DNA acts as a biomacromolecule that encodes, stores, and transmits genetic information, controlling the inheritance and traits of an organism. Due to the characteristics of designability, responsiveness and the like of the functional sequence, the functional sequence can be assembled into a two-dimensional or three-dimensional structure in a programming way. At present, people establish a DNA self-assembly technology by taking DNA as an assembly material to carry out the assembly of a micro-nano structure and the construction of a molecular device. DNA hydrogels are porous networks formed by chemical or physical cross-linking of DNA monomers. The assembly process of the DNA hydrogel can be accurately controlled by designing a DNA sequence and the sequence length, the reaction is rapid, the condition is mild, and the method has wide application prospect in the field of biomedicine.
At present, no relevant literature report exists about the preparation of magnetic DNA supermolecule hydrogel and the application of the magnetic DNA supermolecule hydrogel in the construction of a drug carrier and an ATP detection system.
Disclosure of Invention
In order to overcome the defects, the invention provides a preparation method of magnetic DNA supramolecular hydrogel, and the preparation method is applied to construction of a medicine carrying system and an ATP detection system.
In a first aspect of the invention, a preparation method of a magnetic DNA supramolecular hydrogel is provided. As shown in FIG. 1, the experimental principle is that three single strands (Y1, Y2 and Y3) are used to construct Y-type DNA monomer (Y-DNA) and two single strands (L1 and L2) are used to construct linker DNA monomer (L-DNA) respectively; meanwhile, the magnetic graphene oxide is prepared by utilizing the amide reaction between the graphene oxide and the amino magnetic beads. The magnetic DNA supermolecule hydrogel is prepared by utilizing complementary hybridization self-assembly of the viscous ends of the Y-DNA and the L-DNA to form the DNA supermolecule hydrogel, and adsorbing the DNA hydrogel on the surface of the magnetic graphene oxide through the external exposed viscous end based on the pi-pi stacking effect between the single-stranded DNA and the magnetic graphene oxide.
In order to achieve the purpose, the invention adopts the following technical scheme:
a magnetic DNA supramolecular hydrogel comprising:
DNA supermolecule hydrogel doped with magnetic graphene oxide;
the DNA supermolecule hydrogel is adsorbed on the surface of the magnetic graphene oxide.
The magnetic graphene oxide has a large specific surface area, and can load a large amount of DNA hydrogel. When the nano-particles are used in a drug loading system, higher drug loading efficiency can be realized; when the method is used for detecting ATP, the detection sensitivity is obviously improved.
In addition, the magnetic DNA supermolecule hydrogel is formed by utilizing the pi-pi stacking effect between the exposed adhesive end of the DNA hydrogel and the magnetic graphene oxide, has stronger binding force and stability compared with the traditional electrostatic adsorption, and overcomes the defects of complicated steps and higher cost when a covalent modification method is adopted for synthesis.
Preferably, the DNA supermolecule hydrogel is formed by complementary hybridization and self-assembly of cohesive ends of Y-DNA and L-DNA, wherein the Y-DNA is a Y-type DNA monomer constructed by three DNA single-strands (Y1, Y2 and Y3); the L-DNA is a connector DNA monomer constructed by two DNA single strands (L1 and L2);
more preferably, the molar ratio of the Y-DNA to the L-DNA to the magnetic graphene oxide is 300-600: 900-1800: 1 to 2.
More preferably, the oligonucleotide chain sequence of the Y-DNA is:
Y1：5'-CACGGACTTGGATCCGCATAACCATTCGCCGTAATG-3'；
Y2：5'-CACGGACTCATTACGGCGAATGTACCGAATCAGCCT-3'；
Y3：5'-CACGGACTAGGCTGATTCGGTAGTTATGCGGATCCA-3'；
the sequence of the oligonucleotide chain of the L-DNA is as follows:
L1：
5'-AGTCCGTGGTAGGGCAGGTTGGGGTGACTGGTTGGTGTGGTTGG-3'；
L2：
5'-AGTCCGTGCCAACCACACCAACCAGTCACCCCAACCTGCCCTAC-3'。
the invention can accurately control the self-assembly process of the DNA hydrogel through the designed DNA sequence, has simple design and is easy for practical application.
The invention firstly provides a preparation method of magnetic DNA supermolecule hydrogel, which comprises the steps of dispersing magnetic graphene oxide, Y-DNA and L-DNA in a buffer solution, uniformly mixing, and reacting at constant temperature to obtain the magnetic DNA supermolecule hydrogel.
The preparation method is simple and easy to operate. The invention forms the magnetic DNA supermolecule hydrogel by utilizing the Pi-Pi stacking effect between the adhesive tail end of the exposed DNA hydrogel and the magnetic graphene oxide, and has the advantages of rapid reaction, mild condition, strong binding force and high stability. While the common nanoparticles are used as drug carriers, covalent synthesis or electrostatic adsorption is mostly adopted. Wherein, although the covalent synthesis has better stability, the operation steps are complex and the reaction conditions are harsh; although the electrostatic adsorption has simple synthesis steps, the binding force and the stability are poor.
Preferably, the constant-temperature reaction is carried out for 3-3.5 hours at 35-37 ℃;
preferably, the specific preparation method of the magnetic graphene oxide is as follows: preparing graphene oxide dispersion liquid, activating, and reacting with amino magnetic beads to obtain the graphene oxide dispersion liquid;
preferably, the DNA supermolecule hydrogel is formed by complementary hybridization and self-assembly of cohesive ends of Y-DNA and L-DNA; wherein, the Y-DNA is a Y-type DNA monomer constructed by three DNA single-strands (Y1, Y2 and Y3); the L-DNA is a connector DNA monomer constructed by two DNA single strands (L1 and L2);
more preferably, the molar ratio of the Y-DNA to the L-DNA to the magnetic graphene oxide is 300-600: 900-1800: 1-2;
more preferably, the oligonucleotide chain sequence of the Y-DNA is:
Y1：5'-CACGGACTTGGATCCGCATAACCATTCGCCGTAATG-3'；
Y2：5'-CACGGACTCATTACGGCGAATGTACCGAATCAGCCT-3'；
Y3：5'-CACGGACTAGGCTGATTCGGTAGTTATGCGGATCCA-3'；
the sequence of the oligonucleotide chain of the L-DNA is as follows:
L1：
5'-AGTCCGTGGTAGGGCAGGTTGGGGTGACTGGTTGGTGTGGTTGG-3'；
L2：
5'-AGTCCGTGCCAACCACACCAACCAGTCACCCCAACCTGCCCTAC-3'。
the invention also provides a preparation method of the better magnetic DNA supermolecule hydrogel, which comprises the following steps:
1. preparation of magnetic graphene oxide
Putting a certain amount of graphene oxide sheets in a beaker, adding secondary water for ultrasonic dissolution to obtain a brown solution, and centrifuging at 6000-6500 rpm for 10-15 min to obtain the graphene oxide sheet with the final concentration of 1-1.5 mg mL-1The graphene oxide suspension; taking 600-650 mu L of graphene oxide suspension, adding 600-650 mu L of 1-ethyl- (3-dimethylaminopropyl) carbodiimide hydrochloride) (EDC), and oscillating and activating for 1-1.2 h at 35-37 ℃; adding 300-320 mu L of amino magnetic beads (the particle size is about 100nm) into the activated graphene oxide solution, and carrying out oscillation reaction at 35-37 ℃ for 12-14 h; and performing magnetic separation on the prepared magnetic graphene oxide, washing the magnetic graphene oxide with PBS (phosphate buffer solution) for three times, dispersing the washed magnetic graphene oxide in secondary water, and storing the magnetic graphene oxide at 4-5 ℃ for later use.
Preparation of Y-DNA and L-DNA
The DNA used in the experiment was TE buffered (10mM Tris-HCl buffer; 1mM disodium ethylenediaminetetraacetate (disodium EDTA); 12.5mM MgCl)2pH 8.0). Y1, Y2 and Y3 (concentration ratio Y1: Y2: Y3 is 1: 1: 1, and the final concentration of each DNA is 50 mu M) and L1 and L2 (concentration ratio L1: L2 is 1: 1, and the final concentration of each DNA is 50 mu M) are respectively addedAnnealing treatment, namely heating to 95 ℃ for 5min, then slowly cooling to room temperature for 2h to form Y-DNA and L-DNA with stable structures, and storing at 4 ℃ for later use.
3. Preparation of magnetic DNA supermolecule hydrogel
And (3) putting the same amount of the prepared Y-DNA and L-DNA into a micro-centrifuge tube, adding a magnetic graphene oxide solution into a mixed system, and finally adding a PBS (phosphate buffer solution) (pH 7.0) to ensure that the final concentrations of the Y-DNA, the L-DNA and the magnetic graphene oxide are 6-12 mu M, 18-36 mu M and 0.02-0.04 mu M respectively. And reacting the mixed system at 35-37 ℃ for 3-4 h to obtain the magnetic DNA supermolecule hydrogel.
In the second aspect of the invention, based on the prepared magnetic DNA supermolecule hydrogel, the technical application of taking the magnetic DNA supermolecule hydrogel as a drug carrier is provided. The principle is shown in fig. 2, based on the cross-linking effect of Y-DNA and L-DNA, DNA supramolecular hydrogel is formed by self-assembly, and the magnetic DNA supramolecular hydrogel is prepared by adsorbing the DNA supramolecular hydrogel on the surface of the magnetic graphene oxide through the exposed adhesive end of the DNA hydrogel in combination with the adsorption effect of the magnetic graphene oxide on single-chain DNA, i.e. the magnetic DNA supramolecular hydrogel prepared in the first aspect of the present invention. Further, by utilizing the property that an antitumor drug Doxorabicin (DOX) can be inserted into the DNA double-chain structure, the antitumor drug DOX is embedded into the DNA double-chain structure of the magnetic DNA supramolecular hydrogel, and the magnetic DNA supramolecular hydrogel drug carrier loaded with the antitumor drug DOX is prepared. Because Deoxyribonuclease I (DNase I for short) is in neutral environment and has Mg2+In the presence of the oligonucleotide, double-stranded DNA can be non-specifically hydrolyzed to produce an oligonucleotide having a 5 'phosphate terminus and a 3' hydroxyl terminus. Therefore, after DNase I is added into the system, the DNase I hydrolyzes the DOX-loaded DNA supermolecule hydrogel into DNA fragments, so that the loaded anti-tumor drug DOX is released, and drug release is realized. The method combines the antitumor drug with DNA nano structure with good biocompatibility and water solubility, and overcomes the defects of poor water solubility and stability of the drug; at the same time the method is combinedThe magnetic graphene oxide has the advantage of easy separation and purification in the process of preparing the DNA drug-loaded nanostructure, provides a good application platform for constructing a highly ordered and accurately controlled nucleic acid drug carrier, and has wide development prospect.
In order to achieve the purpose, the invention adopts the following technical scheme:
an anti-tumor drug-loaded magnetic DNA supramolecular hydrogel comprises:
DNA supermolecule hydrogel doped with magnetic graphene oxide;
the anti-tumor drug is loaded on the magnetic DNA supermolecule hydrogel;
the DNA supermolecule hydrogel loaded with the anti-tumor drug is adsorbed on the surface of the magnetic graphene oxide.
The reticular DNA hydrogel is prepared by using a DNA self-assembly technology, and the structure contains a large number of DNA base pairs. Because some antitumor drugs, such as adriamycin (DOX), epirubicin (E-ADM) and pirarubicin (THP), can be inserted into the double DNA chains, the DNA supermolecule hydrogel can be used as a drug carrier to greatly increase the drug loading. In addition, the characteristic that DNase I can non-specifically hydrolyze double-stranded DNA is utilized, so that the aim of slow release of the medicament is fulfilled. Compared with the common nano structure, the reticular DNA hydrogel has high drug loading.
Preferably, the molar ratio of the Y-DNA and the L-DNA to the magnetic graphene oxide and the antitumor drug is 300-600: 900-1800: 1-2: 3X 104～6×104；
Preferably, the anti-tumor drugs are DOX, E-ADM and THP;
preferably, the DNA supermolecule hydrogel is formed by complementary hybridization and self-assembly of cohesive ends of Y-DNA and L-DNA, wherein the Y-DNA is a Y-type DNA monomer constructed by three DNA single-strands (Y1, Y2 and Y3); the L-DNA is a connector DNA monomer constructed by two DNA single strands (L1 and L2);
more preferably, the molar ratio of the Y-DNA to the L-DNA to the magnetic graphene oxide is 300-600: 900-1800: 1 to 2.
More preferably, the oligonucleotide chain sequence of the Y-DNA is:
Y1：5'-CACGGACTTGGATCCGCATAACCATTCGCCGTAATG-3'；
Y2：5'-CACGGACTCATTACGGCGAATGTACCGAATCAGCCT-3'；
Y3：5'-CACGGACTAGGCTGATTCGGTAGTTATGCGGATCCA-3'；
the sequence of the oligonucleotide chain of the L-DNA is as follows:
L1：
5'-AGTCCGTGGTAGGGCAGGTTGGGGTGACTGGTTGGTGTGGTTGG-3'；
L2：
5'-AGTCCGTGCCAACCACACCAACCAGTCACCCCAACCTGCCCTAC-3'。
the invention also provides a preparation method of the magnetic DNA supermolecule hydrogel for loading the antitumor drug, which comprises the following steps:
dispersing the magnetic graphene oxide, the Y-DNA, the L-DNA and the antitumor drug in a buffer solution, uniformly mixing, reacting at constant temperature, and carrying out magnetic separation to obtain the magnetic DNA supermolecule hydrogel loaded with the antitumor drug.
Preferably, the molar ratio of the Y-DNA to the L-DNA to the magnetic graphene oxide to the antitumor drug is 300-600: 900-1800: 1-2: 3X 104～6×104；
Preferably, the anti-tumor drugs are DOX, E-ADM and THP;
preferably, the constant-temperature reaction is carried out for 3-3.5 hours at 35-37 ℃;
preferably, the specific preparation method of the magnetic graphene oxide is as follows: preparing graphene oxide dispersion liquid, activating, and reacting with amino magnetic beads to obtain the graphene oxide dispersion liquid;
preferably, the DNA supermolecule hydrogel is formed by complementary hybridization and self-assembly of cohesive ends of Y-DNA and L-DNA; wherein, the Y-DNA is a Y-type DNA monomer constructed by three DNA single-strands (Y1, Y2 and Y3); the L-DNA is a connector DNA monomer constructed by two DNA single strands (L1 and L2);
more preferably, the molar ratio of the Y-DNA to the L-DNA to the magnetic graphene oxide is 300-600: 900-1800: 1-2;
more preferably, the oligonucleotide chain sequence of the Y-DNA is:
Y1：5'-CACGGACTTGGATCCGCATAACCATTCGCCGTAATG-3'；
Y2：5'-CACGGACTCATTACGGCGAATGTACCGAATCAGCCT-3'；
Y3：5'-CACGGACTAGGCTGATTCGGTAGTTATGCGGATCCA-3'；
the sequence of the oligonucleotide chain of the L-DNA is as follows:
L1：
5'-AGTCCGTGGTAGGGCAGGTTGGGGTGACTGGTTGGTGTGGTTGG-3'；
L2：
5'-AGTCCGTGCCAACCACACCAACCAGTCACCCCAACCTGCCCTAC-3'。
the invention also provides a preparation method of the better magnetic DNA supermolecule hydrogel for loading the antitumor drug,
1. preparation of magnetic graphene oxide
Putting a certain amount of graphene oxide sheets in a beaker, adding secondary water for ultrasonic dissolution to obtain a brown solution, and centrifuging at 6000-6500 rpm for 10-15 min to obtain the graphene oxide sheet with the final concentration of 1-1.5 mg mL-1The graphene oxide suspension; taking 600-650 mu L of graphene oxide suspension, adding 600-650 mu L of EDC into the graphene oxide suspension, and oscillating and activating for 1-1.2 h at 35-37 ℃; adding 300-320 mu L of amino magnetic beads (the particle size is about 100nm) into the activated graphene oxide solution,carrying out oscillation reaction at 35-37 ℃ for 12-14 h; and performing magnetic separation on the prepared magnetic graphene oxide, washing the magnetic graphene oxide with secondary deionized water for three times, dispersing the washed magnetic graphene oxide in secondary water, and storing the magnetic graphene oxide at 4-5 ℃ for later use.
Preparation of Y-DNA and L-DNA
The DNA used in the experiment was TE buffered (10mM Tris-HCl buffer; 1mM EDTA disodium salt; 12.5mM MgCl)2pH 8.0). Annealing Y1, Y2 and Y3 (concentration ratio Y1: Y2: Y3 is 1: 1: 1, and the final concentration of each DNA is 50 mu M) and L1 and L2 (concentration ratio L1: L2 is 1: 1, and the final concentration of each DNA is 50 mu M) respectively, namely heating to 95 ℃ for 5min, and then slowly cooling to room temperature for 2h to form Y-DNA and L-DNA with stable structures for later use.
3. Preparation of magnetic DNA supermolecule hydrogel loaded with anti-tumor drug DOX
Adding a certain amount of the prepared Y-DNA, L-DNA and magnetic graphene oxide into a DOX solution, and then adding Du's buffer solution into a mixed system to ensure that the final concentrations of the Y-DNA, the L-DNA, the magnetic graphene oxide and the antitumor drug DOX are respectively 6-12 mu M, 18-36 mu M, 0.02-0.04 mu M and 600-1200 mu M. And (3) reacting the mixed system at 35-37 ℃ for 7-8.5 h, magnetically separating, and removing excessive DOX to prepare the magnetic DNA supermolecule hydrogel loaded with the anti-tumor drug DOX. And dispersing the prepared DOX-loaded magnetic DNA supermolecule hydrogel in a Du's phosphate buffer solution, and storing at 4-5 ℃ for later use.
The third aspect of the invention provides a magnetic DNA supramolecular hydrogel coated with horseradish peroxidase (HRP) based on the preparation of the magnetic DNA supramolecular hydrogel, and an application system for realizing high-sensitivity and high-selectivity detection of Adenosine Triphosphate (ATP). As shown in FIG. 5, two DNA monomers (Y-DNA 'and L-DNA') were prepared by designing a partial sequence of L1 in L-DNA as an ATP aptamer and modifying the other DNA sequences. The cross-linking effect of the Y-DNA 'and the L-DNA' is utilized to form the DNA hydrogel, and the HRP is coated in the DNA hydrogel. Further based on single-stranded DNA and magnetic oxidationAnd (3) carrying out pi-pi stacking action among the graphene, and adsorbing the DNA hydrogel coated with the HRP on the surface of the magnetic graphene oxide through the naked sticky tail end to prepare the magnetic DNA supermolecule hydrogel coated with the HRP. Based on the specific recognition effect of the aptamer and the target, when ATP exists, the ATP is specifically combined with an aptamer chain thereof to generate an ATP-aptamer complex, so that a DNA hydrogel structure is damaged, and the coated HRP is released. Magnetically separating, adding reaction substrate TMB/H into supernatant2O2And after the reaction is finished, detecting by using an ultraviolet-visible spectrophotometer so as to realize high-sensitivity and high-specificity quantitative analysis on ATP. In addition, the magnetic DNA supermolecule hydrogel coated with the HRP is prepared by the method, detection on other target substances can be realized by changing different aptamer sequences, and the method has wide applicability.
In order to achieve the purpose, the invention adopts the following scheme:
a horseradish peroxidase (HRP) -coated magnetic DNA supramolecular hydrogel, comprising:
DNA supermolecule hydrogel doped with magnetic graphene oxide;
horseradish peroxidase (HRP) coated in the DNA supermolecule hydrogel;
wherein, in the L-DNA' monomer forming the DNA supermolecule hydrogel, the single-stranded DNA connected with the Y-DNA contains an ATP aptamer sequence;
the DNA supermolecule hydrogel coated with the HRP is adsorbed on the surface of the magnetic graphene oxide.
The magnetic graphene oxide has a large specific surface area, and can load a large amount of DNA hydrogel. The application of the protein in ATP detection can obviously improve the detection sensitivity.
Preferably, the DNA supermolecule hydrogel is formed by complementary hybridization and self-assembly of cohesive ends of Y-DNA ' and L-DNA ', wherein the Y-DNA ' is a Y-DNA ' monomer constructed by three DNA single-strands (Y1', Y2' and Y3 '); the L-DNA ' is a connector DNA monomer constructed by two DNA single strands (L1' and L2 ');
more preferably, the molar ratio of the Y-DNA ', the L-DNA', the magnetic graphene oxide and the horseradish peroxidase (HRP) is 300-600: 900-1800: 1-2: 1250 to 2500.
More preferably, the oligonucleotide chain sequence of the Y-DNA' is:
Y1'：5'-TTGGACCCTGGATCCGCATAACCATTCGCCGTAATG-3'；
Y2'：5'-TTGGACCCCATTACGGCGAATGTACCGAATCAGCCT-3'；
Y3'：5'-TTGGACCCAGGCTGATTCGGTAGTTATGCGGATCCA-3'；
the sequence of the oligonucleotide chain of the L-DNA' is as follows:
L1'：
5'-GGGTCCAAGTGAAGAGTCTATTGAAGAATTCCAACCTGGGGGAGTATTGCGGAGGAAGGT-3'；
L2'：5'-GGAATTCTTCAATAGACTCTTCAC-3'。
the invention also provides a preparation method of the magnetic DNA supramolecular hydrogel coated with horseradish peroxidase (HRP), which comprises the following steps:
and (3) dispersing horseradish peroxidase (HRP), magnetic graphene oxide, and Y-DNA 'and L-DNA' which form the DNA supermolecule hydrogel into a buffer solution, uniformly mixing, and reacting at constant temperature to obtain the compound.
Preferably, the molar ratio of the Y-DNA ', the L-DNA', the magnetic graphene oxide and the horseradish peroxidase (HRP) is 300-600: 900-1800: 1-2: 1250 to 2500;
preferably, the constant-temperature reaction is carried out for 3-3.5 h under the condition of 35-37 ℃;
preferably, the specific preparation method of the magnetic graphene oxide is as follows: preparing graphene oxide dispersion liquid, activating, and reacting with amino magnetic beads to obtain the graphene oxide dispersion liquid;
preferably, the DNA supermolecule hydrogel is formed by complementary hybridization and self-assembly of cohesive ends of Y-DNA ' and L-DNA ', wherein the Y-DNA ' is a Y-type DNA monomer; the L-DNA ' is a connector DNA monomer constructed by two single strands (L1' and L2 ');
more preferably, the molar ratio of the Y-DNA ', the L-DNA' and the magnetic graphene oxide is 300-600: 900-1800: 1 to 2.
More preferably, the oligonucleotide chain sequence of the Y-DNA' is:
Y1'：5'-TTGGACCCTGGATCCGCATAACCATTCGCCGTAATG-3'；
Y2'：5'-TTGGACCCCATTACGGCGAATGTACCGAATCAGCCT-3'；
Y3'：5'-TTGGACCCAGGCTGATTCGGTAGTTATGCGGATCCA-3'；
the sequence of the oligonucleotide chain of the L-DNA' is as follows:
L1'：
5'-GGGTCCAAGTGAAGAGTCTATTGAAGAATTCCAACCTGGGGGAGTATTGCGGAGGAAGGT-3'；
L2'：5'-GGAATTCTTCAATAGACTCTTCAC-3'。
the invention also provides a preparation method of the better Horse Radish Peroxidase (HRP) coated magnetic DNA supramolecular hydrogel, which specifically comprises the following steps:
1. preparation of magnetic graphene oxide
Putting a certain amount of graphene oxide sheets in a beaker, adding secondary water for ultrasonic dissolution to obtain a brown solution, and centrifuging at 6000-6500 rpm for 10-15 min to obtain the graphene oxide sheet with the final concentration of 1-1.5 mg mL-1The graphene oxide suspension; taking 600-650 mu L of graphene oxide suspension, adding 600-650 mu L of EDC into the graphene oxide suspension, and oscillating and activating for 1-1.2 h at 35-37 ℃; adding 300-320 mu L of amino magnetic beads (the particle size is about 100nm) into the activated graphene oxide solution, and carrying out oscillation reaction at 35-37 ℃ for 12-14 h; performing magnetic separation on the prepared magnetic graphene oxide, washing with secondary deionized water for three times, and washingAnd dispersing the magnetic graphene oxide in secondary water, and storing at 4-5 ℃ for later use.
Preparation of Y-DNA' and L-DNA
The DNA used in the experiment was TE buffered (10mM Tris-HCl buffer; 1mM EDTA disodium salt; 12.5mM MgCl)2pH 8.0). Y1', Y2', Y3 '(concentration ratio Y1': Y2 ': Y3': 1: 1: 1, each DNA final concentration is 50 μ M) and L1 'and L2' (concentration ratio L1 ': L2': 1: 1, each DNA final concentration is 50 μ M) are respectively annealed, namely heated to 95 ℃ for 5min, and then cooled to room temperature for 2h to form Y-DNA 'and L-DNA' with stable structure for standby.
3. Preparation of HRP-coated magnetic DNA supramolecular hydrogel
Adding a certain amount of the prepared Y-DNA ', L-DNA' and magnetic graphene oxide into an HRP solution, and then adding a PBS (phosphate buffer solution) (pH 7.0) into a mixed system to ensure that the final concentrations of the Y-DNA ', the L-DNA', the magnetic graphene oxide and the horseradish peroxidase are respectively 6-12 mu M, 18-36 mu M, 0.02-0.04 mu M and 25-50 mu M. And reacting the mixed system at 35-37 ℃ for 3-3.2 h to prepare the magnetic DNA supermolecule hydrogel coated with the HRP.
The invention has the advantages of
(1) The invention provides a preparation method of magnetic DNA supermolecule hydrogel. The magnetic DNA supermolecule hydrogel is prepared by utilizing complementary hybridization self-assembly of the viscous ends of the Y-DNA and the L-DNA to form the DNA supermolecule hydrogel, and adsorbing the DNA hydrogel on the surface of the magnetic graphene oxide through the external exposed viscous end based on the pi-pi stacking effect between the single-stranded DNA and the magnetic graphene oxide.
(2) The invention provides a technical application of taking the magnetic DNA supermolecule hydrogel as a drug carrier. The method combines the antitumor drug with DNA nano structure with good biocompatibility and water solubility, and overcomes the defects of poor water solubility and stability of the drug; meanwhile, the method combines the advantages of easy separation and purification of the magnetic graphene oxide in the process of preparing the DNA drug-loaded nanostructure, provides a good application platform for constructing a highly ordered and accurately controlled nucleic acid drug carrier, and has a wide development prospect.
(3) The invention provides a magnetic DNA supramolecular hydrogel coated with horseradish peroxidase (HRP), which is an application system for realizing high-sensitivity and high-selectivity detection of Adenosine Triphosphate (ATP). The magnetic DNA supermolecule hydrogel coated with the HRP prepared by the method can realize detection of other target objects by changing the sequence of the aptamer, and has wide applicability.
(4) The preparation method is simple, high in detection efficiency, strong in practicability and easy to popularize.
Drawings
FIG. 1 is a schematic diagram of the preparation of magnetic DNA supramolecular hydrogel.
FIG. 2 is a schematic diagram of the use of magnetic DNA hydrogel for drug carriers.
FIG. 3 is to add DNase I with different concentrations into DOX-loaded magnetic DNA supramolecular hydrogel, and after the reaction is completed, the supernatant solution photo is obtained by magnetic separation. DNase I concentration (left to right): 0. 0.002U/. mu.L, 0.004U/. mu.L, 0.006U/. mu.L, 0.008U/. mu.L, 0.01U/. mu.L, 0.012U/. mu.L, 0.014U/. mu.L.
FIG. 4 is to add DNase I with different concentrations into DOX-loaded magnetic DNA supramolecular hydrogel, and after the reaction is completed, the supernatant solution is obtained by magnetic separation in an ultraviolet-visible spectrogram. DNase I concentration (from bottom to top, in peaks): 0. 0.002U/. mu.L, 0.004U/. mu.L, 0.006U/. mu.L, 0.008U/. mu.L, 0.01U/. mu.L, 0.012U/. mu.L, 0.014U/. mu.L.
FIG. 5 shows a schematic diagram of the use of HRP-coated magnetic DNA supramolecular hydrogel for ATP detection.
FIG. 6 different concentrations of ATP and TMB/H were added to the HRP-coated magnetic DNA hydrogel system2O2After the reaction was complete, the solution was a color photograph. ATP concentration (left to right): 0,2μM，4μM，6μM，8μM，10μM。
FIG. 7 different concentrations of ATP and TMB/H were added to the HRP-coated magnetic DNA hydrogel system2O2And after the reaction is finished, the ultraviolet-visible spectrum of the solution system. ATP concentration (from bottom to top, in peaks): 0, 2. mu.M, 4. mu.M, 6. mu.M, 8. mu.M, 10. mu.M.
FIG. 8 to a magnetic DNA hydrogel system coated with HRP, PBS buffer (i.e., blank), ATP analogue, and ATP (all at 8 μ M concentration), with TMB/H were added2O2Comparison of UV-visible absorbance at 450nm for the solution system after completion of the reaction.
Detailed Description
The features of the present invention and other related features are further described in detail below by way of examples to facilitate understanding by those skilled in the art:
example 1
A method for preparing magnetic DNA supermolecule hydrogel. As shown in FIG. 1, the experimental principle is that three single strands (Y1, Y2 and Y3) are used to construct Y-type DNA monomer (Y-DNA) and two single strands (L1 and L2) are used to construct linker DNA monomer (L-DNA) respectively; meanwhile, the magnetic graphene oxide is prepared by utilizing the amide reaction between the graphene oxide and the amino magnetic beads. The magnetic DNA supermolecule hydrogel is prepared by utilizing complementary hybridization self-assembly of the viscous ends of the Y-DNA and the L-DNA to form the DNA supermolecule hydrogel, and adsorbing the DNA hydrogel on the surface of the magnetic graphene oxide through the external exposed viscous end based on the pi-pi stacking effect between the single-stranded DNA and the magnetic graphene oxide.
The preparation method comprises the following steps:
1. preparation of magnetic graphene oxide
Putting a certain amount of graphene oxide sheets in a beaker, adding secondary water to the graphene oxide sheetsSonicating to obtain a brown solution, and centrifuging at 6000rpm for 10min to obtain a final concentration of 1mg mL-1The graphene oxide suspension; taking 600 mu L of graphene oxide suspension, adding 600 mu L of EDC into the graphene oxide suspension, and oscillating and activating the graphene oxide suspension for 1h at 37 ℃; adding 300 mu L of amino magnetic beads (the particle size is about 100nm) into the activated graphene oxide solution (note that the amino magnetic beads are cleaned by imidazole-hydrochloric acid buffer solution (1M, pH 6.8, ready for preparation) before use), and carrying out oscillation reaction at 37 ℃ for 12 h; and performing magnetic separation on the prepared magnetic graphene oxide, washing the magnetic graphene oxide with secondary deionized water for three times, dispersing the washed magnetic graphene oxide in secondary water, and storing the magnetic graphene oxide at 4 ℃ for later use.
Preparation of Y-DNA and L-DNA
The DNA used in the experiment was TE buffered (10mM Tris-HCl buffer; 1mM EDTA disodium salt; 12.5mM MgCl)2pH 8.0). Annealing Y1, Y2 and Y3 (concentration ratio Y1: Y2: Y3 is 1: 1: 1, and the final concentration of each DNA is 50 mu M) and L1 and L2 (concentration ratio L1: L2 is 1: 1, and the final concentration of each DNA is 50 mu M) respectively, namely heating to 95 ℃ for 5min, and then slowly cooling to room temperature for 2h to form Y-DNA and L-DNA with stable structures for later use.
3. Preparation of magnetic DNA supermolecule hydrogel
And (3) putting equal amounts of the prepared Y-DNA and L-DNA into a micro-centrifuge tube, adding a magnetic graphene oxide solution into the mixed system, and finally adding a PBS (phosphate buffer solution) (pH 7.0) to ensure that the final concentrations of the Y-DNA, the L-DNA and the magnetic graphene oxide are 6 mu M, 18 mu M and 0.02 mu M respectively. And reacting the mixed system at 37 ℃ for 3h to obtain the magnetic DNA supermolecule hydrogel.
Example 2
A technical application of taking the magnetic DNA supermolecule hydrogel as a drug carrier. The principle is shown in figure 2, based on the cross-linking effect of Y-DNA and L-DNA, the self-assembly forms DNA supermolecule hydrogel, combines the adsorption effect of magnetic graphene oxide on single-chain DNA, and exposes out through the DNA hydrogelThe magnetic DNA supermolecule hydrogel is prepared by adsorbing the DNA supermolecule hydrogel on the surface of the magnetic graphene oxide through the viscous end, and the magnetic DNA supermolecule hydrogel is prepared in the first aspect of the patent. Further, by utilizing the property that an antitumor drug Doxorabicin (DOX) can be inserted into the DNA double-chain structure, the antitumor drug DOX is embedded into the DNA double-chain structure of the magnetic DNA supramolecular hydrogel, and the magnetic DNA supramolecular hydrogel drug carrier loaded with the antitumor drug DOX is prepared. Because Deoxyribonuclease I (DNase I for short) is in neutral environment and has Mg2+In the presence of the oligonucleotide, double-stranded DNA can be non-specifically hydrolyzed to produce an oligonucleotide having a 5 'phosphate terminus and a 3' hydroxyl terminus. Therefore, after DNase I is added into the system, the DNase I hydrolyzes the DOX-loaded DNA supermolecule hydrogel into DNA fragments, so that the loaded anti-tumor drug DOX is released, and drug release is realized. The method combines the antitumor drug with DNA nano structure with good biocompatibility and water solubility, and overcomes the defects of poor water solubility and stability of the drug; meanwhile, the method combines the advantages of easy separation and purification of the magnetic graphene oxide in the process of preparing the DNA drug-loaded nanostructure, provides a good application platform for constructing a highly ordered and accurately controlled nucleic acid drug carrier, and has a wide development prospect.
The preparation method comprises the following steps:
oligonucleotide chain sequences used in Table 1-1
Name (R) Sequence (5'-3')
Y1 CACGGACTTGGATCCGCATAACCATTCGCCGTAATG
Y2 CACGGACTCATTACGGCGAATGTACCGAATCAGCCT
Y3 CACGGACTAGGCTGATTCGGTAGTTATGCGGATCCA
L1 AGTCCGTGGTAGGGCAGGTTGGGGTGACTGGTTGGTGTGGTTGG
L2 AGTCCGTGCCAACCACACCAACCAGTCACCCCAACCTGCCCTAC
1. Preparation of magnetic graphene oxide
Putting a certain amount of graphene oxide sheets in a beaker, adding secondary water for ultrasonic dissolution to obtain a brown solution, and centrifuging at 6000rpm for 10min to obtain the graphene oxide sheet with the final concentration of 1mg mL-1The graphene oxide suspension; taking 600 mu L of graphene oxide suspension, adding 600 mu L of EDC into the graphene oxide suspension, and oscillating and activating the graphene oxide suspension for 1h at 37 ℃; adding 300 mu L of amino magnetic beads (the particle size is about 100nm) into the activated graphene oxide solution (note that the amino magnetic beads are cleaned by imidazole-hydrochloric acid buffer solution (1M, pH 6.8, ready for preparation) before use), and carrying out oscillation reaction at 37 ℃ for 12 h; and performing magnetic separation on the prepared magnetic graphene oxide, washing the magnetic graphene oxide with secondary deionized water for three times, dispersing the washed magnetic graphene oxide in secondary water, and storing the magnetic graphene oxide at 4 ℃ for later use.
Preparation of Y-DNA and L-DNA
The DNA used in the experiment was TE buffered (10mM Tris-HCl buffer; 1mM EDTA disodium salt; 12.5mM MgCl)2pH 8.0). Y1, Y2 and Y3 (concentration ratio Y1: Y2: Y3 is 1: 1: 1, and the final concentration of each DNA is 50 mu M) and L1 and L2 (concentration ratio L1: L2 is 1: 1, and the final concentration of each DNA is 1: 1)50 mu M), namely heating to 95 ℃ for 5min, and then slowly cooling to room temperature for 2h to form Y-DNA and L-DNA with stable structures for later use.
3. Preparation of DOX magnetic DNA supermolecule hydrogel loaded with anti-tumor drug
Adding a certain amount of the prepared Y-DNA, L-DNA and magnetic graphene oxide into a DOX solution, and then adding Du's buffer solution into a mixed system to ensure that the final concentrations of the Y-DNA, the L-DNA, the magnetic graphene oxide and the antitumor drug DOX are respectively 6 mu M, 18 mu M, 0.02 mu M and 600 mu M. Reacting the mixed system for 7 hours at 37 ℃, performing magnetic separation, and removing excessive DOX to prepare the magnetic DNA supramolecular hydrogel loaded with the anti-tumor drug DOX. And dispersing the prepared DOX-loaded magnetic DNA supermolecule hydrogel in a Du's phosphate buffer solution, and storing at 4 ℃ for later use.
4. Detection of drug release
500. mu.L of the DOX-loaded magnetic DNA supramolecular hydrogel prepared as above was placed in 8 centrifuge tubes, 50. mu.L of DNase I was added to the tubes at concentrations of 0, 0.002U/. mu.L, 0.004U/. mu.L, 0.006U/. mu.L, 0.008U/. mu.L, 0.01U/. mu.L, 0.012U/. mu.L, and 0.014U/. mu.L, respectively, wherein the DNase I was dispersed in 1 Xdigestion buffer (10mM Tris solution, 0.5mM Ca. mu.L)2+、2.5mM Mg2+pH 7.4). The final volume was made up to 1mL by adding Du's phosphate buffer and the reaction was allowed to react at 37 ℃ for 1 h. After the reaction is finished, performing magnetic separation, taking an equal amount of supernatant, adding Du's phosphate buffer to supplement the final volume to 2mL, and detecting in an ultraviolet-visible spectrophotometer.
5. Experimental results and discussion
DNase I solutions with different concentrations (the concentrations are 0, 0.002U/. mu.L, 0.004U/. mu.L, 0.006U/. mu.L, 0.008U/. mu.L, 0.01U/. mu.L, 0.012U/. mu.L and 0.014U/. mu.L in sequence) are added into the DOX-loaded magnetic DNA supramolecular hydrogel and reacted for 1h at 37 ℃. After the reaction was completed, magnetic separation was performed, and the supernatant was taken and added to a Duchen phosphate buffer solution to make up the final volume to 2mL, and then the color of the solution was observed. As shown in FIG. 3, the supernatant was orange-red (i.e., DOX color) and the color gradually increased with the increase of the concentration of DNase I added, indicating that after DNase I was added, the double-stranded structure of the DNA hydrogel was hydrolyzed by DNase I into oligonucleotide fragments, DOX intercalated in the DNA double strand was released, and the concentration of released DOX increased with the increase of the amount of DNase I added. Further, ultraviolet-visible absorption detection is carried out on the obtained supernatant by using an ultraviolet-visible spectrophotometer. As shown in fig. 4, as the concentration of added DNase I increases, the uv-visible absorbance of the corresponding supernatant at 480nm increases in turn, further illustrating that the released DOX concentration is in positive correlation with the amount of added DNase I, thus confirming the feasibility of using the magnetic DNA supramolecular hydrogel for drug carriers.
Example 3
A magnetic DNA supramolecular hydrogel coated with horseradish peroxidase (HRP) realizes an application system for high-sensitivity and high-selectivity detection of Adenosine Triphosphate (ATP). As shown in FIG. 5, two DNA monomers (Y-DNA 'and L-DNA') were prepared by designing a partial sequence of L1 in L-DNA as an ATP aptamer and modifying the other DNA sequences. The cross-linking effect of the Y-DNA 'and the L-DNA' is utilized to form the DNA hydrogel, and the HRP is coated in the DNA hydrogel. Further based on the pi-pi stacking effect between the single-stranded DNA and the magnetic graphene oxide, the HRP-coated DNA hydrogel is adsorbed on the surface of the magnetic graphene oxide through a naked sticky end to prepare the HRP-coated magnetic DNA supramolecular hydrogel. Based on the specific recognition effect of the aptamer and the target, when ATP exists, the ATP is specifically combined with an aptamer chain to generate an ATP-aptamer complex, and a DNA hydrogel structure is damaged, so that the HRP is released. Magnetically separating, adding reaction substrate TMB/H into supernatant2O2And after the reaction is finished, detecting by using an ultraviolet-visible spectrophotometer so as to realize high-sensitivity and high-specificity quantitative analysis on ATP. In addition, the magnetic DNA supermolecule hydrogel coated with the HRP is prepared by the method, detection on other targets can be realized by changing different aptamer sequences, and the method has wide applicability.
The preparation method comprises the following steps:
oligonucleotide and aptamer chain sequences used in tables 1-2
1. Preparation of magnetic graphene oxide
Putting a certain amount of graphene oxide sheets in a beaker, adding secondary water for ultrasonic dissolution to obtain a brown solution, and centrifuging at 6000rpm for 10min to obtain the graphene oxide sheet with the final concentration of 1mg mL-1The graphene oxide suspension; taking 600 mu L of graphene oxide suspension, adding 600 mu L of EDC into the graphene oxide suspension, and oscillating and activating for 1h at 37 ℃; adding 300 mu L of amino magnetic beads (the particle size is about 100nm) washed by imidazole-hydrochloric acid buffer solution (1M, pH is 6.8, ready for preparation) into the activated graphene oxide solution, and carrying out oscillation reaction at 37 ℃ for 12 h; and performing magnetic separation on the prepared magnetic graphene oxide, washing the magnetic graphene oxide with secondary deionized water for three times, dispersing the washed magnetic graphene oxide in secondary water, and storing the magnetic graphene oxide at 4 ℃ for later use.
Preparation of Y-DNA' and L-DNA
The DNA used in the experiment was TE buffered (10mM Tris-HCl buffer; 1mM EDTA disodium salt; 12.5mM MgCl)2pH 8.0). Y1', Y2', Y3 '(concentration ratio Y1': Y2 ': Y3': 1: 1: 1, each DNA final concentration is 50 μ M) and L1 'and L2' (concentration ratio L1 ': L2': 1: 1, each DNA final concentration is 50 μ M) are respectively annealed, namely heated to 95 ℃ for 5min, and then cooled to room temperature for 2h to form Y-DNA 'and L-DNA' with stable structure for standby.
3. Preparation of HRP-coated magnetic DNA supramolecular hydrogel
A certain amount of the prepared Y-DNA ', L-DNA' and magnetic graphene oxide are added into an HRP solution, and then PBS buffer solution (pH 7.0) is added into a mixed system to ensure that the final concentrations of the Y-DNA ', the L-DNA', the magnetic graphene oxide and the horseradish peroxidase are respectively 6 mu M, 18 mu M, 0.02 mu M and 25 mu M. The mixed system reacts for 3 hours at 37 ℃ to prepare the magnetic DNA supermolecule hydrogel coated with the HRP.
ATP detection
100 mu L of Adenosine Triphosphate (ATP) standard solutions with different concentrations are respectively added into a magnetic DNA supermolecule hydrogel system coated with HRP, and the reaction is carried out for 1h at 25 ℃. After the reaction, the reaction mixture was magnetically separated, and 50. mu.L of the supernatant was transferred, to which 10. mu.L of a 0.5% TMB solution and 20. mu.L of 30% H solution were added2O2Solution, 920. mu.L buffer (26.6mM citric acid, 51.4mM Na)2HPO415mM KCl, pH5.0), after 15min of reaction, 500. mu.L of 2M H was added, respectively2SO4The reaction was terminated, and 500. mu.L of buffer (pH5.0) was added to make up to a final volume of 2mL, and UV-visible absorption was detected using a UV-visible spectrophotometer.
5. Specificity detection
Adding 100 μ L PBS buffer, ATP analogue (uridine triphosphate (UTP), Cytidine Triphosphate (CTP), Guanosine Triphosphate (GTP) with concentration of 8 μ M) and target ATP with concentration of 8 μ M into magnetic DNA supramolecular hydrogel system coated with HRP, reacting at 25 deg.C for 1H, magnetically separating, collecting 50 μ L supernatant, adding 10 μ L0.5% TMB solution and 20 μ L30% H2O2Solution, 920. mu.L buffer (26.6mM citric acid, 51.4mM Na)2HPO415mM KCl, pH5.0), after 15min of reaction, 500. mu.L of 2M H was added, respectively2SO4The reaction was terminated and then 500. mu.L of buffer (pH5.0) was added to make up to a final volume of 2mL and UV-visible absorbance measurements were performed using a UV-visible spectrophotometer.
6. Experimental results and discussion
Adding a certain amount of Y-DNA ', L-DNA', magnetic graphene oxide and PBS buffer solution (pH 7.0) into the HRP solution, and reacting the mixed system at 37 ℃ for 3h to prepare the magnetic DNA supramolecular hydrogel coated with the HRP.
Mixing different concentrations of ATP standard solution (The concentration is 0, 2 muM, 4 muM, 6 muM, 8 muM and 10 muM) in sequence, and the mixture is added into a magnetic DNA hydrogel system coated with HRP, and after reaction for 1h at 25 ℃, the mixture is magnetically separated, and supernatant is taken. Adding TMB solution and H into the supernatant2O2The solution was reacted for 15min, then sulfuric acid was added to terminate the reaction, buffer (pH5.0) was added to make up the final volume to 2mL, and the color of the solution system was observed. As shown in FIG. 6, the solution was yellow and the color gradually deepened with the increase of the concentration of added ATP, indicating that the HRP coated in the DNA hydrogel was released after the addition of ATP and the concentration of the released HRP increased with the increase of the concentration of added ATP. And (3) performing ultraviolet-visible absorption detection by using an ultraviolet-visible spectrophotometer, wherein the result is shown in fig. 7, and as the concentration of the added ATP increases, the ultraviolet-visible absorbance of the supernatant at 450nm sequentially increases, which further indicates that the concentration of the released HRP is in positive correlation with the concentration of the added ATP, so that high-sensitivity quantitative detection on the ATP is realized.
In order to verify the specificity of the system for detecting ATP, equal volume of PBS buffer solution (blank), ATP analogues (UTP, CTP and GTP, the concentration is 8 mu M) and a target ATP (the concentration is 8 mu M) are respectively added into the prepared magnetic DNA hydrogel coated with the HRP, and an ultraviolet-visible absorption detection is carried out by using an ultraviolet-visible spectrophotometer. The result is shown in fig. 8, the ultraviolet-visible absorbance of the solution at 450nm after adding ATP analogs (UTP, CTP, GTP) to the system for reaction is not significantly changed compared to the blank sample; when the target ATP is added, the ultraviolet-visible absorbance of the solution at 450nm after the reaction is obviously increased, which indicates that the method has good specificity.
Example 4
A preparation method of magnetic DNA supermolecule hydrogel comprises the following specific steps:
1. preparation of magnetic graphene oxide
Putting a certain amount of graphene oxide sheets in a beaker, adding secondary water for ultrasonic dissolution to obtain a brown solution, and centrifuging at 6500rpmThe final concentration is 1.5mg mL in 15min-1The graphene oxide suspension; taking 650 mu L of graphene oxide suspension, adding 650 mu L of EDC into the graphene oxide suspension, and carrying out oscillation activation for 1.2h at 35 ℃; adding 320 mu L of amino magnetic beads (the particle size is about 100nm) into the activated graphene oxide solution, and carrying out oscillation reaction at 35 ℃ for 14 h; and performing magnetic separation on the prepared magnetic graphene oxide, washing the magnetic graphene oxide with secondary deionized water for three times, dispersing the washed magnetic graphene oxide in secondary water, and storing the magnetic graphene oxide at 5 ℃ for later use.
Preparation of Y-DNA and L-DNA
The DNA used in the experiment was TE buffered (10mM Tris-HCl buffer; 1mM EDTA disodium salt; 12.5mM MgCl)2pH 8.0). Annealing Y1, Y2 and Y3 (concentration ratio Y1: Y2: Y3 is 1: 1: 1, and the final concentration of each DNA is 50 mu M) and L1 and L2 (concentration ratio L1: L2 is 1: 1, and the final concentration of each DNA is 50 mu M) respectively, namely heating to 95 ℃ for 5min, and then slowly cooling to room temperature for 2h to form Y-DNA and L-DNA with stable structures for later use.
3. Preparation of magnetic DNA supermolecule hydrogel
And (3) putting equal amounts of the prepared Y-DNA and L-DNA into a micro-centrifuge tube, adding a magnetic graphene oxide solution into the mixed system, and finally adding a PBS (phosphate buffer solution) (pH 7.0) to ensure that the final concentrations of the Y-DNA, the L-DNA and the magnetic graphene oxide are 12 mu M, 36 mu M and 0.04 mu M respectively. And reacting the mixed system at 36 ℃ for 4h to obtain the magnetic DNA supermolecule hydrogel.
Example 5
A method for preparing better magnetic DNA supermolecule hydrogel for loading antitumor drugs,
1. preparation of magnetic graphene oxide
Putting a certain amount of graphene oxide sheets in a beaker, adding secondary water for ultrasonic dissolution to obtain a brown solution, and centrifuging at 6500rpm for 15min to obtain the final concentration of 1.5mg mL-1Of (2) an oxidized stoneAn graphene suspension; taking 650 mu L of graphene oxide suspension, adding 650 mu L of EDC into the graphene oxide suspension, and carrying out oscillation activation for 1.2h at 35 ℃; adding 320 mu L of amino magnetic beads (the particle size is about 100nm) into the activated graphene oxide solution, and carrying out oscillation reaction at 35 ℃ for 14 h; and performing magnetic separation on the prepared magnetic graphene oxide, washing the magnetic graphene oxide with secondary deionized water for three times, dispersing the washed magnetic graphene oxide in secondary water, and storing the magnetic graphene oxide at 5 ℃ for later use.
Preparation of Y-DNA and L-DNA
The DNA used in the experiment was TE buffered (10mM Tris-HCl buffer; 1mM EDTA disodium salt; 12.5mM MgCl)2pH 8.0). Annealing Y1, Y2 and Y3 (concentration ratio Y1: Y2: Y3 is 1: 1: 1, and the final concentration of each DNA is 50 mu M) and L1 and L2 (concentration ratio L1: L2 is 1: 1, and the final concentration of each DNA is 50 mu M) respectively, namely heating to 95 ℃ for 5min, and then slowly cooling to room temperature for 2h to form Y-DNA and L-DNA with stable structures for later use.
3. Preparation of E-ADM magnetic DNA supermolecule hydrogel loaded with antitumor drug
Adding a certain amount of the prepared Y-DNA ', L-DNA ' and magnetic graphene oxide into an E-ADM solution, and then adding Du's buffer solution into a mixed system to ensure that the final concentrations of the Y-DNA, the L-DNA, the magnetic graphene oxide and the antitumor drug E-ADM are respectively 12 mu M, 36 mu M, 0.04 mu M and 1200 mu M. Reacting the mixed system for 6 hours at 37 ℃, performing magnetic separation, and removing excessive antitumor drugs to prepare the magnetic DNA supramolecular hydrogel loaded with the antitumor drugs. And dispersing the prepared E-ADM-loaded magnetic DNA supermolecule hydrogel in Du's phosphate buffer, and storing at 5 ℃ for later use.
Example 6
A method for preparing better magnetic DNA supermolecule hydrogel for loading antitumor drugs,
1. preparation of magnetic graphene oxide
Mixing a certain amount ofPlacing graphene oxide sheets in a beaker, adding secondary water for ultrasonic dissolution to obtain a brown solution, and centrifuging at 6500rpm for 15min to obtain a final concentration of 1.5mg mL-1The graphene oxide suspension; taking 650 mu L of graphene oxide suspension, adding 650 mu L of EDC into the graphene oxide suspension, and carrying out oscillation activation for 1.2h at 35 ℃; adding 320 mu L of amino magnetic beads (the particle size is about 100nm) into the activated graphene oxide solution, and carrying out oscillation reaction at 35 ℃ for 14 h; and performing magnetic separation on the prepared magnetic graphene oxide, washing the magnetic graphene oxide with secondary deionized water for three times, dispersing the washed magnetic graphene oxide in secondary water, and storing the magnetic graphene oxide at 5 ℃ for later use.
Preparation of Y-DNA and L-DNA
The DNA used in the experiment was TE buffered (10mM Tris-HCl buffer; 1mM EDTA disodium salt; 12.5mM MgCl)2pH 8.0). Annealing Y1, Y2 and Y3 (concentration ratio Y1: Y2: Y3 is 1: 1: 1, and the final concentration of each DNA is 50 mu M) and L1 and L2 (concentration ratio L1: L2 is 1: 1, and the final concentration of each DNA is 50 mu M) respectively, namely heating to 95 ℃ for 5min, and then slowly cooling to room temperature for 2h to form Y-DNA and L-DNA with stable structures for later use.
3. Preparation of THP magnetic DNA supermolecule hydrogel loaded with anti-tumor drug
Adding a certain amount of the prepared Y-DNA ', L-DNA ' and magnetic graphene oxide into the THP solution, and then adding Du's buffer solution into the mixed system to ensure that the final concentrations of the Y-DNA, the L-DNA, the magnetic graphene oxide and the anti-tumor drug THP are respectively 12 mu M, 36 mu M, 0.04 mu M and 1200 mu M. Reacting the mixed system for 6 hours at 37 ℃, performing magnetic separation, and removing excessive antitumor drugs to prepare the magnetic DNA supramolecular hydrogel loaded with the antitumor drugs. Dispersing the prepared THP-loaded magnetic DNA supermolecule hydrogel in Du's phosphate buffer solution, and storing at 5 ℃ for later use.
Example 7
A preparation method of a magnetic DNA supramolecular hydrogel coated with horseradish peroxidase (HRP) specifically comprises the following steps:
1. preparation of magnetic graphene oxide
Putting a certain amount of graphene oxide sheets in a beaker, adding secondary water for ultrasonic dissolution to obtain a brown solution, and centrifuging at 6500rpm for 15min to obtain the final concentration of 1.5mg mL-1The graphene oxide suspension; taking 650 mu L of graphene oxide suspension, adding 650 mu L of EDC into the graphene oxide suspension, and carrying out oscillation activation for 1.2h at 35 ℃; adding 320 mu L of amino magnetic beads (the particle size is about 100nm) into the activated graphene oxide solution, and carrying out oscillation reaction at 35 ℃ for 14 h; and performing magnetic separation on the prepared magnetic graphene oxide, washing the magnetic graphene oxide with secondary deionized water for three times, dispersing the washed magnetic graphene oxide in secondary water, and storing the magnetic graphene oxide at 5 ℃ for later use.
Preparation of Y-DNA' and L-DNA
The DNA used in the experiment was TE buffered (10mM Tris-HCl buffer; 1mM EDTA disodium salt; 12.5mM MgCl)2pH 8.0). Y1', Y2', Y3 '(concentration ratio Y1': Y2 ': Y3': 1: 1: 1, each DNA final concentration is 50 μ M) and L1 'and L2' (concentration ratio L1 ': L2': 1: 1, each DNA final concentration is 50 μ M) are respectively annealed, namely heated to 95 ℃ for 5min, and then cooled to room temperature for 2h to form Y-DNA 'and L-DNA' with stable structure for standby.
3. Preparation of HRP-coated magnetic DNA supramolecular hydrogel
A certain amount of the prepared Y-DNA ', L-DNA' and magnetic graphene oxide are added into an HRP solution, and then PBS buffer solution (pH 7.0) is added into a mixed system, so that the final concentrations of the Y-DNA ', the L-DNA', the magnetic graphene oxide and horseradish peroxidase are respectively 12 mu M, 36 mu M, 0.04 mu M and 50 mu M. The mixed system reacts for 3.2 hours at 36 ℃ to prepare the magnetic DNA supermolecule hydrogel coated with the HRP.
It should be noted that the above-mentioned embodiments are only preferred embodiments of the present invention, and the present invention is not limited thereto, and although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that modifications and equivalents can be made in the technical solutions described in the foregoing embodiments, or equivalents thereof. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention. Although the embodiments of the present invention have been described with reference to the accompanying drawings, it is not intended to limit the scope of the present invention, and it should be understood by those skilled in the art that various modifications and variations can be made without inventive efforts by those skilled in the art based on the technical solution of the present invention.

Claims (8)

1. A magnetic DNA supramolecular hydrogel, comprising:
DNA supermolecule hydrogel doped with magnetic graphene oxide;
the DNA supermolecule hydrogel is adsorbed on the surface of the magnetic graphene oxide;
the DNA supermolecule hydrogel is formed by complementary hybridization and self-assembly of viscous ends of Y-DNA and L-DNA, wherein the Y-DNA is a Y-type DNA monomer constructed by three single-chains Y1, Y2 and Y3; the L-DNA is a connector DNA monomer constructed by two single-stranded L1 and L2;
the molar ratio of the Y-DNA to the L-DNA to the magnetic graphene oxide is 300-600: 900-1800: 1 to 2.
2. A method for preparing the magnetic DNA supramolecular hydrogel according to claim 1, which comprises:
dispersing the magnetic graphene oxide, the Y-DNA and the L-DNA in a buffer solution, uniformly mixing, and reacting at constant temperature to obtain the magnetic graphene oxide-DNA-L-graphene material.
3. The method according to claim 2, wherein the isothermal reaction conditions are 35 to 37oC, reacting for 3-3.5 h;
the specific preparation method of the magnetic graphene oxide comprises the following steps: preparing graphene oxide dispersion liquid, activating, and reacting with amino magnetic beads to obtain the graphene oxide dispersion liquid;
the buffer solution is PBS buffer solution, pH 7.0.
4. The method of claim 2,
the oligonucleotide chain sequence of the Y-DNA is as follows:
Y1：5'-CACGGACTTGGATCCGCATAACCATTCGCCGTAATG-3'；
Y2：5'-CACGGACTCATTACGGCGAATGTACCGAATCAGCCT-3'；
Y3：5'-CACGGACTAGGCTGATTCGGTAGTTATGCGGATCCA-3'；
the sequence of the oligonucleotide chain of the L-DNA is as follows:
L1：
5'-AGTCCGTGGTAGGGCAGGTTGGGGTGACTGGTTGGTGTGGTTGG-3'；
L2：
5'-AGTCCGTGCCAACCACACCAACCAGTCACCCCAACCTGCCCTAC-3'。
5. the magnetic DNA supermolecule hydrogel for loading the antitumor drug is characterized by comprising the following components:
DNA supermolecule hydrogel doped with magnetic graphene oxide;
the anti-tumor drug is loaded on the magnetic DNA supermolecule hydrogel;
wherein the DNA supermolecule hydrogel adhesive tail end is adsorbed on the surface of the magnetic graphene oxide;
the DNA supermolecule hydrogel is formed by complementary hybridization and self-assembly of viscous ends of Y-DNA and L-DNA, wherein the Y-DNA is a Y-type DNA monomer constructed by three single-chains Y1, Y2 and Y3; the L-DNA is a connector DNA monomer constructed by two single-stranded L1 and L2;
the molar ratio of the Y-DNA monomer to the L-DNA monomer to the magnetic graphene oxide to the antitumor drug is 300-600: 900-1800: 1-2: 3X 104~6×104；
The antitumor drug is DOX, E-ADM and THP.
6. The preparation method of the anti-tumor drug-loaded magnetic DNA supramolecular hydrogel disclosed by claim 5, which is characterized by comprising the following steps:
dispersing the magnetic graphene oxide, the Y-DNA, the L-DNA and the antitumor drug in a buffer solution, uniformly mixing, and reacting at constant temperature to obtain the magnetic DNA supermolecule hydrogel loaded with the antitumor drug.
7. A magnetic DNA supramolecular hydrogel coated with horseradish peroxidase (HRP) is characterized by comprising:
DNA supermolecule hydrogel doped with magnetic graphene oxide;
horse Radish Peroxidase (HRP) coated in the DNA supramolecular hydrogel;
wherein,
the adhesive tail end of the DNA supermolecule hydrogel is adsorbed on the surface of the magnetic graphene oxide;
the DNA supermolecule hydrogel is formed by complementary hybridization and self-assembly of viscous ends of Y-DNA 'and L-DNA', wherein the Y-DNA 'is a Y-type DNA monomer constructed by three single-stranded monomers of Y1', Y2 'and Y3'; the L-DNA ' is a connector DNA monomer constructed by two single-stranded L1' and L2 ';
in the L-DNA 'monomer forming the DNA supermolecule hydrogel, single-stranded DNA connected with Y-DNA' contains an ATP aptamer sequence;
wherein the molar ratio of the Y-DNA 'monomer to the L-DNA' monomer to the magnetic graphene oxide is 300-600: 900-1800: 1 to 2.
8. The preparation method of the horseradish peroxidase HRP-coated magnetic DNA supramolecular hydrogel of claim 7 is characterized by comprising the following steps:
and (3) dispersing horseradish peroxidase (HRP), magnetic graphene oxide, Y-DNA 'and L-DNA' in a buffer solution, uniformly mixing, and reacting at constant temperature to obtain the compound enzyme.
CN201610860783.XA 2016-09-28 2016-09-28 A kind of preparation method and applications of magnetic DNA supramolecular hydrogel Active CN106397796B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610860783.XA CN106397796B (en) 2016-09-28 2016-09-28 A kind of preparation method and applications of magnetic DNA supramolecular hydrogel

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610860783.XA CN106397796B (en) 2016-09-28 2016-09-28 A kind of preparation method and applications of magnetic DNA supramolecular hydrogel

Publications (2)

Publication Number Publication Date
CN106397796A CN106397796A (en) 2017-02-15
CN106397796B true CN106397796B (en) 2019-02-19

Family

ID=58015650

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610860783.XA Active CN106397796B (en) 2016-09-28 2016-09-28 A kind of preparation method and applications of magnetic DNA supramolecular hydrogel

Country Status (1)

Country Link
CN (1) CN106397796B (en)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107569448B (en) * 2017-09-06 2020-08-25 青岛大学 Preparation method and application of self-assembled DNA hydrogel
CN109554331B (en) * 2017-09-27 2022-09-27 清华大学 L-nucleic acid hydrogels
CN109234263A (en) * 2018-09-27 2019-01-18 福建海峡石墨烯产业技术研究院有限公司 A method of the crosslinked action immobilized enzyme based on adenosine monophosphate and graphene
CN109576256B (en) * 2018-12-03 2022-05-13 北京化工大学 Method for encapsulating double enzymes by magnetic DNA hydrogel
CN109781688B (en) * 2019-01-18 2021-06-08 青岛科技大学 Construction method of DNA silicon nano hydrogel and method for detecting ATP in cells in ratio mode
CN110272982A (en) * 2019-06-11 2019-09-24 天津大学 A kind of magnetic DNA hydrogel and preparation method thereof
CN112844325B (en) * 2020-09-15 2022-01-28 海南大学 Specific DNA hydrogel material for extracting uranium from seawater and preparation method thereof
CN113702462B (en) * 2021-08-15 2023-10-20 厦门大学附属第一医院 Preparation method of double-strand specific nuclease-assisted controlled release electrochemical DNA hydrogel composite material
CN113774055B (en) * 2021-09-16 2024-05-10 湖南大学 Nucleic acid nanogel and preparation method and application thereof
CN115054569B (en) * 2022-05-16 2024-03-19 四川大学华西医院 DNA hydrogel for treating alveolar bone injury and preparation method and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102274521A (en) * 2011-08-25 2011-12-14 天津医科大学 Graphene oxide-based target gene vector material and preparation and use thereof
CN102949727A (en) * 2012-12-12 2013-03-06 天津医科大学 Common carrier material for targeting anticancer drug and gene and preparation and application
CN104086786A (en) * 2014-07-17 2014-10-08 厦门大学 Preparation method and application of hydrogel electrode
CN104165912A (en) * 2013-06-26 2014-11-26 江南大学 Preparation method and use of graphene oxide surface molecularly imprinted sol-gel polymer

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102274521A (en) * 2011-08-25 2011-12-14 天津医科大学 Graphene oxide-based target gene vector material and preparation and use thereof
CN102949727A (en) * 2012-12-12 2013-03-06 天津医科大学 Common carrier material for targeting anticancer drug and gene and preparation and application
CN104165912A (en) * 2013-06-26 2014-11-26 江南大学 Preparation method and use of graphene oxide surface molecularly imprinted sol-gel polymer
CN104086786A (en) * 2014-07-17 2014-10-08 厦门大学 Preparation method and application of hydrogel electrode

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
"DNA水凝胶的制备及生物应用";宋萍等;《化学进展》;20160515;第28卷(第5期);第628-636页 *
"DNA超分子水凝胶";邵昱等;《高分子通报》;20150930(第9期);第100-108页 *
"Self-Assembled DNA Hydrogels with Designable Thermal and Enzymatic Responsiveness";Yongzheng Xing等;《Adv. Mater.》;20101222;第23卷;第1117-1121页 *
"Three-Dimensional Self-Assembly of Graphene Oxide and DNA into Multifunctional Hydrogels";Yuxi Xu等;《ACS Nano》;20101116;第4卷(第12期);第7358-7362页 *
"刺激响应型DNA水凝胶及其在生物传感和药物控制方面的应用";赵海旭等;《沈阳药科大学学报》;20150228;第32卷(第2期);第161-168页 *
"基于核酸适体检测ATP的酶联分析新方法";赵秋伶等;《高等学校化学学报》;20140630;第35卷(第6期);第1161-1165页 *
"磁性氧化石墨烯的制备方法及其复合材料的应用研究";王乐乐等;《江西化工》;20160630(第3期);第1-5页 *

Also Published As

Publication number Publication date
CN106397796A (en) 2017-02-15

Similar Documents

Publication Publication Date Title
CN106397796B (en) A kind of preparation method and applications of magnetic DNA supramolecular hydrogel
Liu et al. Polyamidoamine dendrimer and oleic acid-functionalized graphene as biocompatible and efficient gene delivery vectors
Teradal et al. Carbon nanomaterials in biological studies and biomedicine
Wen et al. Recent applications of carbon nanomaterials in fluorescence biosensing and bioimaging
Meng et al. Bioorthogonal DNA adsorption on polydopamine nanoparticles mediated by metal coordination for highly robust sensing in serum and living cells
Mehra et al. A review of ligand tethered surface engineered carbon nanotubes
Wu et al. Aptamers: active targeting ligands for cancer diagnosis and therapy
Liu et al. Intracellular detection of ATP using an aptamer beacon covalently linked to graphene oxide resisting nonspecific probe displacement
Yang et al. Aptamer-conjugated nanomaterials and their applications
Muazim et al. Graphene oxide—A platform towards theranostics
Zeng et al. Multifunctional surface modification of nanodiamonds based on dopamine polymerization
Ma et al. Label-free bioassay with graphene oxide-based fluorescent aptasensors: A review
Cui et al. Graphene oxide protected nucleic acid probes for bioanalysis and biomedicine
Xu et al. Continuously tunable nucleotide/lanthanide coordination nanoparticles for DNA adsorption and sensing
Akbarinejad et al. Novel electrochemically switchable, flexible, microporous cloth that selectively captures, releases, and concentrates intact extracellular vesicles
Sun et al. A chemiluminescence biosensor based on the adsorption recognition function between Fe3O4@ SiO2@ GO polymers and DNA for ultrasensitive detection of DNA
Gong et al. The synthesis of PEI core@ silica shell nanoparticles and its application for sensitive electrochemical detecting mi-RNA
Yang et al. Metal/covalent-organic framework-based biosensors for nucleic acid detection
Zhang et al. Chemically modified nucleic acid biopolymers used in biosensing
Gao et al. Functionalization of boron nitride nanotubes for applications in nanobiomedicine
Panicker et al. Gold‐Aryl nanoparticles coated with polyelectrolytes for adsorption and protection of DNA against nuclease degradation
CN113005180A (en) Magnetic SERS biosensor and preparation method and application thereof
Gong et al. Graphene-based multifunctional nanomaterials in cancer detection and therapeutics
Tang et al. Engineered aptamer for the analysis of cells
Mumtaz et al. Multifunctional nanodiamonds as emerging platforms for cancer treatment, and targeted delivery of genetic factors and protein medications—a review

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant