CN106397796A - Method for preparing magnetic DNA (deoxyribonucleic acid) supramolecular hydrogel and application thereof - Google Patents
Method for preparing magnetic DNA (deoxyribonucleic acid) supramolecular hydrogel and application thereof Download PDFInfo
- Publication number
- CN106397796A CN106397796A CN201610860783.XA CN201610860783A CN106397796A CN 106397796 A CN106397796 A CN 106397796A CN 201610860783 A CN201610860783 A CN 201610860783A CN 106397796 A CN106397796 A CN 106397796A
- Authority
- CN
- China
- Prior art keywords
- dna
- magnetic
- supramolecular hydrogel
- hydrogel
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08J—WORKING-UP; GENERAL PROCESSES OF COMPOUNDING; AFTER-TREATMENT NOT COVERED BY SUBCLASSES C08B, C08C, C08F, C08G or C08H
- C08J3/00—Processes of treating or compounding macromolecular substances
- C08J3/24—Crosslinking, e.g. vulcanising, of macromolecules
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
- A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
- A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/02—Inorganic compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
- A61K47/26—Carbohydrates, e.g. sugar alcohols, amino sugars, nucleic acids, mono-, di- or oligo-saccharides; Derivatives thereof, e.g. polysorbates, sorbitan fatty acid esters or glycyrrhizin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0002—Galenical forms characterised by the drug release technique; Application systems commanded by energy
- A61K9/0009—Galenical forms characterised by the drug release technique; Application systems commanded by energy involving or responsive to electricity, magnetism or acoustic waves; Galenical aspects of sonophoresis, iontophoresis, electroporation or electroosmosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/06—Ointments; Bases therefor; Other semi-solid forms, e.g. creams, sticks, gels
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08J—WORKING-UP; GENERAL PROCESSES OF COMPOUNDING; AFTER-TREATMENT NOT COVERED BY SUBCLASSES C08B, C08C, C08F, C08G or C08H
- C08J3/00—Processes of treating or compounding macromolecular substances
- C08J3/02—Making solutions, dispersions, lattices or gels by other methods than by solution, emulsion or suspension polymerisation techniques
- C08J3/03—Making solutions, dispersions, lattices or gels by other methods than by solution, emulsion or suspension polymerisation techniques in aqueous media
- C08J3/075—Macromolecular gels
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08K—Use of inorganic or non-macromolecular organic substances as compounding ingredients
- C08K3/00—Use of inorganic substances as compounding ingredients
- C08K3/02—Elements
- C08K3/04—Carbon
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08K—Use of inorganic or non-macromolecular organic substances as compounding ingredients
- C08K9/00—Use of pretreated ingredients
- C08K9/04—Ingredients treated with organic substances
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
- G01N33/5735—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes co-enzymes or co-factors, e.g. NAD, ATP
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08K—Use of inorganic or non-macromolecular organic substances as compounding ingredients
- C08K2201/00—Specific properties of additives
- C08K2201/01—Magnetic additives
Abstract
The invention relates to a method for preparing magnetic DNA (deoxyribonucleic acid) supramolecular hydrogel and application thereof. The magnetic DNA supramolecular hydrogel comprises magnetic oxidized graphene and two types of DNA monomers [Y-type DNA monomers (Y-DNA) and linker DNA monomers (L-DNA)]. The Y-DNA and the L-DNA are hybridized by sticky ends in a complementary manner to form DNA hydrogel; exposed sticky ends of the DNA hydrogel are adsorbed on the surfaces of the magnetic oxidized graphene under pi-pi stacking effects to form the magnetic DNA supramolecular hydrogel. The method and the application have the advantages that the magnetic DNA supramolecular hydrogel prepared by the aid of the method is low in cost, easy to operate and separate and high in reaction speed and universality; the method can be successfully applied to colorimetry and ultraviolet-visible absorption quantitative detection on medicine carriers and adenosine triphosphate (ATP); as compared with existing detection methods, the method is easy and convenient to implement and low in cost and has a broad application prospect, visual detection results can be obtained, and complicated instruments or equipment can be omitted.
Description
Technical field
The invention belongs to biomedicine field, particularly to a kind of preparation method of magnetic DNA supramolecular hydrogel and its
Application.
Background technology
Nano material refers at least one-dimensional material being in nanoscale (usually 0.1-100nm) of three-dimensional space of particle
Material.Magnetic Nano material is the important nano material of a class, has the characteristics that：(1) scantling is little, can free permeation blood
Pipe；(2) corresponding heat effect can be produced with the change of external magnetic field；(3) its bio-compatible can be strengthened according to application target functionalization
Property and targeting；(4) material shows quantum size effect, skin effect, macro quanta tunnel effect and good biofacies
The special physicochemical properties such as capacitive, can be used for medicine transmission etc. as magnetic carrier.In recent years, magnetic Nano material is wide
General it is applied to cell Magnetic Isolation, target drug-carrying, tumor magnetic hyperthermia etc., before the fields such as disease treatment have wide application
Scape.
DNA, as the biomacromolecule encoding, storing and convey hereditary information, controls heredity and the character of organism.
Because it has the features such as designability of functional sequence and response, programmable is assembled into two dimension or three dimensional structure.At present,
DNA is established DNA self-assembling technique as a kind of assembled material by people, carries out assembling and the molecular device of micro nano structure
Structure.DNA hydrogel is the porous network structure being cross-linked to form by chemically or physically method by DNA monomer.Can be by setting
Meter DNA sequence and the assembling process of sequence length precise control DNA hydrogel, reaction is quick, and mild condition, in biomedicine
Field has broad application prospects.
There is no magnetic DNA supramolecular hydrogel at present prepares and uses it for pharmaceutical carrier and ATP detection system structure
Pertinent literature report.
Content of the invention
In order to overcome above-mentioned deficiency, the invention provides a kind of preparation method of magnetic DNA supramolecular hydrogel, and by its
It is applied to medicine-carried system and the structure of ATP detection system.
A kind of the first aspect of the invention, there is provided preparation method of magnetic DNA supramolecular hydrogel.Experimental principle is such as
Shown in Fig. 1, it is utilized respectively three single-stranded (Y1, Y2, Y3) first and builds Y type DNA monomer (Y-DNA), two single-stranded (L1, L2) structures
Build connector DNA monomer (L-DNA)；Meanwhile, using occurring amide to react between graphene oxide and amino magnetic bead, prepare magnetic oxygen
Graphite alkene.It is self-assembly of DNA supramolecular hydrogel using Y-DNA and L-DNA sticky end Complementary hybridization, based on single-stranded
π-π stacking effect between DNA and magnetic oxygenated Graphene, DNA hydrogel is passed through outside exposed sticky end and adsorbs in magnetic
Property surface of graphene oxide, prepares magnetic DNA supramolecular hydrogel.
For achieving the above object, the present invention adopts the following technical scheme that：
A kind of magnetic DNA supramolecular hydrogel, including：
DNA supramolecular hydrogel doped with magnetic oxygenated Graphene；
Wherein, described DNA supramolecular hydrogel adsorbs in magnetic oxygenated graphenic surface.
Magnetic oxygenated Graphene has larger specific surface area, can load substantial amounts of DNA hydrogel.Use it for carrying medicine body
System, can achieve higher load drug effect energy；Use it for the detection of ATP, then significantly improve detection sensitivity.
In addition, using the π-π stacking effect shape between the exposed sticky end of DNA hydrogel and magnetic oxygenated Graphene
Become magnetic DNA supramolecular hydrogel, compare with traditional Electrostatic Absorption, there is stronger adhesion and stability, and overcome
Complex steps, relatively costly shortcoming when being synthesized using covalent modification methods.
Preferably, described DNA supramolecular hydrogel is formed by the sticky end Complementary hybridization self assembly of Y-DNA and L-DNA,
Wherein, the Y type DNA monomer that Y-DNA builds for three DNA single-stranded (Y1, Y2, Y3)；L-DNA is two DNA single-stranded (L1, L2) structures
The connector DNA monomer built；
It is furthermore preferred that the mol ratio of described Y-DNA, L-DNA and magnetic oxygenated Graphene is 300～600：900～1800：
1～2.
It is furthermore preferred that the oligonucleotide chain-ordering of described Y-DNA is：
Y1：5'-CACGGACTTGGATCCGCATAACCATTCGCCGTAATG-3'；
Y2：5'-CACGGACTCATTACGGCGAATGTACCGAATCAGCCT-3'；
Y3：5'-CACGGACTAGGCTGATTCGGTAGTTATGCGGATCCA-3'；
The oligonucleotide chain-ordering of described L-DNA is：
L1：
5'-AGTCCGTGGTAGGGCAGGTTGGGGTGACTGGTTGGTGTGGTTGG-3'；
L2：
5'-AGTCCGTGCCAACCACACCAACCAGTCACCCCAACCTGCCCTAC-3'.
The present invention is accurately controlled the self assembling process of DNA hydrogel, design letter by the DNA sequence of above-mentioned design
Single it is easy to practical application.
Present invention firstly provides a kind of preparation method of magnetic DNA supramolecular hydrogel, by magnetic oxygenated Graphene, Y-
DNA, L-DNA are scattered in buffer solution, mix homogeneously, and isothermal reaction obtains final product.
The preparation method of the present invention is simply it is easy to operate.The present invention utilize the exposed sticky end of DNA hydrogel with
π-π stacking effect between magnetic oxygenated Graphene forms magnetic DNA supramolecular hydrogel, and reaction is quick, mild condition, and has
Stronger adhesion and stability.And general nanoparticle as pharmaceutical carrier when, how using covalent synthesis or Electrostatic Absorption
Method.Wherein, though covalent synthesis has preferable stability, operating procedure is complicated, severe reaction conditions；Though Electrostatic Absorption is closed
Become step simple, but adhesion and less stable.
Preferably, at the condition of described isothermal reaction is 35～37 DEG C, react 3～3.5h；
Preferably, the concrete preparation method of described magnetic oxygenated Graphene is as follows：Prepare graphene oxide dispersion, work
Change, react with amino magnetic bead, obtain final product；
Preferably, described DNA supramolecular hydrogel is formed by the sticky end Complementary hybridization self assembly of Y-DNA and L-DNA；
Wherein, the Y type DNA monomer that Y-DNA builds for three DNA single-stranded (Y1, Y2, Y3)；L-DNA is two DNA single-stranded (L1, L2) structures
The connector DNA monomer built；
It is furthermore preferred that the mol ratio of described Y-DNA, L-DNA and magnetic oxygenated Graphene is 300～600：900～1800：
1～2；
It is furthermore preferred that the oligonucleotide chain-ordering of described Y-DNA is：
Y1：5'-CACGGACTTGGATCCGCATAACCATTCGCCGTAATG-3'；
Y2：5'-CACGGACTCATTACGGCGAATGTACCGAATCAGCCT-3'；
Y3：5'-CACGGACTAGGCTGATTCGGTAGTTATGCGGATCCA-3'；
The oligonucleotide chain-ordering of described L-DNA is：
L1：
5'-AGTCCGTGGTAGGGCAGGTTGGGGTGACTGGTTGGTGTGGTTGG-3'；
L2：
5'-AGTCCGTGCCAACCACACCAACCAGTCACCCCAACCTGCCCTAC-3'.
Present invention also offers a kind of preparation method of preferably magnetic DNA supramolecular hydrogel, specific preparation method
As follows：
1. the preparation of magnetic oxygenated Graphene
A certain amount of graphene oxide sheet is placed in beaker, adds secondary water ultrasonic dissolution to obtain brown solution, then
It is centrifuged 10～15min in 6000～6500rpm and final concentration of 1～1.5mg mL is obtained-1Graphene oxide suspension；Take 600
～650 μ L graphene oxide suspension, are added thereto to 600～650 μ L 1- ethyls-(3- dimethylaminopropyl) carbon two sub-
Amine hydrochlorate) (EDC), 35～37 DEG C of vibration activation 1～1.2h；300～320 are added in the graphene oxide solution having activated
μ L amino magnetic bead (particle diameter is about 100nm), 35～37 DEG C of oscillating reactionss 12～14h；The magnetic oxygenated Graphene preparing is entered
Row Magnetic Isolation, is cleaned with PBS three times, by the magnetic oxygenated graphene dispersion after cleaning in secondary water, 4～5 DEG C
Save backup.
The preparation of 2.Y-DNA and L-DNA
In experiment, DNA used is all using TE buffer solution (10mM Tris-HCl buffer；1mM disodiumedetate
(EDETATE DISODIUM)；12.5mM MgCl2, pH 8.0) and preparation.By Y1, Y2, Y3 (concentration ratio Y1：Y2：Y3=1：1：1, every
Final concentration of 50 μM of DNA) and L1, L2 (concentration ratio L1：L2=1：Final concentration of 50 μM of 1, every DNA) carry out respectively annealing treatment
Reason, that is, be heated to 95 DEG C of 5min, be slowly cooled to room temperature stable 2h immediately, to form constitutionally stable Y-DNA and L-DNA, 4
DEG C save backup.
3. the preparation of magnetic DNA supramolecular hydrogel
Y-DNA and L-DNA taking the above-mentioned preparation of equivalent, in microcentrifugal tube, then adds magnetic oxygen in mixed system
Graphite alkene solution, is eventually adding PBS (pH 7.0), so that Y-DNA, L-DNA, the final concentration of magnetic oxygenated Graphene is divided
Wei 6～12 μM, 18～36 μM, 0.02～0.04 μM.Mixed system is obtained magnetic DNA in 35～37 DEG C of reaction 3～4h surpass
Molecule hydrogel.
The second aspect of the invention, the magnetic DNA supramolecular hydrogel based on above-mentioned preparation, there is provided a kind of by this magnetic
Property DNA supramolecular hydrogel is as the technology application of pharmaceutical carrier.Principle is as shown in Fig. 2 crosslinking based on Y-DNA and L-DNA
Effect is self-assembly of DNA supramolecular hydrogel, in conjunction with the adsorption to single stranded DNA for the magnetic oxygenated Graphene, by DNA water
The absorption of DNA supramolecular hydrogel is prepared magnetic in magnetic oxygenated graphenic surface by the exposed sticky end of gel
DNA supramolecular hydrogel, i.e. prepared magnetic DNA supramolecular hydrogel in the one side of this patent.Further, utilize
Antitumor drug amycin (doxorubicin, DOX) can be intercalated into the property in DNA double chain structure, by antitumor drug DOX
It is fitted in the DNA double chain structure of magnetic DNA supramolecular hydrogel, the magnetic DNA preparing load antitumor drug DOX surpasses
Molecule hydrogel drug carrier.Because deoxyribonuclease I (Deoxyribonuclease I, abbreviation DNase I) is in neutrality
Environment and have Mg2+In the presence of, can non-specifically hydrolyze double-stranded DNA, generate the oligonucleoside of 5 ' phosphate terminals and 3 ' C-terminals
Acid.Therefore, after adding DNase I in system, the DNA supramolecular hydrogel loading DOX is hydrolyzed to DNA piece by DNase I
Section, thus discharging loaded antitumor drug DOX, realizes drug release.The method is by antitumor drug and bio-compatible
Property and the good DNA nanostructure of water solublity combine, overcome the shortcomings of medicine itself poorly water-soluble, stability difference；Simultaneously
The method is easily isolated the advantage with purification with reference to magnetic oxygenated Graphene in DNA medicament-carried nano structure preparation process, is structure
Build high-sequential and the nucleic acid drug carrier of precise control provides good application platform, there is vast potential for future development.
To achieve these goals, the present invention adopts the following technical scheme that：
A kind of load antitumor drug magnetic DNA supramolecular hydrogel, including：
DNA supramolecular hydrogel doped with magnetic oxygenated Graphene；
It is supported on the antitumor drug on described magnetic DNA supramolecular hydrogel；
Wherein, the DNA supramolecular hydrogel of described load antitumor drug adsorbs in magnetic oxygenated graphenic surface.
Prepare netted DNA hydrogel using DNA self-assembling technique, in this structure, contain a large amount of DNA base pair.Due to
Some antitumor drug, such as amycin (DOX), epirubicin (E-ADM), Pirarubicin (THP) can be intercalated in DNA double chain,
Therefore drug loading can be greatly increased with DNA supramolecular hydrogel as pharmaceutical carrier.Additionally, can be non-specific using DNase I
Property hydrolysis double-stranded DNA characteristic, thus reaching the purpose of medicament slow release.The present invention netted DNA hydrogel and general nano junction
Structure is compared, and drug loading is high.
Preferably, described Y-DNA, L-DNA and the mol ratio of magnetic oxygenated Graphene, antitumor drug are 300～600：
900～1800：1～2：3×104～6 × 104；
Preferably, described antitumor drug is DOX, E-ADM, THP；
Preferably, described DNA supramolecular hydrogel is formed by the sticky end Complementary hybridization self assembly of Y-DNA and L-DNA,
Wherein, the Y type DNA monomer that Y-DNA builds for three DNA single-stranded (Y1, Y2, Y3)；L-DNA is two DNA single-stranded (L1, L2) structures
The connector DNA monomer built；
It is furthermore preferred that the mol ratio of described Y-DNA, L-DNA and magnetic oxygenated Graphene is 300～600：900～1800：
1～2.
It is furthermore preferred that the oligonucleotide chain-ordering of described Y-DNA is：
Y1：5'-CACGGACTTGGATCCGCATAACCATTCGCCGTAATG-3'；
Y2：5'-CACGGACTCATTACGGCGAATGTACCGAATCAGCCT-3'；
Y3：5'-CACGGACTAGGCTGATTCGGTAGTTATGCGGATCCA-3'；
The oligonucleotide chain-ordering of described L-DNA is：
L1：
5'-AGTCCGTGGTAGGGCAGGTTGGGGTGACTGGTTGGTGTGGTTGG-3'；
L2：
5'-AGTCCGTGCCAACCACACCAACCAGTCACCCCAACCTGCCCTAC-3'.
Present invention also offers a kind of preparation method of load antitumor drug magnetic DNA supramolecular hydrogel, including：
Magnetic oxygenated Graphene, Y-DNA, L-DNA, antitumor drug are scattered in buffer solution, mix homogeneously, constant temperature
Reaction, Magnetic Isolation, obtain final product the magnetic DNA supramolecular hydrogel of load antitumor drug.
Preferably, described Y-DNA, L-DNA, magnetic oxygenated Graphene, the mol ratio of antitumor drug are 300～600：
900～1800：1～2：3×104～6 × 104；
Preferably, described antitumor drug is DOX, E-ADM, THP；
Preferably, at the condition of described isothermal reaction is 35～37 DEG C, react 3～3.5h；
Preferably, the concrete preparation method of described magnetic oxygenated Graphene is as follows：Prepare graphene oxide dispersion, work
Change, react with amino magnetic bead, obtain final product；
Preferably, described DNA supramolecular hydrogel is formed by the sticky end Complementary hybridization self assembly of Y-DNA and L-DNA；
Wherein, the Y type DNA monomer that Y-DNA builds for three DNA single-stranded (Y1, Y2, Y3)；L-DNA is two DNA single-stranded (L1, L2) structures
The connector DNA monomer built；
It is furthermore preferred that the mol ratio of described Y-DNA, L-DNA and magnetic oxygenated Graphene is 300～600：900～1800：
1～2；
It is furthermore preferred that the oligonucleotide chain-ordering of described Y-DNA is：
Y1：5'-CACGGACTTGGATCCGCATAACCATTCGCCGTAATG-3'；
Y2：5'-CACGGACTCATTACGGCGAATGTACCGAATCAGCCT-3'；
Y3：5'-CACGGACTAGGCTGATTCGGTAGTTATGCGGATCCA-3'；
The oligonucleotide chain-ordering of described L-DNA is：
L1：
5'-AGTCCGTGGTAGGGCAGGTTGGGGTGACTGGTTGGTGTGGTTGG-3'；
L2：
5'-AGTCCGTGCCAACCACACCAACCAGTCACCCCAACCTGCCCTAC-3'.
Present invention also offers a kind of preparation method preferably loading antitumor drug magnetic DNA supramolecular hydrogel,
1. the preparation of magnetic oxygenated Graphene
A certain amount of graphene oxide sheet is placed in beaker, adds secondary water ultrasonic dissolution to obtain brown solution, then
It is centrifuged 10～15min in 6000～6500rpm and final concentration of 1～1.5mg mL is obtained-1Graphene oxide suspension；Take 600
～650 μ L graphene oxide suspension, are added thereto to 600～650 μ L EDC, 35～37 DEG C of vibration activation 1～1.2h；To work
300～320 μ L amino magnetic bead (particle diameter is about 100nm), 35～37 DEG C of oscillating reactionss are added in the graphene oxide solution changed
12～14h；The magnetic oxygenated Graphene preparing is carried out Magnetic Isolation, is cleaned with secondary deionized water three times, after cleaning
Magnetic oxygenated graphene dispersion in secondary water, 4～5 DEG C save backup.
The preparation of 2.Y-DNA and L-DNA
In experiment, DNA used is all using TE buffer solution (10mM Tris-HCl buffer；1mM EDETATE DISODIUM；
12.5mM MgCl2, pH 8.0) and preparation.By Y1, Y2, Y3 (concentration ratio Y1：Y2：Y3=1：1：Final concentration of 50 μ of 1, every DNA
) and L1, L2 (concentration ratio L1 M：L2=1：Final concentration of 50 μM of 1, every DNA) made annealing treatment respectively, that is, it is heated to 95 DEG C
5min, is slowly cooled to room temperature stable 2h immediately, to form constitutionally stable Y-DNA and L-DNA, standby.
3. the preparation of the magnetic DNA supramolecular hydrogel of load antitumor drug DOX
Add the Y-DNA of a certain amount of above-mentioned preparation, L-DNA, magnetic oxygenated Graphene in DOX solution, then to mixing
Add Du Shi buffer in system, so that Y-DNA, L-DNA, magnetic oxygenated Graphene, the final concentration of antitumor drug DOX is respectively
6～12 μM, 18～36 μM, 0.02～0.04 μM, 600～1200 μM.Mixed system reacts 7～8.5h, magnetic in 35～37 DEG C
Separate, remove excessive DOX, the magnetic DNA supramolecular hydrogel of load antitumor drug DOX is obtained.Negative by prepare
The magnetic DNA supramolecular hydrogel carrying DOX is scattered in Du Shi phosphate buffer, and 4～5 DEG C save backup.
The third aspect of the invention, a kind of preparation based on magnetic DNA supramolecular hydrogel, there is provided cladding Radix Cochleariae officinalises mistake
The magnetic DNA supramolecular hydrogel of oxide enzyme (HRP), realizes the high sensitivity to adenosine triphosphate (ATP), high selectivity is examined
The application system surveyed.Principle is as shown in figure 5, that the partial sequence of L1 in L-DNA is designed as ATP is fit, and changes other with this
DNA sequence, prepares two kinds of DNA monomers (Y-DNA' and L-DNA').Crosslinked action using Y-DNA' and L-DNA' is formed
DNA hydrogel, HRP is coated in DNA hydrogel simultaneously.It is based further on the π-π between single stranded DNA and magnetic oxygenated Graphene
Stacking acts on, and the DNA hydrogel of cladding HRP is passed through exposed sticky end absorption in magnetic oxygenated graphenic surface, prepares
Obtain coating the magnetic DNA supramolecular hydrogel of HRP.Specific recognition effect based on aptamer and object, when there being ATP
In the presence of, ATP generates the fit complex of ATP- with its fit chain specific binding, thus destroying DNA hydrogel structure, discharges
The HRP being coated.Magnetic Isolation, adds reaction substrate TMB/H in supernatant2O2, divided using ultraviolet-visible after the completion of reaction
Light photometer detects, thus realizing highly sensitive, high specific quantitative analyses to ATP.Additionally, using this method preparation cladding
The magnetic DNA supramolecular hydrogel of HRP, by changing the achievable detection to other target substances of different fit sequences, tool
There is broad applicability.
To achieve these goals, the present invention adopts following scheme：
A kind of magnetic DNA supramolecular hydrogel of cladding horseradish peroxidase (HRP), including：
DNA supramolecular hydrogel doped with magnetic oxygenated Graphene；
It is coated on the horseradish peroxidase (HRP) in described DNA supramolecular hydrogel；
Wherein, constitute in the L-DNA' monomer of described DNA supramolecular hydrogel, the single stranded DNA being connected with Y-DNA is contained
Sequence that ATP is fit；
The DNA supramolecular hydrogel of described cladding HRP adsorbs in magnetic oxygenated graphenic surface.
Magnetic oxygenated Graphene has larger specific surface area, can load substantial amounts of DNA hydrogel.Use it for ATP's
Detection, is remarkably improved detection sensitivity.
Preferably, described DNA supramolecular hydrogel is by the sticky end Complementary hybridization self assembly of Y-DNA' and L-DNA'
Become, wherein, the Y-DNA' monomer that Y-DNA' builds for three DNA single-stranded (Y1', Y2', Y3')；L-DNA' is that two DNA are single-stranded
The connector DNA monomer that (L1', L2') builds；
It is furthermore preferred that described Y-DNA', L-DNA', magnetic oxygenated Graphene, the mol ratio of horseradish peroxidase (HRP)
For 300～600：900～1800：1～2：1250～2500.
It is furthermore preferred that the oligonucleotide chain-ordering of described Y-DNA' is：
Y1'：5'-TTGGACCCTGGATCCGCATAACCATTCGCCGTAATG-3'；
Y2'：5'-TTGGACCCCATTACGGCGAATGTACCGAATCAGCCT-3'；
Y3'：5'-TTGGACCCAGGCTGATTCGGTAGTTATGCGGATCCA-3'；
The oligonucleotide chain-ordering of described L-DNA' is：
L1'：
5'-GGGTCCAAGTGAAGAGTCTATTGAAGAATTCCAACCTGGGGGAGTATTGCGGAGGAAGGT-3'；
L2'：5'-GGAATTCTTCAATAGACTCTTCAC-3'.
Present invention also offers a kind of preparation of the magnetic DNA supramolecular hydrogel of cladding horseradish peroxidase (HRP)
Method, including：
By horseradish peroxidase (HRP), magnetic oxygenated Graphene, formation DNA supramolecular hydrogel Y-DNA', L-
DNA' is scattered in buffer solution, mix homogeneously, and isothermal reaction obtains final product.
Preferably, the mol ratio of described Y-DNA', L-DNA' and magnetic oxygenated Graphene, horseradish peroxidase (HRP)
For 300～600：900～1800：1～2：1250～2500；
Preferably, the condition of described isothermal reaction is 35～37 DEG C, reacts 3～3.5h；
Preferably, the concrete preparation method of described magnetic oxygenated Graphene is as follows：Prepare graphene oxide dispersion, work
Change, react with amino magnetic bead, obtain final product；
Preferably, described DNA supramolecular hydrogel is by the sticky end Complementary hybridization self assembly of Y-DNA' and L-DNA'
Become, wherein, Y-DNA' is Y type DNA monomer；The connector DNA monomer that L-DNA' builds for two single-stranded (L1', L2')；
It is furthermore preferred that the mol ratio of described Y-DNA', L-DNA' and magnetic oxygenated Graphene is 300～600：900～
1800：1～2.
It is furthermore preferred that the oligonucleotide chain-ordering of described Y-DNA' is：
Y1'：5'-TTGGACCCTGGATCCGCATAACCATTCGCCGTAATG-3'；
Y2'：5'-TTGGACCCCATTACGGCGAATGTACCGAATCAGCCT-3'；
Y3'：5'-TTGGACCCAGGCTGATTCGGTAGTTATGCGGATCCA-3'；
The oligonucleotide chain-ordering of described L-DNA' is：
L1'：
5'-GGGTCCAAGTGAAGAGTCTATTGAAGAATTCCAACCTGGGGGAGTATTGCGGAGGAAGGT-3'；
L2'：5'-GGAATTCTTCAATAGACTCTTCAC-3'.
Present invention also offers one kind preferably coats the magnetic DNA supramolecular hydrogel of horseradish peroxidase (HRP)
Preparation method, specifically include following steps：
1. the preparation of magnetic oxygenated Graphene
A certain amount of graphene oxide sheet is placed in beaker, adds secondary water ultrasonic dissolution to obtain brown solution, then
It is centrifuged 10～15min in 6000～6500rpm and final concentration of 1～1.5mg mL is obtained-1Graphene oxide suspension；Take 600
～650 μ L graphene oxide suspension, are added thereto to 600～650 μ L EDC, 35～37 DEG C of vibration activation 1～1.2h；To work
300～320 μ L amino magnetic bead (particle diameter is about 100nm), 35～37 DEG C of oscillating reactionss are added in the graphene oxide solution changed
12～14h；The magnetic oxygenated Graphene preparing is carried out Magnetic Isolation, is cleaned with secondary deionized water three times, after cleaning
Magnetic oxygenated graphene dispersion in secondary water, 4～5 DEG C save backup.
The preparation of 2.Y-DNA' and L-DNA'
In experiment, DNA used is all using TE buffer solution (10mM Tris-HCl buffer；1mM EDETATE DISODIUM；
12.5mM MgCl2, pH 8.0) and preparation.By Y1', Y2', Y3'(concentration ratio Y1'：Y2'：Y3'=1：1：1, every DNA final concentration
For 50 μM) and L1', L2'(concentration ratio L1'：L2'=1：Final concentration of 50 μM of 1, every DNA) made annealing treatment respectively, that is, plus
Heat, to 95 DEG C of 5min, is cooled to ambient-temp-stable 2h immediately, to form constitutionally stable Y-DNA' and L-DNA', standby.
3. the preparation of the magnetic DNA supramolecular hydrogel of cladding HRP
Add the Y-DNA' of a certain amount of above-mentioned preparation, L-DNA', magnetic oxygenated Graphene in HRP solution, then to mixed
Add PBS (pH 7.0) in fit system, make Y-DNA', L-DNA', magnetic oxygenated Graphene, horseradish peroxidase
Final concentration is respectively 6～12 μM, 18～36 μM, 0.02～0.04 μM, 25～50 μM.Mixed system in 35～37 DEG C react 3～
3.2h, is obtained the magnetic DNA supramolecular hydrogel of cladding HRP.
Beneficial effects of the present invention
(1) the invention provides a kind of preparation method of magnetic DNA supramolecular hydrogel.Using Y-DNA and L-DNA viscosity
Termini-complementary hybridization is self-assembly of DNA supramolecular hydrogel, based on the π-π stacking between single stranded DNA and magnetic oxygenated Graphene
Effect, DNA hydrogel is passed through outside exposed sticky end and adsorbs in magnetic oxygenated graphenic surface, prepare magnetic
DNA supramolecular hydrogel.
(2) the invention provides a kind of using this magnetic DNA supramolecular hydrogel as pharmaceutical carrier technology application.The party
DNA nanostructure good with biocompatibility and water solublity for antitumor drug is combined by method, overcomes medicine itself water-soluble
Property poor, stability difference the shortcomings of；The method is easy in DNA medicament-carried nano structure preparation process with reference to magnetic oxygenated Graphene simultaneously
In separating the advantage with purification, the nucleic acid drug carrier for building high-sequential and precise control provides good application and puts down
Platform, has vast potential for future development.
(3) the invention provides a kind of magnetic DNA supramolecular hydrogel of cladding horseradish peroxidase (HRP), realize
Application system to the high sensitivity of adenosine triphosphate (ATP), high selectivity detection.Prepare the magnetic of cladding HRP using this method
Property DNA supramolecular hydrogel, can achieve detection to other objects by changing fit sequence, there is broad applicability.
(4) preparation method of the present invention is simple, detection efficiency is high, practical it is easy to promote.
Brief description
Fig. 1 magnetic DNA supramolecular hydrogel preparation principle figure.
Fig. 2 magnetic DNA hydrogel is used for pharmaceutical carrier schematic diagram.
Fig. 3 adds variable concentrations DNase I, after the completion of reaction, magnetic in load DOX magnetic DNA supramolecular hydrogel
Separate and obtain supernatant soln photo.DNase I concentration (from left to right)：0、0.002U/μL、0.004U/μL、0.006U/μL、
0.008U/μL、0.01U/μL、0.012U/μL、0.014U/μL.
Fig. 4 adds variable concentrations DNase I, after the completion of reaction, magnetic in load DOX magnetic DNA supramolecular hydrogel
Separate and obtain supernatant soln UV-visible spectrum.DNase I concentration (from bottom to top, in terms of at crest)：0、0.002U/μ
L、0.004U/μL、0.006U/μL、0.008U/μL、0.01U/μL、0.012U/μL、0.014U/μL.
The magnetic DNA supramolecular hydrogel that Fig. 5 coats HRP is used for ATP detection principle diagram.
Fig. 6 adds variable concentrations ATP in the magnetic DNA aquogel system of cladding HRP, with TMB/H2O2After the completion of reaction,
Solution colour photo.ATP concentration (from left to right)：0,2 μM, 4 μM, 6 μM, 8 μM, 10 μM.
Fig. 7 adds variable concentrations ATP in the magnetic DNA aquogel system of cladding HRP, with TMB/H2O2After the completion of reaction,
The UV-visible spectrum of solution system.ATP concentration (from bottom to top, in terms of at crest)：0,2 μM, 4 μM, 6 μM, 8 μM, 10 μ
M.
Fig. 8 add in the magnetic DNA aquogel system of cladding HRP PBS (i.e. blank), ATP analog and
ATP (concentration is 8 μM), with TMB/H2O2After the completion of reaction, the ratio of UV-visible absorbance at 450nm for the solution system
Relatively.
Specific embodiment
By the following examples feature of present invention and other correlated characteristic are described in further detail, in order to the same industry
The understanding of technical staff：
Embodiment 1
A kind of preparation method of magnetic DNA supramolecular hydrogel.Experimental principle is as shown in figure 1, be utilized respectively three first
Single-stranded (Y1, Y2, Y3) builds Y type DNA monomer (Y-DNA), two single-stranded (L1, L2) builds connector DNA monomer (L-DNA)；
Meanwhile, using occurring amide to react between graphene oxide and amino magnetic bead, prepare magnetic oxygenated Graphene.Using Y-DNA and L-
DNA sticky end Complementary hybridization is self-assembly of DNA supramolecular hydrogel, based between single stranded DNA and magnetic oxygenated Graphene
π-π stacking acts on, and DNA hydrogel is passed through outside exposed sticky end and adsorbs in magnetic oxygenated graphenic surface, be prepared into
To magnetic DNA supramolecular hydrogel.
Specific preparation method is as follows：
1. the preparation of magnetic oxygenated Graphene
A certain amount of graphene oxide sheet is placed in beaker, adds secondary water ultrasonic dissolution to obtain brown solution, then
Final concentration of 1mg mL is obtained in 6000rpm centrifugation 10min-1Graphene oxide suspension；600 μ L graphene oxides are taken to suspend
Liquid, is added thereto to 600 μ L EDC, 37 DEG C of vibration activation 1h；300 μ L amino are added in the graphene oxide solution having activated
Magnetic bead (particle diameter is about 100nm) (notes：Amino magnetic bead uses front use imidazoles-hydrochloride buffer (1M, pH 6.8, now with the current)
Clean up), 37 DEG C of oscillating reactionss 12h；The magnetic oxygenated Graphene preparing is carried out Magnetic Isolation, uses secondary deionized water
Cleaning three times, by the magnetic oxygenated graphene dispersion after cleaning in secondary water, 4 DEG C save backup.
The preparation of 2.Y-DNA and L-DNA
In experiment, DNA used is all using TE buffer solution (10mM Tris-HCl buffer；1mM EDETATE DISODIUM；
12.5mM MgCl2, pH 8.0) and preparation.By Y1, Y2, Y3 (concentration ratio Y1：Y2：Y3=1：1：Final concentration of 50 μ of 1, every DNA
) and L1, L2 (concentration ratio L1 M：L2=1：Final concentration of 50 μM of 1, every DNA) made annealing treatment respectively, that is, it is heated to 95 DEG C
5min, is slowly cooled to room temperature stable 2h immediately, to form constitutionally stable Y-DNA and L-DNA, standby.
3. the preparation of magnetic DNA supramolecular hydrogel
Y-DNA and L-DNA taking the above-mentioned preparation of equivalent, in microcentrifugal tube, then adds magnetic oxygen in mixed system
Graphite alkene solution, is eventually adding PBS (pH 7.0), so that Y-DNA, L-DNA, the final concentration of magnetic oxygenated Graphene is divided
Wei 6 μM, 18 μM, 0.02 μM.Mixed system is obtained magnetic DNA supramolecular hydrogel in 37 DEG C of reaction 3h.
Embodiment 2
A kind of using this magnetic DNA supramolecular hydrogel as pharmaceutical carrier technology application.Principle is as shown in Fig. 2 be based on
The crosslinked action of Y-DNA and L-DNA is self-assembly of DNA supramolecular hydrogel, in conjunction with magnetic oxygenated Graphene to single stranded DNA
Adsorption, is adsorbed DNA supramolecular hydrogel in magnetic oxygenated Graphene by the exposed sticky end of DNA hydrogel
Surface prepares magnetic DNA supramolecular hydrogel, and this is prepared magnetic DNA supermolecule water in this patent one side
Gel.Further, the property in DNA double chain structure can be intercalated into using antitumor drug amycin (doxorubicin, DOX),
Antitumor drug DOX is fitted in the DNA double chain structure of magnetic DNA supramolecular hydrogel, prepares load antineoplastic agent
The magnetic DNA supramolecular hydrogel pharmaceutical carrier of thing DOX.Due to deoxyribonuclease I (Deoxyribonuclease I, letter
Claim DNase I) in neutral environment and there is Mg2+In the presence of, can non-specifically hydrolyze double-stranded DNA, generate 5 ' phosphate terminals and 3 '
The oligonucleotide of C-terminal.Therefore, after adding DNase I in system, DNase I will load the DNA supermolecule water of DOX
Gel hydrolysis are DNA fragmentation, thus discharging loaded antitumor drug DOX, realize drug release.The method is by antitumor
The medicine DNA nanostructure good with biocompatibility and water solublity combines, and overcomes medicine itself poorly water-soluble, stability
The shortcomings of difference；Simultaneously the method with reference to magnetic oxygenated Graphene be easily isolated in DNA medicament-carried nano structure preparation process with pure
The advantage changed, the nucleic acid drug carrier for building high-sequential and precise control provides good application platform, has wide
Development prospect.
Specific preparation method is as follows:
Oligonucleotide chain-ordering used by table 1-1
| Title | Sequence (5'-3') |
| Y1 | CACGGACTTGGATCCGCATAACCATTCGCCGTAATG |
| Y2 | CACGGACTCATTACGGCGAATGTACCGAATCAGCCT |
| Y3 | CACGGACTAGGCTGATTCGGTAGTTATGCGGATCCA |
| L1 | AGTCCGTGGTAGGGCAGGTTGGGGTGACTGGTTGGTGTGGTTGG |
| L2 | AGTCCGTGCCAACCACACCAACCAGTCACCCCAACCTGCCCTAC |
1. the preparation of magnetic oxygenated Graphene
A certain amount of graphene oxide sheet is placed in beaker, adds secondary water ultrasonic dissolution to obtain brown solution, then
Final concentration of 1mg mL is obtained in 6000rpm centrifugation 10min-1Graphene oxide suspension；600 μ L graphene oxides are taken to suspend
Liquid, is added thereto to 600 μ L EDC, 37 DEG C of vibration activation 1h；300 μ L amino are added in the graphene oxide solution having activated
Magnetic bead (particle diameter is about 100nm) (notes：Amino magnetic bead uses front use imidazoles-hydrochloride buffer (1M, pH 6.8, now with the current)
Clean up), 37 DEG C of oscillating reactionss 12h；The magnetic oxygenated Graphene preparing is carried out Magnetic Isolation, uses secondary deionized water
Cleaning three times, by the magnetic oxygenated graphene dispersion after cleaning in secondary water, 4 DEG C save backup.
The preparation of 2.Y-DNA and L-DNA
In experiment, DNA used is all using TE buffer solution (10mM Tris-HCl buffer；1mM EDETATE DISODIUM；
12.5mM MgCl2, pH 8.0) and preparation.By Y1, Y2, Y3 (concentration ratio Y1：Y2：Y3=1：1：Final concentration of 50 μ of 1, every DNA
) and L1, L2 (concentration ratio L1 M：L2=1：Final concentration of 50 μM of 1, every DNA) made annealing treatment respectively, that is, it is heated to 95 DEG C
5min, is slowly cooled to room temperature stable 2h immediately, to form constitutionally stable Y-DNA and L-DNA, standby.
3. load the preparation of antitumor drug DOX magnetic DNA supramolecular hydrogel
Add the Y-DNA of a certain amount of above-mentioned preparation, L-DNA, magnetic oxygenated Graphene in DOX solution, then to mixing
Add Du Shi buffer in system, so that Y-DNA, L-DNA, magnetic oxygenated Graphene, the final concentration of antitumor drug DOX is respectively
6μM、18μM、0.02μM、600μM.37 DEG C of reaction 7h of mixed system, Magnetic Isolation, remove excessive DOX, load is obtained anti-swollen
The magnetic DNA supramolecular hydrogel of tumor medicine DOX.The load preparing DOX magnetic DNA supramolecular hydrogel is scattered in Du
Family name's phosphate buffer, 4 DEG C save backup.
4. the detection of release amount
The load DOX magnetic DNA supramolecular hydrogel taking the above-mentioned preparation of 500 μ L respectively, in 8 centrifuge tubes, divides thereto
Do not add 50 μ L concentration be respectively 0,0.002U/ μ L, 0.004U/ μ L, 0.006U/ μ L, 0.008U/ μ L, 0.01U/ μ L,
0.012U/ μ L, the DNase I of 0.014U/ μ L, wherein DNase I is scattered in 1 × digestion buffer (10mM Tris solution,
0.5mM Ca2+、2.5mM Mg2+, pH 7.4) in.Du Shi phosphate buffer is added to supplement final volume to 1mL, by this reaction system
React 1h in 37 DEG C.After the completion of reaction, Magnetic Isolation, take equivalent supernatant, add Du Shi phosphate buffer to supplement final volume extremely
2mL, in ultraviolet-visible spectrophotometer detection.
5. experimental result and discussion
By variable concentrations DNase I solution (concentration be followed successively by 0,0.002U/ μ L, 0.004U/ μ L, 0.006U/ μ L,
0.008U/ μ L, 0.01U/ μ L, 0.012U/ μ L, 0.014U/ μ L) it is added in load DOX magnetic DNA supramolecular hydrogel, in
37 DEG C of reaction 1h.After reaction terminates, Magnetic Isolation, take the supernatant, the supplementary final volume of addition Du Shi phosphate buffer to 2mL
Afterwards, observe solution colour.As shown in figure 3, supernatant is in salmon pink (as DOX color), and color is dense with adding DNase I
The increase of degree is gradually deepened, and after showing to add DNase I, DNA hydrogel duplex structure is hydrolyzed to oligonucleotide piece by DNase I
Section, DOX in DNA double chain for the intercalation is released, and the concentration of the DOX being discharged is with the increase adding DNase I amount
Increase.Further, using ultraviolet-visible spectrophotometer, ultraviolet-ray visible absorbing detection is carried out to gained supernatant.As Fig. 4 institute
Show, with the increase adding DNase I concentration, its corresponding supernatant UV-visible absorbance at 480nm rises successively
Height, the amount further illustrating the DOX concentration discharging with the DNase I adding is proportionate, thus confirming magnetic DNA
Supramolecular hydrogel is used for the feasibility of pharmaceutical carrier.
Embodiment 3
A kind of magnetic DNA supramolecular hydrogel of cladding horseradish peroxidase (HRP), realizes to adenosine triphosphate
(ATP) high sensitivity, the application system of high selectivity detection.Principle is as shown in figure 5, set the partial sequence of L1 in L-DNA
It is calculated as ATP fit, and other DNA sequence are changed with this, prepare two kinds of DNA monomers (Y-DNA' and L-DNA').Using Y-
The crosslinked action of DNA' and L-DNA' forms DNA hydrogel, HRP is coated in DNA hydrogel simultaneously.It is based further on single-stranded
π-π stacking effect between DNA and magnetic oxygenated Graphene, the DNA hydrogel of cladding HRP is passed through exposed sticky end absorption
Prepare the magnetic DNA supramolecular hydrogel of cladding HRP in magnetic oxygenated graphenic surface.Based on aptamer and object
Specific recognition effect, in the presence of having ATP, ATP generates the fit complex of ATP- with its fit chain specific binding, destroys
DNA hydrogel structure, thus discharge HRP.Magnetic Isolation, adds reaction substrate TMB/H in supernatant2O2, adopt after the completion of reaction
With ultraviolet-visible spectrophotometer detection, thus realizing highly sensitive, the high specific quantitative analyses to ATP.Additionally, using this
The magnetic DNA supramolecular hydrogel of method preparation cladding HRP, be can achieve to other objects by changing different fit sequences
Detection, there is broad applicability.
Specific preparation method is as follows:
Oligonucleotide used by table 1-2 and fit chain-ordering
1. the preparation of magnetic oxygenated Graphene
A certain amount of graphene oxide sheet is placed in beaker, adds secondary water ultrasonic dissolution to obtain brown solution, then
Final concentration of 1mg mL is obtained in 6000rpm centrifugation 10min-1Graphene oxide suspension；600 μ L graphene oxides are taken to suspend
Liquid, is added thereto to 600 μ L EDC, vibration activation 1h under the conditions of 37 DEG C；300 are added in the graphene oxide solution having activated
Amino magnetic bead (particle diameter is about 100nm) after μ L imidazoles-hydrochloride buffer (1M, pH 6.8, now with the current) cleaning, 37 DEG C are shaken
Swing reaction 12h；The magnetic oxygenated Graphene preparing is carried out Magnetic Isolation, is cleaned with secondary deionized water three times, will clean
In secondary water, 4 DEG C save backup magnetic oxygenated graphene dispersion afterwards.
The preparation of 2.Y-DNA' and L-DNA'
In experiment, DNA used is all using TE buffer solution (10mM Tris-HCl buffer；1mM EDETATE DISODIUM；
12.5mM MgCl2, pH 8.0) and preparation.By Y1', Y2', Y3'(concentration ratio Y1'：Y2'：Y3'=1：1：1, every DNA final concentration
For 50 μM) and L1', L2'(concentration ratio L1'：L2'=1：Final concentration of 50 μM of 1, every DNA) made annealing treatment respectively, that is, plus
Heat, to 95 DEG C of 5min, is cooled to ambient-temp-stable 2h immediately, to form constitutionally stable Y-DNA' and L-DNA', standby.
3. the preparation of the magnetic DNA supramolecular hydrogel of cladding HRP
Add the Y-DNA' of a certain amount of above-mentioned preparation, L-DNA', magnetic oxygenated Graphene in HRP solution, then to mixed
Add PBS (pH 7.0) in fit system, make Y-DNA', L-DNA', magnetic oxygenated Graphene, horseradish peroxidase
Final concentration is respectively 6 μM, 18 μM, 0.02 μM, 25 μM.Mixed system reacts 3h in 37 DEG C, and the magnetic DNA that cladding HRP is obtained surpasses
Molecule hydrogel.
4.ATP detects
Take 100 μ L variable concentrations adenosine triphosphate (ATP) titers respectively, be added to the magnetic DNA supermolecule of cladding HRP
In aquogel system, 25 DEG C of reaction 1h.After reaction terminates, Magnetic Isolation, pipette 50 μ L of supernatant liquid respectively, be added thereto to 10 μ L
0.5%TMB solution, 20 μ L 30%H2O2Solution, 920 μ L buffer (26.6mM citric acid, 51.4mM Na2HPO4, 15mM
KCl, pH 5.0), after reaction 15min, it is separately added into 500 μ L 2M H2SO4Terminating reaction, is subsequently adding 500 μ L buffer (pH
5.0) supplement final volume to 2mL, carry out ultraviolet-ray visible absorbing detection using ultraviolet-uisible spectrophotometer.
5. specific detection
Respectively by 100 μ L PBS, ATP analog (uridine triphosphate (UTP), cytidine (CTP), three phosphorus
Sour guanosine (GTP), concentration is 8 μM), object ATP (concentration is 8 μM) be added to the magnetic DNA supramolecular hydrogel of cladding HRP
In colloid system, after 25 DEG C of reaction 1h, Magnetic Isolation, pipette 50 μ L of supernatant liquid respectively, be added thereto to 10 μ L 0.5%TMB molten
Liquid, 20 μ L 30%H2O2Solution, 920 μ L buffer (26.6mM citric acid, 51.4mM Na2HPO4, 15mM KCl, pH 5.0),
After reaction 15min, it is separately added into 500 μ L 2M H2SO4Terminating reaction, is subsequently adding 500 μ L buffer (pH 5.0) and supplements end body
Amass to 2mL, carry out ultraviolet-ray visible absorbing detection using ultraviolet-uisible spectrophotometer.
6. experimental result and discussion
A certain amount of Y-DNA', L-DNA', magnetic oxygenated Graphene, PBS (pH 7.0) is added in HRP solution,
Make mixed system react 3h in 37 DEG C, the magnetic DNA supramolecular hydrogel of cladding HRP is obtained.
Variable concentrations ATP standard solution (concentration is followed successively by 0,2 μM, 4 μM, 6 μM, 8 μM, 10 μM) is added to cladding HRP
Magnetic DNA aquogel system in, in 25 DEG C reaction 1h after, Magnetic Isolation, take supernatant.TMB solution is added in supernatant
And H2O2Solution, after reaction 15min, adds sulphuric acid terminating reaction, adds buffer (pH 5.0) to supplement final volume to 2mL, observes
Solution system color.As shown in fig. 6, solution is in yellow, and color is gradually deepened with the increase adding ATP concentration, shows to add
After entering ATP, the HRP being coated in DNA hydrogel is released, and the HRP concentration being discharged is with the increase adding ATP concentration
And increase.Carry out ultraviolet-ray visible absorbing detection using ultraviolet-visible spectrophotometer, result as shown in fig. 7, with add ATP
The increase of concentration, UV-visible absorbance at 450nm for the supernatant raises successively, further illustrates the HRP concentration discharging
It is proportionate with the ATP concentration adding, thus realizing the highly sensitive detection by quantitative to ATP.
Specificity ATP being detected for checking body series, in the magnetic DNA hydrogel of prepared cladding HRP respectively
Add equal-volume PBS (i.e. blank), ATP analog (UTP, CTP, GTP, concentration is 8 μM), object ATP (concentration
For 8 μM), carry out ultraviolet-ray visible absorbing detection using ultraviolet-visible spectrophotometer.Result is as shown in figure 8, add in system
After ATP analog (UTP, CTP, GTP) reaction, solution, in the UV-visible absorbance at 450nm compared with blank sample, does not have
Significant change；After adding object ATP, after reaction, UV-visible absorbance at 450nm for the solution significantly increases, and shows
The method has good specificity.
Embodiment 4
A kind of preparation method of magnetic DNA supramolecular hydrogel, specific preparation method is as follows：
1. the preparation of magnetic oxygenated Graphene
A certain amount of graphene oxide sheet is placed in beaker, adds secondary water ultrasonic dissolution to obtain brown solution, then
Final concentration of 1.5mg mL is obtained in 6500rpm centrifugation 15min-1Graphene oxide suspension；650 μ L graphene oxides are taken to hang
Supernatant liquid, is added thereto to 650 μ L EDC, 35 DEG C of vibration activation 1.2h；320 μ L are added in the graphene oxide solution having activated
Amino magnetic bead (particle diameter is about 100nm), 35 DEG C of oscillating reactionss 14h；The magnetic oxygenated Graphene preparing is carried out Magnetic Isolation,
Cleaned with secondary deionized water three times, by the magnetic oxygenated graphene dispersion after cleaning in secondary water, 5 DEG C save backup.
The preparation of 2.Y-DNA and L-DNA
In experiment, DNA used is all using TE buffer solution (10mM Tris-HCl buffer；1mM EDETATE DISODIUM；
12.5mM MgCl2PH 8.0) preparation.By Y1, Y2, Y3 (concentration ratio Y1：Y2：Y3=1：1：Final concentration of 50 μM of 1, every DNA)
With L1, L2 (concentration ratio L1：L2=1：Final concentration of 50 μM of 1, every DNA) made annealing treatment respectively, that is, it is heated to 95 DEG C
5min, is slowly cooled to room temperature stable 2h immediately, to form constitutionally stable Y-DNA and L-DNA, standby.
3. the preparation of magnetic DNA supramolecular hydrogel
Y-DNA and L-DNA taking the above-mentioned preparation of equivalent, in microcentrifugal tube, then adds magnetic oxygen in mixed system
Graphite alkene solution, is eventually adding PBS (pH 7.0), so that Y-DNA, L-DNA, the final concentration of magnetic oxygenated Graphene is divided
Wei 12 μM, 36 μM, 0.04 μM.Mixed system is obtained magnetic DNA supramolecular hydrogel in 36 DEG C of reaction 4h.
Embodiment 5
A kind of preparation method preferably loading antitumor drug magnetic DNA supramolecular hydrogel,
1. the preparation of magnetic oxygenated Graphene
A certain amount of graphene oxide sheet is placed in beaker, adds secondary water ultrasonic dissolution to obtain brown solution, then
Final concentration of 1.5mg mL is obtained in 6500rpm centrifugation 15min-1Graphene oxide suspension；650 μ L graphene oxides are taken to hang
Supernatant liquid, is added thereto to 650 μ L EDC, 35 DEG C of vibration activation 1.2h；320 μ L are added in the graphene oxide solution having activated
Amino magnetic bead (particle diameter is about 100nm), 35 DEG C of oscillating reactionss 14h；The magnetic oxygenated Graphene preparing is carried out Magnetic Isolation,
Cleaned with secondary deionized water three times, by the magnetic oxygenated graphene dispersion after cleaning in secondary water, 5 DEG C save backup.
The preparation of 2.Y-DNA and L-DNA
In experiment, DNA used is all using TE buffer solution (10mM Tris-HCl buffer；1mM EDETATE DISODIUM；
12.5mM MgCl2PH 8.0) preparation.By Y1, Y2, Y3 (concentration ratio Y1：Y2：Y3=1：1：Final concentration of 50 μM of 1, every DNA)
With L1, L2 (concentration ratio L1：L2=1：Final concentration of 50 μM of 1, every DNA) made annealing treatment respectively, that is, it is heated to 95 DEG C
5min, is slowly cooled to room temperature stable 2h immediately, to form constitutionally stable Y-DNA and L-DNA, standby.
3. load the preparation of antitumor drug E-ADM magnetic DNA supramolecular hydrogel
The Y-DNA' of a certain amount of above-mentioned preparation, L-DNA', magnetic oxygenated Graphene, Ran Houxiang is added in E-ADM solution
Add Du Shi buffer in mixed system, make Y-DNA, L-DNA, magnetic oxygenated Graphene, the final concentration of antitumor drug E-ADM
It is respectively 12 μM, 36 μM, 0.04 μM, 1200 μM.37 DEG C of reaction 6h of mixed system, Magnetic Isolation, remove excessive antineoplastic agent
Thing, is obtained the magnetic DNA supramolecular hydrogel of load antitumor drug.By the load preparing E-ADM magnetic DNA supermolecule
Hydrogel is scattered in Du Shi phosphate buffer, and 5 DEG C save backup.
Embodiment 6
A kind of preparation method preferably loading antitumor drug magnetic DNA supramolecular hydrogel,
1. the preparation of magnetic oxygenated Graphene
A certain amount of graphene oxide sheet is placed in beaker, adds secondary water ultrasonic dissolution to obtain brown solution, then
Final concentration of 1.5mg mL is obtained in 6500rpm centrifugation 15min-1Graphene oxide suspension；650 μ L graphene oxides are taken to hang
Supernatant liquid, is added thereto to 650 μ L EDC, 35 DEG C of vibration activation 1.2h；320 μ L are added in the graphene oxide solution having activated
Amino magnetic bead (particle diameter is about 100nm), 35 DEG C of oscillating reactionss 14h；The magnetic oxygenated Graphene preparing is carried out Magnetic Isolation,
Cleaned with secondary deionized water three times, by the magnetic oxygenated graphene dispersion after cleaning in secondary water, 5 DEG C save backup.
The preparation of 2.Y-DNA and L-DNA
In experiment, DNA used is all using TE buffer solution (10mM Tris-HCl buffer；1mM EDETATE DISODIUM；
12.5mM MgCl2PH 8.0) preparation.By Y1, Y2, Y3 (concentration ratio Y1：Y2：Y3=1：1：Final concentration of 50 μM of 1, every DNA)
With L1, L2 (concentration ratio L1：L2=1：Final concentration of 50 μM of 1, every DNA) made annealing treatment respectively, that is, it is heated to 95 DEG C
5min, is slowly cooled to room temperature stable 2h immediately, to form constitutionally stable Y-DNA and L-DNA, standby.
3. load the preparation of antitumor drug THP magnetic DNA supramolecular hydrogel
Add the Y-DNA' of a certain amount of above-mentioned preparation, L-DNA', magnetic oxygenated Graphene in THP solution, then to mixed
Add Du Shi buffer in fit system, make the final concentration difference of Y-DNA, L-DNA, magnetic oxygenated Graphene, antitumor drug THP
For 12 μM, 36 μM, 0.04 μM, 1200 μM.37 DEG C of reaction 6h of mixed system, Magnetic Isolation, remove excessive antitumor drug, system
The magnetic DNA supramolecular hydrogel of antitumor drug must be loaded.By the load preparing THP magnetic DNA supramolecular hydrogel
It is scattered in Du Shi phosphate buffer, 5 DEG C save backup.
Embodiment 7
A kind of preparation method of the magnetic DNA supramolecular hydrogel of cladding horseradish peroxidase (HRP), specifically include as
Lower step：
1. the preparation of magnetic oxygenated Graphene
A certain amount of graphene oxide sheet is placed in beaker, adds secondary water ultrasonic dissolution to obtain brown solution, then
Final concentration of 1.5mg mL is obtained in 6500rpm centrifugation 15min-1Graphene oxide suspension；650 μ L graphene oxides are taken to hang
Supernatant liquid, is added thereto to 650 μ L EDC, 35 DEG C of vibration activation 1.2h；320 μ L are added in the graphene oxide solution having activated
Amino magnetic bead (particle diameter is about 100nm), 35 DEG C of oscillating reactionss 14h；The magnetic oxygenated Graphene preparing is carried out Magnetic Isolation,
Cleaned with secondary deionized water three times, by the magnetic oxygenated graphene dispersion after cleaning in secondary water, 5 DEG C save backup.
The preparation of 2.Y-DNA' and L-DNA'
In experiment, DNA used is all using TE buffer solution (10mM Tris-HCl buffer；1mM EDETATE DISODIUM；
12.5mM MgCl2PH 8.0) preparation.By Y1', Y2', Y3'(concentration ratio Y1'：Y2'：Y3'=1：1：1, every DNA final concentration
For 50 μM) and L1', L2'(concentration ratio L1'：L2'=1：Final concentration of 50 μM of 1, every DNA) made annealing treatment respectively, that is, plus
Heat, to 95 DEG C of 5min, is cooled to ambient-temp-stable 2h immediately, to form constitutionally stable Y-DNA' and L-DNA', standby.
3. the preparation of the magnetic DNA supramolecular hydrogel of cladding HRP
Add the Y-DNA' of a certain amount of above-mentioned preparation, L-DNA', magnetic oxygenated Graphene in HRP solution, then to mixed
Add PBS (pH 7.0) in fit system, make Y-DNA', L-DNA', magnetic oxygenated Graphene, horseradish peroxidase
Final concentration is respectively 12 μM, 36 μM, 0.04 μM, 50 μM.Mixed system reacts 3.2h in 36 DEG C, and the magnetic DNA of cladding HRP is obtained
Supramolecular hydrogel.
Finally it should be noted that the foregoing is only the preferred embodiments of the present invention, it is not limited to this
Bright, although being described in detail to the present invention with reference to the foregoing embodiments, for a person skilled in the art, it is still
Technical scheme described in previous embodiment can be modified, or to wherein partly carrying out equivalent.All at this
Within bright spirit and principle, any modification, equivalent substitution and improvement made etc., should be included in protection scope of the present invention
Within.Although the above-mentioned accompanying drawing that combines is described to the specific embodiment of the present invention, not to the scope of the present invention
Restriction, one of ordinary skill in the art should be understood that, on the basis of technical scheme, those skilled in the art are not required to
Various modifications that creative work to be paid can be made or deformation are still within protection scope of the present invention.
Claims (10)
1. a kind of magnetic DNA supramolecular hydrogel is it is characterised in that include：
DNA supramolecular hydrogel doped with magnetic oxygenated Graphene；
Wherein, described DNA supramolecular hydrogel adsorbs in magnetic oxygenated graphenic surface.
2. magnetic DNA supramolecular hydrogel as claimed in claim 1 is it is characterised in that described DNA supramolecular hydrogel is by Y-
The sticky end Complementary hybridization self assembly of DNA and L-DNA forms, wherein, the Y that Y-DNA builds for three single-stranded (Y1, Y2, Y3)
Type DNA monomer；The connector DNA monomer that L-DNA builds for two single-stranded (L1, L2).
3. magnetic DNA supramolecular hydrogel as claimed in claim 2 is it is characterised in that described Y-DNA, L-DNA and magnetic oxygen
The mol ratio of graphite alkene is 300～600：900～1800：1～2.
4. a kind of preparation method of magnetic DNA supramolecular hydrogel is it is characterised in that include：
Magnetic oxygenated Graphene, DNA supramolecular hydrogel are scattered in solution, mix homogeneously, isothermal reaction, obtain final product.
5. method as claimed in claim 4 is it is characterised in that described DNA supramolecular hydrogel is viscous by Y-DNA and L-DNA
Property termini-complementary hybridization self assembly form, wherein, the Y type DNA monomer that Y-DNA builds for three single-stranded (Y1, Y2, Y3)；L-DNA
The connector DNA monomer building for two single-stranded (L1, L2)；The condition of described isothermal reaction be 35～37 DEG C at, reaction 3～
3.5h；
The concrete preparation method of described magnetic oxygenated Graphene is as follows：Prepare graphene oxide dispersion, activation, with amino magnetic bead
Reaction, obtains final product；
Described solution is PBS, pH 7.0；
Preferably, described DNA supramolecular hydrogel is formed by the sticky end Complementary hybridization self assembly of Y-DNA and L-DNA；Its
In, the Y type DNA monomer that Y-DNA builds for three single-stranded (Y1, Y2, Y3)；The connection that L-DNA builds for two single-stranded (L1, L2)
Body DNA monomer；
The mol ratio of described Y-DNA, L-DNA and magnetic oxygenated Graphene is 300～600：900～1800：1～2；
The oligonucleotide chain-ordering of described Y-DNA is：
Y1：5'-CACGGACTTGGATCCGCATAACCATTCGCCGTAATG-3'；
Y2：5'-CACGGACTCATTACGGCGAATGTACCGAATCAGCCT-3'；
Y3：5'-CACGGACTAGGCTGATTCGGTAGTTATGCGGATCCA-3'；
The oligonucleotide chain-ordering of described L-DNA is：
L1：
5'-AGTCCGTGGTAGGGCAGGTTGGGGTGACTGGTTGGTGTGGTTGG-3'；
L2：
5'-AGTCCGTGCCAACCACACCAACCAGTCACCCCAACCTGCCCTAC-3'.
6. a kind of load antitumor drug magnetic DNA supramolecular hydrogel is it is characterised in that include：
DNA supramolecular hydrogel doped with magnetic oxygenated Graphene；
It is supported on the antitumor drug on described magnetic DNA supramolecular hydrogel；
Wherein, described DNA supramolecular hydrogel sticky end adsorbs in described magnetic oxygenated graphenic surface.
7. hydrogel as claimed in claim 6 is it is characterised in that described DNA supramolecular hydrogel is by Y-DNA's and L-DNA
Sticky end Complementary hybridization self assembly forms, the Y type DNA monomer that described Y-DNA builds for three single-stranded (Y1, Y2, Y3)；Described
The connector DNA monomer that L-DNA builds for two single-stranded (L1, L2)；
Wherein, the mol ratio of described Y-DNA monomer and L-DNA monomer and magnetic oxygenated Graphene, antitumor drug be 300～
600：900～1800：1～2：3×104～6 × 104；
Or described antitumor drug is DOX, E-ADM, THP.
8. a kind of preparation method of load antitumor drug magnetic DNA supramolecular hydrogel is it is characterised in that include：
Magnetic oxygenated Graphene, Y-DNA, L-DNA, antitumor drug are scattered in solution, mix homogeneously, isothermal reaction, obtain
The magnetic DNA supramolecular hydrogel of load antitumor drug.
9. a kind of magnetic DNA supramolecular hydrogel of cladding horseradish peroxidase (HRP) is it is characterised in that include：
DNA supramolecular hydrogel doped with magnetic oxygenated Graphene；
It is coated on the horseradish peroxidase (HRP) in described DNA supramolecular hydrogel；
Wherein, constitute in the L-DNA' monomer of described DNA supramolecular hydrogel, the single stranded DNA being connected with Y-DNA contains ATP fits
Body sequence；
Described DNA supramolecular hydrogel sticky end adsorbs in magnetic oxygenated graphenic surface.
10. a kind of preparation method of the magnetic DNA supramolecular hydrogel of cladding horseradish peroxidase (HRP) it is characterised in that
Including：
Horseradish peroxidase (HRP), magnetic oxygenated Graphene, Y-DNA, L-DNA are scattered in solution, mix homogeneously, permanent
Temperature reaction, obtains final product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610860783.XA CN106397796B (en) | 2016-09-28 | 2016-09-28 | A kind of preparation method and applications of magnetic DNA supramolecular hydrogel |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610860783.XA CN106397796B (en) | 2016-09-28 | 2016-09-28 | A kind of preparation method and applications of magnetic DNA supramolecular hydrogel |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106397796A true CN106397796A (en) | 2017-02-15 |
| CN106397796B CN106397796B (en) | 2019-02-19 |
Family
ID=58015650
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610860783.XA Active CN106397796B (en) | 2016-09-28 | 2016-09-28 | A kind of preparation method and applications of magnetic DNA supramolecular hydrogel |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106397796B (en) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107569448A (en) * | 2017-09-06 | 2018-01-12 | 青岛大学 | A kind of preparation method and applications of Self-assembled DNA hydrogel |
| CN109234263A (en) * | 2018-09-27 | 2019-01-18 | 福建海峡石墨烯产业技术研究院有限公司 | A method of the crosslinked action immobilized enzyme based on adenosine monophosphate and graphene |
| CN109554331A (en) * | 2017-09-27 | 2019-04-02 | 清华大学 | L- nucleic acid hydrogel |
| CN109576256A (en) * | 2018-12-03 | 2019-04-05 | 北京化工大学 | Method for encapsulating double enzymes by magnetic DNA hydrogel |
| CN109781688A (en) * | 2019-01-18 | 2019-05-21 | 青岛科技大学 | The method that the construction method and Ratio-type of DNA silicon nano-hydrogel based on Nano particles of silicon dioxide detect intracellular ATP |
| CN110272982A (en) * | 2019-06-11 | 2019-09-24 | 天津大学 | A kind of magnetic DNA hydrogel and preparation method thereof |
| CN112844325A (en) * | 2020-09-15 | 2021-05-28 | 海南大学 | Specific DNA hydrogel material for extracting uranium from seawater and preparation method thereof |
| CN113702462A (en) * | 2021-08-15 | 2021-11-26 | 厦门大学附属第一医院 | Preparation method of controllable-release electrochemical DNA hydrogel composite material based on assistance of double-strand specific nuclease |
| CN113774055A (en) * | 2021-09-16 | 2021-12-10 | 湖南大学 | Nucleic acid nanogel and preparation method and application thereof |
| CN115054569A (en) * | 2022-05-16 | 2022-09-16 | 四川大学华西医院 | DNA hydrogel for treating alveolar bone injury and preparation method and application thereof |
| CN113774055B (en) * | 2021-09-16 | 2024-05-10 | 湖南大学 | Nucleic acid nanogel and preparation method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102274521A (en) * | 2011-08-25 | 2011-12-14 | 天津医科大学 | Graphene oxide-based target gene vector material and preparation and use thereof |
| CN102949727A (en) * | 2012-12-12 | 2013-03-06 | 天津医科大学 | Common carrier material for targeting anticancer drug and gene and preparation and application |
| CN104086786A (en) * | 2014-07-17 | 2014-10-08 | 厦门大学 | Preparation method and application of hydrogel electrode |
| CN104165912A (en) * | 2013-06-26 | 2014-11-26 | 江南大学 | Preparation method and use of graphene oxide surface molecularly imprinted sol-gel polymer |
-
2016
- 2016-09-28 CN CN201610860783.XA patent/CN106397796B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102274521A (en) * | 2011-08-25 | 2011-12-14 | 天津医科大学 | Graphene oxide-based target gene vector material and preparation and use thereof |
| CN102949727A (en) * | 2012-12-12 | 2013-03-06 | 天津医科大学 | Common carrier material for targeting anticancer drug and gene and preparation and application |
| CN104165912A (en) * | 2013-06-26 | 2014-11-26 | 江南大学 | Preparation method and use of graphene oxide surface molecularly imprinted sol-gel polymer |
| CN104086786A (en) * | 2014-07-17 | 2014-10-08 | 厦门大学 | Preparation method and application of hydrogel electrode |
Non-Patent Citations (8)
| Title |
|---|
| YONGZHENG XING等: ""Self-Assembled DNA Hydrogels with Designable Thermal and Enzymatic Responsiveness"", 《ADV. MATER.》 * |
| YUXI XU等: ""Three-Dimensional Self-Assembly of Graphene Oxide and DNA into Multifunctional Hydrogels"", 《ACS NANO》 * |
| 吕国蔚: "《实验神经生物学》", 31 March 2002 * |
| 宋萍等: ""DNA水凝胶的制备及生物应用"", 《化学进展》 * |
| 王乐乐等: ""磁性氧化石墨烯的制备方法及其复合材料的应用研究"", 《江西化工》 * |
| 赵海旭等: ""刺激响应型DNA水凝胶及其在生物传感和药物控制方面的应用"", 《沈阳药科大学学报》 * |
| 赵秋伶等: ""基于核酸适体检测ATP的酶联分析新方法"", 《高等学校化学学报》 * |
| 邵昱等: ""DNA超分子水凝胶"", 《高分子通报》 * |
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107569448B (en) * | 2017-09-06 | 2020-08-25 | 青岛大学 | Preparation method and application of self-assembled DNA hydrogel |
| CN107569448A (en) * | 2017-09-06 | 2018-01-12 | 青岛大学 | A kind of preparation method and applications of Self-assembled DNA hydrogel |
| CN109554331A (en) * | 2017-09-27 | 2019-04-02 | 清华大学 | L- nucleic acid hydrogel |
| CN109234263A (en) * | 2018-09-27 | 2019-01-18 | 福建海峡石墨烯产业技术研究院有限公司 | A method of the crosslinked action immobilized enzyme based on adenosine monophosphate and graphene |
| CN109576256A (en) * | 2018-12-03 | 2019-04-05 | 北京化工大学 | Method for encapsulating double enzymes by magnetic DNA hydrogel |
| CN109576256B (en) * | 2018-12-03 | 2022-05-13 | 北京化工大学 | Method for encapsulating double enzymes by magnetic DNA hydrogel |
| CN109781688A (en) * | 2019-01-18 | 2019-05-21 | 青岛科技大学 | The method that the construction method and Ratio-type of DNA silicon nano-hydrogel based on Nano particles of silicon dioxide detect intracellular ATP |
| CN109781688B (en) * | 2019-01-18 | 2021-06-08 | 青岛科技大学 | Construction method of DNA silicon nano hydrogel and method for detecting ATP in cells in ratio mode |
| CN110272982A (en) * | 2019-06-11 | 2019-09-24 | 天津大学 | A kind of magnetic DNA hydrogel and preparation method thereof |
| CN112844325A (en) * | 2020-09-15 | 2021-05-28 | 海南大学 | Specific DNA hydrogel material for extracting uranium from seawater and preparation method thereof |
| CN112844325B (en) * | 2020-09-15 | 2022-01-28 | 海南大学 | Specific DNA hydrogel material for extracting uranium from seawater and preparation method thereof |
| CN113702462A (en) * | 2021-08-15 | 2021-11-26 | 厦门大学附属第一医院 | Preparation method of controllable-release electrochemical DNA hydrogel composite material based on assistance of double-strand specific nuclease |
| CN113702462B (en) * | 2021-08-15 | 2023-10-20 | 厦门大学附属第一医院 | Preparation method of double-strand specific nuclease-assisted controlled release electrochemical DNA hydrogel composite material |
| CN113774055A (en) * | 2021-09-16 | 2021-12-10 | 湖南大学 | Nucleic acid nanogel and preparation method and application thereof |
| CN113774055B (en) * | 2021-09-16 | 2024-05-10 | 湖南大学 | Nucleic acid nanogel and preparation method and application thereof |
| CN115054569A (en) * | 2022-05-16 | 2022-09-16 | 四川大学华西医院 | DNA hydrogel for treating alveolar bone injury and preparation method and application thereof |
| CN115054569B (en) * | 2022-05-16 | 2024-03-19 | 四川大学华西医院 | DNA hydrogel for treating alveolar bone injury and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106397796B (en) | 2019-02-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106397796A (en) | Method for preparing magnetic DNA (deoxyribonucleic acid) supramolecular hydrogel and application thereof | |
| Yang et al. | Aptamer-conjugated nanomaterials and their applications | |
| Liu et al. | Aptamer-incorporated hydrogels for visual detection, controlled drug release, and targeted cancer therapy | |
| Heister et al. | Higher dispersion efficacy of functionalized carbon nanotubes in chemical and biological environments | |
| Cardenas-Benitez et al. | Covalent functionalization of carbon nanomaterials for biosensor applications: An update | |
| Umapathi et al. | Engineered nanomaterials for biomedical applications and their toxicity: a review | |
| Pan et al. | Poly (2-hydroxypropylene imines) functionalized magnetic polydopamine nanoparticles for high-efficiency DNA isolation | |
| US20210378975A1 (en) | Metal-nucleic acid nanoparticle, preparation method therefor and use thereof | |
| Zhang | Selective modification of inner surface of halloysite nanotubes: A review | |
| Cui et al. | Graphene oxide protected nucleic acid probes for bioanalysis and biomedicine | |
| Moodley et al. | Polymeric mesoporous silica nanoparticles for combination drug delivery in vitro | |
| Iqbal et al. | Responsive-DNA hydrogel based intelligent materials: Preparation and applications | |
| Lu et al. | Chemisorption mechanism of dna on mg/fe layered double hydroxide nanoparticles: insights into engineering effective SiRNA delivery systems | |
| Chakraborty et al. | Development of DNA nanotechnology and uses in molecular medicine and biology | |
| Kapri et al. | Chemical modifications of porous carbon nanospheres obtained from ubiquitous precursors for targeted drug delivery and live cell imaging | |
| Panicker et al. | Gold‐Aryl nanoparticles coated with polyelectrolytes for adsorption and protection of DNA against nuclease degradation | |
| CN102458379B (en) | Functional amphiphilic molecule or macromolecule formulations with multiple compartments | |
| CN101927006A (en) | Preparation method of pH-responded metal organic coordination polymer based on medicament | |
| CN102552110A (en) | Medicament-supported hydrogel system and preparation method thereof | |
| Chen et al. | Bioinspired affinity DNA polymers on nanoparticles for drug sequestration and detoxification | |
| CN106046280B (en) | A kind of Inorganic-organic Hybrid Material and its preparation method and application | |
| Moradi et al. | Simulation and computational study of graphene oxide nano-carriers, absorption, and release of the anticancer drug of camptothecin | |
| WO2019126627A1 (en) | Dna origami nanoparticle delivery of programmed chromosome breakage machinery | |
| Azizi et al. | Synthesis of folic acid functionalized terbium‐doped dendritic fibrous nano‐silica and interaction with HEK 293 normal, MDA breast cancer and HT 29 colon cancer cells | |
| CN111166728B (en) | Tumor-targeted composite nano-drug carrier, drug, preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |