CN106367497A - Series G-quadruplex-heme DNA enzyme label-free signal amplification method based on rolling-circle amplification - Google Patents
Series G-quadruplex-heme DNA enzyme label-free signal amplification method based on rolling-circle amplification Download PDFInfo
- Publication number
- CN106367497A CN106367497A CN201610772798.0A CN201610772798A CN106367497A CN 106367497 A CN106367497 A CN 106367497A CN 201610772798 A CN201610772798 A CN 201610772798A CN 106367497 A CN106367497 A CN 106367497A
- Authority
- CN
- China
- Prior art keywords
- dna
- circle amplification
- rolling circle
- rolling
- microsphere
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/682—Signal amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application provides a series G-quadruplex-heme DNA enzyme label-free signal amplification method based on rolling-circle amplification. The series G-quadruplex-heme DNA enzyme label-free signal amplification method comprises the steps of: 1) using affinity eluent and a biotinylated capture probe to treat functional microballs of streptavidin to obtain pretreated microballs; 2) cyclically amplifying and purifying the sample genomic DNA to obtain cyclic DNA; 3) mixing the pretreated microballs obtained in step 1) and the prepared cyclic DNA obtained in step 2) and then amplifying them in the rolling-circle to obtain rolling-circle amplification products; 4) mixing the rolling-circle amplification products with the heme to obtain the rolling-circle amplification products with signals amplified, and forming an amplified detection signal by the rolling-circle amplification products with signals amplified. In the step 1) and step 2) there is no time sequence. The detection limit of salmonella is 0.03 pmol/L, the detection cost is low, the operation is simple, the sensitivity is extremely high, the detection is rapid, and whether the salmonella is contained in the sample can be judged by the naked eye.
Description
Technical field
The present invention relates to technical field of molecular biology, series connection g- tetra- serobila of more particularly, to a kind of rolling circle amplification-blood red
The label-free method for amplifying signal of plain dna enzyme.
Background technology
Salmonella is that one of enterobacteriaceae can cause the Gram-negative enteric bar that the mankind or animal are caused a disease
Bacterium.According to ASSOCIATE STATISTICS, in all kinds of bacterial food poisonings of countries in the world, salmonellal alimentary toxicosis Chang Ju
The umber one, in China mainland area with Salmonella as first place, in Britain with Salmonella as first place, the U.S. is then second, generation
In boundary, maximum salmonella food poisoning together is the Salmonella typhimurium poisoning that nineteen fifty-three is caused due to Carnis Sus domestica in Sweden,
7717 people's poisonings, 90 people are dead.The detection of therefore Salmonella is always the key problem of Salmonella research.
Traditional method currently used for detection Salmonella is bacterial cultivation, and this cultural method totally can be divided into three
Different phase, overall process takes at least 4-7 days and just can draw clear and definite diagnostic result, and this produces to timely, the effectively treatment of disease
Raw strong influence.The development of biosensor technique has promoted application in life science for the analytical chemistry significantly.Due to
It is excellent that biosensor technique has that sensitivity is high, selectivity is good, cost is relatively low, analyze speed is fast and can continuously monitor etc.
Point, has very high using value in chemistry, biology, medical science, food, environment, medicine and other fields.It is presently available for Salmonella inspection
The biosensor technique surveyed mainly has immunological method, polymerase chain reaction (pcr) technology, biochip technology, fluorescent quantitation
Pcr, Phage display peptide library etc..The Salmonella Fast Detection Technique using at present is shown very compared with traditional detection method
Many advantages, but simultaneously there is also certain defect, such as complex operation, high cost, rely on large-scale instrument, need special marking etc. to lack
Point.
With people's pay attention to day by day safe to food and the highest attention to food hygiene monitor in real time, need by each
Be combined with each other between kind of technology and supplement not only make respective advantage obtain maximum play, also compensate for individually that a kind of detection technique is not
Foot.Therefore inexpensive, simple to operate, label-free highly sensitive Salmonella method for quick is easy in exploitation is urgently to be resolved hurrily
Technical problem.
Content of the invention
In view of this, present invention aims to the deficiencies in the prior art, and provide and a kind of be based on rolling circle amplification
Series connection g- tetra- serobilas-label-free method for amplifying signal of haemachrome dna enzyme.
In order to realize foregoing invention purpose, present invention offer technical scheme below:
The invention provides a kind of series connection g- tetra- serobilas-label-free signal of haemachrome dna enzyme based on rolling circle amplification amplifies
Method, comprises the following steps:
1) using affinity elution liquid and biotinylation capture probe, Streptavidin functionalized microsphere is processed, obtain
Pretreatment microsphere；
2) sample gene group dna is circulated amplification and purification, obtains being cyclized dna；
3) by described step 1) the pretreatment microsphere that obtains and described step 2) carry out rolling ring after the cyclisation dna mixing that obtains
Amplification, obtains rolling circle amplification product；
4) by described step 3) rolling circle amplification product that obtains is combined with haemachrome, and the rolling circle amplification obtaining signal amplification produces
Thing, the rolling circle amplification product that described signal amplifies forms the detection signal amplifying；
Described step 1) and step 2) between do not have time sequencing limit.
Preferably, described step 1) particularly as follows:
By described Streptavidin functionalized microsphere after the washing of affinity elution liquid and centrifugation, with biotinylation capture probe
Mixing, vibration, recentrifuge washs, and obtains pretreatment microsphere；
The rotating speed of described centrifugation is 3000～4000rpm, and the time of described centrifugation is 2～8min；
The temperature of described vibration is 25～45 DEG C, and the time of described vibration is 0.5～1.5h；
The rotating speed of described recentrifuge is 3000～4000rpm, and the time of described recentrifuge is 2～8min.
Preferably, described affinity elution liquid includes the component of following concentration: 15～25mmol/l tris-hcl, 0.5～
1.5mol/l nacl, 0.5～1.5mmol/l edta-2na and the triton-x100 that volumetric concentration is 0.0005%；
The ph value of described affinity elution liquid is 7.0～8.0.
Preferably, described step 2) in cyclic amplification system be 65～80 μ l ddh2O, 5～15 μ l 10 × high temperature are even
Connect enzyme reaction buffer solution, 3～8 μ l cyclization dna, 5～15 μ l sample gene groups dna and 0.1～0.8 μ lampligase；
The process of described cyclic amplification is: first 25～45 DEG C of reaction 5～12min, then 94 DEG C of reaction 25～35s, last 25
～45 DEG C of reaction 5～12min, totally 20～30 circulations.
Preferably, the sequential structure of described cyclization dna is:
cgtcaattgctgcggttaagcgtgctgaagtcaagttaaaacccaacccgccctacccaaaatgcttcttctgcggg
taa.
Preferably, the reagent that described purification uses includes 10 × exonuclease iii reaction buffer, amplification dna, nucleic acid
Excision enzyme, exonuclease and water.
Preferably, the raw material that described rolling circle amplification uses include described 10 × phi29dna polymerase buffer,
Phi29dna polymerase, dtt and dntp.
Preferably, described step 4) in rolling circle amplification product and haemachrome combination in pbs solution and tris buffer
Carry out under system.
Preferably, the sequential structure of described capture probe is:
biotin-teg-aaaaaaaaaaaacttgacttcagcacgct.
The invention provides a kind of series connection g- tetra- serobilas-label-free signal of haemachrome dna enzyme based on rolling circle amplification amplifies
Test kit, including described Streptavidin functionalized microsphere, affinity elution liquid, biotinylation capture probe, haemachrome, 10
× high temperature conjunction enzyme reaction buffer solution, ampligase, cyclization dna, purification use reagent, rolling circle amplification use raw material,
Pbs solution and tris buffer.
The invention provides a kind of series connection g- tetra- serobilas-label-free signal of haemachrome dna enzyme based on rolling circle amplification amplifies
Method, comprises the following steps: 1) using affinity elution liquid and biotinylation capture probe, Streptavidin functionalized microsphere is entered
Row is processed, and obtains pretreatment microsphere；2) sample gene group dna is circulated amplification and purification, obtains being cyclized dna；3) by institute
State step 1) the pretreatment microsphere that obtains and described step 2) carry out rolling circle amplification after the cyclisation dna mixing that obtains, obtain rolling ring
Amplified production；4) by described step 3) rolling circle amplification product that obtains is combined with haemachrome, obtains the rolling circle amplification of signal amplification
Product, the rolling circle amplification product that described signal amplifies forms the detection signal amplifying；Described step 1) and step 2) between do not have
Time sequencing limits., using rolling ring amplifying technique amplification g- tetra- serobila dna sequence, the dna sequence after amplification can group for the present invention
Dress up thousands of g- tetra- serobilas-haemachrome dna enzyme for catalyzed signal amplification so that this technology is not needing additional markers and not
The detection of a small amount of Salmonella is realized in the case of relying on large-scale instrument and equipment；The method for amplifying signal that the present invention provides will connect
Cyclic amplification technology, rolling circle amplification and g- tetra- serobilas-haemachrome dna enzyme catalysiss system effectively combine, to Salmonella dna
Detection be limited to 0.03pmol/l, testing cost is low, simple to operate, sensitivity is high, detection is quick and can by naked eyes judge
The features such as whether contain Salmonella in sample, it is suitable for developing into Salmonella field quick detection technology；The present invention provides
Signal amplification technique has good specificity, and its specificity derives from the special probe design of Salmonella.
Brief description
Fig. 1 is the series connection g- tetra- serobilas-haemachrome dna enzyme label-free signal enlarged diagram based on rolling circle amplification；
Fig. 2 is the feasibility analysis of detection Salmonella dna；
Fig. 3 is the sensitive analysis of detection Salmonella dna；
Fig. 4 is the performance evaluation of Salmonella in detection actual sample.
Specific embodiment
The invention provides a kind of series connection g- tetra- serobilas-label-free signal of haemachrome dna enzyme based on rolling circle amplification amplifies
Method, comprises the following steps:
1) using affinity elution liquid and biotinylation capture probe, Streptavidin functionalized microsphere is processed, obtain
Pretreatment microsphere；
2) sample gene group dna is circulated amplification and purification, obtains being cyclized dna；
3) by described step 1) the pretreatment microsphere that obtains and described step 2) carry out rolling ring after the cyclisation dna mixing that obtains
Amplification, obtains rolling circle amplification product；
4) by described step 3) rolling circle amplification product that obtains is combined with haemachrome, and the rolling circle amplification obtaining signal amplification produces
Thing, the rolling circle amplification product that described signal amplifies forms the detection signal amplifying；
Described step 1) and step 2) between do not have time sequencing limit.
After described Streptavidin functionalized microsphere is preferably washed and is centrifuged through affinity elution liquid by the present invention, with biotin
Change capture probe mixing, vibration, recentrifuge washs, and obtains pretreatment microsphere.In the present invention, to described Streptavidin work(
The species of the microsphere in microsphere can be changed and source is not particularly limited, the microsphere using the conventional selection of those skilled in the art is
Can.It is preferably specifically silicon dioxide microsphere, polystyrene type organic polymeric microspheres or magnetic microsphere, more preferably polyphenyl
Vinyl organic polymeric microspheres.The diameter of the microsphere in described Streptavidin functionalized microsphere is preferably 5～40 μm, more excellent
Elect 10～30 μm as, most preferably 15～25 μm.In the present invention, described microsphere preferably through Streptavidin functionalization at
Reason, the carboxyl that the method for described process is specially on microsphere is issued in cross-linking agent edc/nhs effect with the amino of streptavidin
Raw covalent cross-linking.In described 100 μ l Streptavidin functionalized microspheres, the mass content of microsphere is preferably 1mg/ml～25mg/
Ml, more preferably 5mg/ml～20mg/ml, most preferably 10mg/ml.
In the present invention, described affinity elution liquid preferably includes the component of following concentration: 15～25mmol/l tris-
Hcl, 0.5～1.5mol/l nacl, 0.5～1.5mmol/l edta-2na and the triton- that volumetric concentration is 0.0005%
x100；More preferably 18～22mmol/l tris-hcl, 0.8～1.2mol/l nacl, 0.8～1.2mmol/l edta-2na
The triton-x100 being 0.0005% with volumetric concentration；Most preferably 20mmol/l tris-hcl, 1.0mol/l nacl,
The 1.0mmol/l edta-2na and triton-x100 that volumetric concentration is 0.0005%.The present invention does not have to the source of above-mentioned medicine
There is special restriction, using the conventional medicine selected of those skilled in the art.
In the present invention, the ph value of described affinity elution liquid is preferably 7.0～8.0, more preferably 7.3～7.7, most preferably
For 7.5.
In the present invention, described affine cleaning mixture and the volume ratio of Streptavidin functionalized microsphere are preferably 0.5:2, more
It is preferably 0.8～1.5, most preferably 1:1.In the present invention, the number of times of described washing preferably 1～5 time, more preferably 2～3
Secondary.
Streptavidin functionalized microsphere after the washing of affinity elution liquid is centrifuged by the present invention, in the present invention, institute
The rotating speed stating centrifugation is preferably 3000～4000rpm, more preferably 3300～3700rpm, most preferably 3500rpm.At this
In bright, the time of described centrifugation is preferably 2～8min, more preferably 4～6min, most preferably 5min.The present invention to described from
The equipment of the heart does not have particular/special requirement, using the conventional use of centrifugation apparatus of those skilled in the art, such as centrifuge.
In the present invention, the sequential structure of described capture probe is:
The probe that the present invention provides preferably includes two parts: the biotin during (1) extends even is biotin modification, and teg is
C15 extends chain, primarily serves the purpose of and reduces the sterically hindered impact to hybridization；(2) cttgacttcagcacgct and cyclization dna
Area is complementary, for capturing annular dna.
Being conventionally synthesized from company of biotinylation capture probe.In the present invention, described Streptavidin function
The volume ratio changing microsphere with the solution of biotinylation capture probe is preferably 100:(0.4～0.8), more preferably 100:(0.5～
0.7), most preferably 100:0.6.In the solution of described biotinylation capture probe the mass concentration of capture probe be preferably 80～
120 μm of ol/l, more preferably 90～110 μm ol/l, most preferably 100 μm ol/l.Described capture probe is dissolved in the present invention
In deionized water.
In the present invention, the temperature of described vibration is preferably 25～45 DEG C, more preferably 30～40 DEG C, and most preferably 37
℃.In the present invention, the time of described vibration is preferably 0.5～1.5h, more preferably 0.8～1.2h, most preferably 1h.This
The bright equipment that described vibration is adopted is not particularly limited, using the conventional oscillator device selected of those skilled in the art,
As shaker.
After described vibration, by the feed liquid obtaining recentrifuge, in the present invention, the rotating speed of described recentrifuge is excellent for the present invention
Elect 3000～4000rpm, more preferably 3300～3700rpm, most preferably 3500rpm as.In the present invention, described again from
The time of the heart is preferably 2～8min, more preferably 4～6min, most preferably 5min.The present invention does not have to the equipment of described centrifugation
Particular/special requirement, using the conventional use of centrifugation apparatus of those skilled in the art, such as centrifuge.
In the present invention, washed again after described vibration, the described consumption washing again and washing times and first
The consumption of secondary washing is identical with number of times.In the present invention, the described purpose washed again is to remove unconjugated probe.
In the present invention, sample gene group dna is circulated amplification and purification, obtains being cyclized dna.
In the present invention, the system of described cyclic amplification is preferably: 65～80 μ l ddh2O, 5～15 μ l 10 × high temperature are even
Connect enzyme reaction buffer solution, 3～8 μ l cyclization dna, 5～15 μ l sample gene groups dna and 0.1～0.8 μ lampligase；More preferably
For 70～76 μ l ddh2O, 8～12 μ l 10 × high temperature conjunction enzyme reaction buffer solution, 4～6 μ l cyclization dna, 8～12 μ l sample bases
Because organizing dna and 0.3～0.6 μ lampligase；Most preferably 74.5 μ l ddh2O, 10 μ l 10 × high temperature conjunction enzyme reaction bufferings
Liquid, 5 μ l cyclization dna, 10 μ l sample gene groups dna and 0.5 μ lampligase.In the present invention, described high temperature conjunction enzyme reaction
Buffer and ampligase are commercial goods.
In the present invention, the sequential structure of described cyclization dna is:
In the present invention, in described cyclization dna structure area's dna special with Salmonella with * area Complementary hybridization so that becoming
The 5' end of ring dna is close to each other with 3' end, can form 3' in the presence of high temperature conjunction enzyme, and 5'- phosphodiester bond cyclization is described
The 5' end of cyclization dna is preferably through phosphatizing treatment；Ii area is the complementary region of capture probe, can mate hybridization with capture probe；
Iii area comprises the reverse complemental chain of g- tetra- serobila formation sequence, and described iii area comprises 4 groups of ccc structures, can by rolling circle amplification
Comprise the g- tetra- serobila sequence repeating in a large number in the single-stranded dna producing, in the single-stranded dna of described generation, comprise 4 groups of certain bits
The ggg structure put.
In the present invention, the enzyme activity of described ampligase is preferably 80～120u/ μ l, more preferably 90～110u/ μ
L, most preferably 100u/ μ l.
In the present invention, the process of described cyclic amplification is preferably: first 25～45 DEG C of reaction 5～12min, then 94 DEG C of reactions
25～35s, last 25～45 DEG C of reaction 5～12min, totally 20～30 circulations；The process of more preferably cyclic amplification is: first 32
～40 DEG C of reaction 6～10min, then 94 DEG C of reaction 28～32s, last 32～40 DEG C of reaction 6～10min, totally 22～27 circulations；
The process of most preferably cyclic amplification is: first 37 DEG C of reaction 8min, then 94 DEG C of reaction 30s, last 37 DEG C of reaction 8min, totally 25
Circulation.The present invention is not particularly limited to the instrument of described cyclic amplification, using the conventional instrument selected of those skilled in the art
, such as pcr instrument.
After described cyclic amplification, the product obtaining is carried out purification by the present invention, obtains being cyclized dna.In the present invention, described
Purified reagent preferably includes 10 × exonuclease iii reaction buffer, amplification dna, exonuclease, exonuclease
And water.In the present invention, described water is specifically preferably deionized water.The present invention does not have spy to the source of described purified reagent
Different restriction, using the commercial goods of the above-mentioned purified reagent of those skilled in the art.
In the present invention, the system of described purification is preferably: 10 × exonuclease iii reaction buffer of 5～15 μ l,
85～110 μ l amplification dna, 3～8 μ l exonucleases, 2.0～3.0 μ l exonucleases, deionized water is supplemented to 200 μ
l；More preferably 10 × exonuclease iii reaction buffer of 8～12 μ l, 95～105 μ l, 4～6 μ l exonucleases,
2.2～3.7 μ l exonucleases, deionized water is supplemented to 200 μ l；10 × exonuclease iii of most preferably 10 μ l is anti-
Answer buffer, 100 μ l, 5 μ l exonucleases, 2.5 μ l exonucleases, deionized water is supplemented to 200 μ l.
In the present invention, the enzyme activity of described exonuclease is preferably 10～30u/ μ l, more preferably 15～25u/ μ
L, most preferably 20u/ μ l；The enzyme activity of described exonuclease preferably 350～450u/ μ l, more preferably 375～
425u/ μ l, most preferably 400u/ μ l.
In the present invention, the process of described purification is preferably: 25～42 DEG C of reaction 45～75min, then 70～100 DEG C of reactions
15～40min；More preferably 32～40 DEG C reaction 50～65min, then 75～90 DEG C of reaction 20～30min；Most preferably 37 DEG C
Reaction 60min, then 80 DEG C of reaction 25min.The instrument that the present invention adopts to described purification is not particularly limited, using this area skill
The conventional instrument selected of art personnel.
The sequence of the cyclisation dna obtaining is: 5 ' cgtcaattgctgcggttaagcgtgctgaagtcaagttaaaaccca
Acccgccctacccaaaatgcttcttctgcgggtaa3 ', the 5 ' of this sequence and 3 ' couples together cyclization.
The present invention carries out rolling circle amplification mix the pretreatment obtaining microsphere with the cyclisation dna obtaining after, obtains rolling ring expansion
Volume increase thing.
In the present invention, the source and species of the raw material that described rolling circle amplification uses is not particularly limited, using ability
The conventional medicine selected of field technique personnel.It is preferably specifically 10 × phi29dna polymerase buffer, phi29dna
Polymerase, dtt and dntp.
In the present invention, described rolling circle amplification preferred pair cyclisation dna carries out pretreatment, obtains preprocessing solution.Described pre-
Process system preferably include 20～40 μ l deionized waters, 3～8 μ l pretreatment microspheres, 3～8 μ l cyclisation dna, the 10 of 3～8 μ l
× phi29dna is polymerized enzyme buffer solution；More preferably 25～35 μ l deionized waters, 4～6 μ l pretreatment microspheres, 4～6 μ l cyclisation
Dna, 10 × phi29dna polymerization enzyme buffer solution of 4～6 μ l；Most preferably 30.5 μ l deionized waters, 5 μ l pretreatment microspheres, 5
μ l is cyclized 10 × phi29dna polymerization enzyme buffer solution of dna, 5 μ l.
In the present invention, preferably 25～42 DEG C reaction 5～15min of the process of described pretreatment, more preferably 30～40
DEG C reaction 8～12min, most preferably 37 DEG C reaction 10min.In the present invention, the purpose of described pretreatment is using microsphere table
The capture probe that face is modified and annular dna hybridization.
After obtaining described preprocessing solution, the phi29dna polymerase, 1～3 μ l that preferably add 0.1～0.8 μ l are second-rate
Threitol, 1～3 μ ldntp carry out rolling circle amplification, more preferably add phi29dna polymerase, 1.5～2.5 μ l of 0.3～0.6 μ l
Second-rate threitol, 1.5～2.5 μ l dntp, the phi29dna polymerase of most preferably 0.5 μ l, the second-rate threitol of 2 μ l, 2 μ
ldntp.The present invention is not particularly limited to the source of above-mentioned medicine, and the medicine using the conventional selection of those skilled in the art is
Can.
In the present invention, the process of described rolling circle amplification preferably reacts 30～60min at 25～42 DEG C, more preferably 30～
40 DEG C of reaction 40～50min, most preferably react 45min at 37 DEG C.
In the present invention, the enzyme activity of described phi29dna polymerase preferably 80～120u/ μ l, more preferably 90～
110u/ μ l, most preferably 100u/ μ l；The mass concentration of described second-rate threitol is preferably 80～120mmol/l, more preferably
90～110mmol/l, most preferably 100mmol/l；The mass concentration of described dntp is preferably 20～30mmol/l, more preferably
22～27mmol/l, most preferably 25mmol/l.
After described rolling circle amplification, preferred pair of the present invention obtains product centrifugation, the precipitation that described centrifugation is obtained pbs solution
Washing, obtains cyclic amplification product.In the present invention, the speed of described centrifugation is preferably 3500rpm, and the time of described centrifugation is excellent
Elect 5min as.In the present invention, the molar concentration of described pbs solution is preferably 0.1mol/l pbs；The number of times of described washing is excellent
Elect 2～3 times as.
The sequence of rolling circle amplification product is: 5 ' ttacccgcagaagaagcattttgggtagggcgggttgggttttaac
Ttgacttcagcacgcttaaccgcagcaattgacg 3 ', described rolling circle amplification product is the hundreds of of above-mentioned sequence
Constantly repeat.
After obtaining cyclic amplification product, described rolling circle amplification product is combined by the present invention with haemachrome, obtains signal and amplifies
Rolling circle amplification product, the rolling circle amplification product that described signal amplifies forms the detection signal amplifying.In the present invention, described rolling
Circle amplification product is preferably carried out with the combination of haemachrome under the conditions of tris buffer solution and lucifuge.
In the present invention, the volume mass ratio of the microsphere after described tris buffer solution is amplified with described rolling ring is preferably (5
～30) μ l:50 μ g, more preferably (10～20) μ l:50 μ g), most preferably 15 μ l:50 μ g.In the present invention, described tris delays
Rush the component that solution preferably includes following concentration: 25mmol/l tris-hcl, 100mmol/l nacl, 2mmol/l mgcl2、
5mmol/l kcl；The ph value of described tris buffer solution is 7.4.
In the present invention, the mass ratio of the microsphere after the haemachrome in described haemachrome solution is amplified with described rolling ring is preferred
For (0.02～0.1) μ g:50 μ g, more preferably (0.04～0.08) μ g:50 μ g, most preferably 0.06 μ g:50 μ g.
In the present invention, the temperature of described lucifuge reaction is preferably 25～42 DEG C, more preferably 30～40 DEG C, most preferably
37℃；The time of described lucifuge reaction is preferably 40～80min, most preferably 50～70min, most preferably 60min.
After the rolling circle amplification product that the signal obtaining is amplified washs through tris buffer solution, add abts solution and just joined
The h of system2o2Solution is reacted, and detects the light absorption value in 420nm for the supernatant by taking supernatant after color change or centrifugation
Carry out the Salmonella in qualitative or quantitative judgement sample.
In the present invention, the rolling circle amplification product that described signal amplifies adds abts solution and the firm h preparing2o2After solution
The temperature reacted is preferably 25～42 DEG C, more preferably 30～40 DEG C, most preferably 37 DEG C；The time of above-mentioned reaction is preferred
For 2～8min, more preferably 3～6min, most preferably 5min.
In the present invention, the addition of described abts solution is preferably 40～60 μ l, more preferably 45～55 μ l, most preferably
For 50 μ l；The concentration of described abts solution is preferably 2～6mmol/l, more preferably 3～5mmol/l, most preferably 4mmol/l.
In the present invention, described h2o2The addition of solution is preferably 40～60 μ l, more preferably 45～55 μ l, most preferably
For 50 μ l；The concentration of described abts solution is preferably 2～6mmol/l, more preferably 3～5mmol/l, most preferably 4mmol/l.
After completing above-mentioned reaction, the supernatant after color change or detection centrifugation is determined in the light absorption value of 420nm
Salmonella in property or rational judgment sample.
The method that the present invention provides employs two probes, is capture probe and cyclization dna respectively.As shown in Figure 1: capture
Probe is fixed on microsphere (Fig. 1, step 1) by Streptavidin-biotin, and is used for capturing annular dna and carries out rolling ring and put
Greatly；Cyclization dna comprises four functional areas, is i, i*, ii and iii respectively, and wherein i and i* dna special with Salmonella complementation is miscellaneous
Hand over so that the 5 ' ends of cyclization dna are close to each other with 3 ' ends, 3' can be formed in the presence of ligase, 5'- phosphodiester bond becomes
Ring, then in the presence of exonuclease i and iii, (Fig. 1, step 2) is cut to 3 ' flat end dna of single-stranded dna and complementation；ii
Area is the complementary region of capture probe, can mate hybridization with capture probe；Iii area comprises the reverse complemental of g- tetra- serobila formation sequence
Chain, can comprise the g- tetra- serobila sequence repeating in a large number in the single-stranded dna producing by rolling circle amplification.Capture probe capture annular
Dna simultaneously carries out rolling circle amplification, and synthesis comprises to repeat the long-chain dna (Fig. 1, step 3) of g- tetra- serobila sequence in a large number, with haemachrome knot
Close and produce a large amount of g- tetra- serobilas-haemachrome dna enzyme, be catalyzed abts-h2o2Reaction, generates jade-green abts ●+(Fig. 1, step
4).There is absorption at 420nm, can observe by the naked eye or spectrophotometry.
The invention provides a kind of series connection g- tetra- serobilas-label-free signal of haemachrome dna enzyme based on rolling circle amplification amplifies
Test kit, including the Streptavidin functionalized microsphere described in claim 1-9, affinity elution liquid, biotinylation capture visit
Pin, haemachrome, 10 × high temperature conjunction enzyme reaction buffer solution, ampligase, cyclization dna, the reagent of purification use, rolling circle amplification
Raw material, pbs solution and the tris buffer using.
Below in conjunction with the embodiment in the present invention, the technical scheme in the present invention is clearly and completely described.Aobvious
So, described embodiment is only a part of embodiment of the present invention, rather than whole embodiments.Based on the reality in the present invention
Apply example, the every other embodiment that those of ordinary skill in the art are obtained under the premise of not making creative work, all belong to
In the scope of protection of the invention.
Embodiment 1
Feasibility analysis:
Prepared by pretreatment microsphere: take 100 μ l streptavidin functionalized microspheres to wash two with the affinity elution liquid of 100 μ l
Secondary, 3500rpm is centrifuged 5min, removes supernatant, adds the affinity elution liquid of 49.4 μ l and the biotin of 0.6 100 μm of ol/l of μ l
Change capture probe shaking table at 37 DEG C to shake 1 hour, with affinity elution liquid centrifuge washing 2 times, remove unconjugated probe, finally
Add 100 μ l affinity elution liquid and preserve pretreatment microsphere in 4 DEG C.
The preparation of cyclisation dna: take sterilized deionized water centrifuge tube being dried, measuring 74.5 μ l with liquid-transfering gun,
Add 10 μ l 10 × connect enzyme reaction buffer solution, the cyclization dna of 1 μm of ol/l of the 5 ' phosphorylations of 5 μ l, the synthesis of 10 μ l
Salmonella dna sequence (10pmol/l), the high temperature conjunction enzyme of 0.5 μ l, cumulative volume is 100 μ l.After solution mixes, using connection
Cyclic amplification technology, step is as follows: centrifuge tube is positioned at 37 DEG C and reacts 8 minutes, move to reaction 30s at 94 DEG C, then at 37
DEG C reaction 8 minutes, circulate 25 times.For obtaining the cyclisation product of purification further, molten using the degraded mixing of Exonucleolytic enzyme method
Other than ring type dna in liquid.Exonuclease double digestion system is: will be molten for 10 × exonuclease iii reaction buffering of 10 μ l
Liquid adds in the cyclisation product of above-mentioned 100 μ l, adds exonuclease i solution 5 μ l, exonuclease iii solution 2.5
μ l, is eventually adding 82.5 μ l deionized waters, makes cumulative volume reach 200 μ l.Fully mix and react 1 hour after 37 DEG C, afterwards again
80 DEG C are reacted 25 minutes, and subpackage preserves after -20 DEG C.
Rolling circle amplification: take a sterilizing and the centrifuge tube being dried, add 30.5 μ l deionized waters, sequentially add 5 μ l's
Pretreatment microsphere, the cyclisation dna solution of 5 μ l, 5 μ l10 × phi29dna polymerization enzyme buffer solution mix homogeneously are anti-at 37 DEG C
Answer 10 minutes, add phi29dna polymerase 0.5 μ l, the dtt solution 2 μ l of 100mmol/l, dntp solution 2 μ of 25mmol/l
L, is sufficiently mixed and uniformly carries out rolling circle amplification within 45 minutes after 37 DEG C of isothermal reactions.Washed using 0.1mol/l pbs solution after centrifugation
Wash 2-3 time, be subsequently adding 19 μ l tris buffer solution and 100 μm of ol/l hemin solution of 1 μ l, keep away under conditions of 37 DEG C
Photoreaction 1 hour.Fully wash microsphere with tris buffer solution after the completion of reaction and remove unconjugated haemachrome, be eventually adding
The abts solution of 4mmol/l and the 4mmol/l h of firm configuration2o2The each 50 μ l of solution, are reacted 5 minutes at 37 DEG C, are become by color
Supernatant solution is taken to detect it whether contain Salmonella in judgement sample in the light absorption value of 420nm after changing or being centrifuged.
Feasibility analysis: for detecting the feasibility of the present invention program, devise four groups of experiments.It is named as 1,2,3,4 successively
Group: the wherein first group experiment flow fully according to dna cyclisation and rolling circle amplification completes to test；Second group is added without 10 μ l synthesis
Salmonella dna, is substituted with 10 μ l te buffer, and other steps are consistent with described in dna cyclisation and rolling circle amplification；3rd group is not
Add the ampligase of 0.5 μ l, substituted with 0.5 μ lampligase buffer solution, other steps are cyclized with step dna and rolling ring
Amplification is described consistent；The extinction value changes that the 4th group of autoxidation then directly surveying abts leads to.Result is as shown in Fig. 2 display only has
Add Salmonella dna and cyclization dna is cyclized (Fig. 2 organizes 1), obvious detection signal could occur, abts only has extremely low
Autoxidation signal (Fig. 2, organize 4), group 2 and group 3 background signals (Fig. 2) that only haemachrome causes.It is indicated above the base set up
In rolling circle amplification series connection g- tetra- serobilas-haemachrome dna enzyme signal amplification system be used for Salmonella label-free detection be can
Row.
Embodiment 2
Sensitive analysis:
The preparation of pretreatment microsphere: take 100 μ l Streptavidin functionalized microspheres to wash two with the affinity elution liquid of 100 μ l
Secondary, 3500rpm is centrifuged 5min, removes supernatant, adds the affinity elution liquid of 49.4 μ l and the biotin of 0.6 100 μm of ol/l of μ l
Change capture probe shaking table at 37 DEG C to shake 1 hour, remove unconjugated probe 2 times with affinity elution liquid centrifuge washing, finally
Add 100 μ l affinity elution liquid and preserve pretreatment microsphere in 4 DEG C.
The preparation of cyclisation dna: take sterilized deionized water centrifuge tube being dried, measuring 74.5 μ l with liquid-transfering gun,
Add 10 μ l 10 × connect enzyme reaction buffer solution, the cyclization dna of 1 μm of ol/l of the 5 ' phosphorylations of 5 μ l, the synthesis of 10 μ l
Salmonella dna sequence, the high temperature conjunction enzyme of 0.5 μ l, cumulative volume is 100 μ l.After solution mixes, using connection cyclic amplification skill
Art, step is as follows: centrifuge tube is positioned at 37 DEG C and reacts 8 minutes, move to reaction 30s at 94 DEG C, react 8 points then at 37 DEG C
Clock, circulates 25 times.For obtaining the cyclisation product of purification further, degraded using Exonucleolytic enzyme method acyclic in mixed solution
Shape dna.Exonuclease double digestion system is: 10 × exonuclease iii reaction buffer solution of 10 μ l is added above-mentioned
In the cyclisation product of 100 μ l, add exonuclease i solution 5 μ l, exonuclease iii solution 2.5 μ l, finally plus
Enter 82.5 μ l deionized waters, make cumulative volume reach 200 μ l.Fully mix and react 1 hour after 37 DEG C, 80 DEG C of reactions 25 more afterwards
Minute, subpackage preserves after -20 DEG C.
Rolling circle amplification: take a sterilizing and the centrifuge tube being dried, add 30.5 μ l deionized waters, sequentially add 5 μ l's
Pretreatment microsphere, the cyclisation dna solution of 5 μ l, 5 μ l10 × phi29dna polymerization enzyme buffer solution mix homogeneously are anti-at 37 DEG C
Answer 10 minutes, add phi29dna polymerase 0.5 μ l, the dtt solution 2 μ l of 100mmol/l, dntp solution 2 μ of 25mmol/l
l.It is sufficiently mixed and uniformly carry out rolling circle amplification within 45 minutes after 37 DEG C of isothermal reactions.Washed using 0.1mol/l pbs solution after centrifugation
Wash 2-3 time, be subsequently adding 19 μ l tris buffer solution and 100 μm of ol/l hemin solution of 1 μ l, keep away under conditions of 37 DEG C
Photoreaction 1 hour.Fully wash microsphere with tris buffer solution after the completion of reaction and remove unconjugated haemachrome, be eventually adding
The abts solution of 4mmol/l and the 4mmol/l h of firm configuration2o2The each 50 μ l of solution, react 5 minutes at 37 DEG C, directly carry out purple
Outer absorption detecting.Select the absorbance at 420nm as measured value, define δ a420nm=a420nm- a0, wherein a420nmFor sample
Measured value, a0It is background value when 0 for Salmonella dna concentration.Signal value becomes with the rising of Salmonella dna concentration
Greatly, when Salmonella dna concentration reaches a timing (more than 50pmol/l), light absorption value is several with the increase of Salmonella dna concentration
No longer change, this shows that this system has had arrived at saturation (Fig. 3 a).When Salmonella dna concentration 0.01pmol/l～
When between 1pmol/l, in good linear relationship (Fig. 3 b), regression equation is δ a420nm=0.1241cSalmonella+ 0.0843 is (single
Position: pmol/l), linearly dependent coefficient r2=0.9902, obtained divided by the slope of standard curve with 3 times of standard deviations of blank group
The detection of this method is limited to 0.03pmol/l.
Embodiment 3
The performance evaluation of Salmonella in detection actual sample:
The preparation of pretreatment microsphere: take 100 μ l streptavidin functionalized microspheres to wash two with the affinity elution liquid of 100 μ l
Secondary, 3500rpm is centrifuged 5min.Remove supernatant, add the affinity elution liquid of 49.4 μ l and the biotin of 0.6 100 μm of ol/l of μ l
Change capture probe shaking table at 37 DEG C to shake 1 hour, remove unconjugated probe 2 times with affinity elution liquid centrifuge washing, finally
Add 100 μ l affinity elution liquid and preserve pretreatment microsphere in 4 DEG C.
The culture of Salmonella and the enzyme action of genome dna: Salmonella is cultivated in lb culture medium, are led to using commercialization
Extract the genome dna of Salmonella with bacterial genomes dna extracts kit.Processed using rsai restriction endonuclease
Salmonella gene group dna of extracting, condition is: adds the rsai of 10u and its reaction slow in 50ng salmonella gene group dna
Rush solution, cumulative volume 50 μ l, react 60min in 37 DEG C, subsequently in 65 DEG C of reaction 30min inactivation rsa i.The rsai of Salmonella
Digestion products, in 95 DEG C of degenerative treatments 15min, make sequence to be measured keep single-chain state with placing 10min after 0 DEG C.In addition make
Carry out the culture consistent with Salmonella with escherichia coli as reference and enzyme action is processed.
The preparation of cyclisation dna: take sterilized deionized water centrifuge tube being dried, measuring 74.5 μ l with liquid-transfering gun,
Add 10 × connection enzyme reaction buffer solution of 10 μ l, the cyclization dna of 1 μm of ol/l of the 5 ' phosphorylations of 5 μ l, 10 μ l rsa i enzymes
Salmonella gene group dna cut, the high temperature conjunction enzyme of 0.5 μ l, cumulative volume is 100 μ l.After solution mixes, circulated using connecting
Amplification technique, step is as follows: centrifuge tube is positioned at 37 DEG C and reacts 8 minutes, move to reaction 30s at 94 DEG C, anti-then at 37 DEG C
Answer 8 minutes, circulate 25 times, by connecting circulation with a small amount of masterplate synthesis annular dna in a large number.For obtaining the cyclisation of purification further
Product, using the other than ring type dna in Exonucleolytic enzyme method degraded mixed solution.Exonuclease double digestion system is: by 10 μ
10 × exonuclease iii of l reacts in the cyclisation product that buffer solution adds above-mentioned 100 μ l, adds exonuclease
I solution 5 μ l, exonuclease iii solution 2.5 μ l, are eventually adding 82.5 μ l deionized waters, make cumulative volume reach 200 μ l.Fill
Point mix after 37 DEG C react 1 hour, afterwards again 80 DEG C react 25 minutes, subpackage after -20 DEG C preserve.
Rolling circle amplification: take a sterilizing and the centrifuge tube being dried, add 30.5 μ l deionized waters, sequentially add 5 μ l's
Functionalized microsphere, the cyclisation dna solution of 5 μ l, 5 μ l10 × phi29dna polymerization enzyme buffer solution mix homogeneously are anti-at 37 DEG C
Answer 10 minutes, add phi29dna polymerase 0.5 μ l, the dtt solution 2 μ l of 100mmol/l, dntp solution 2 μ of 25mmol/l
L, is sufficiently mixed and uniformly carries out rolling circle amplification within 45 minutes after 37 DEG C of isothermal reactions.Washed using 0.1mol/l pbs solution after centrifugation
Wash 3 times, be subsequently adding 19 μ l tris buffer solution and 100 μm of ol/l haemachrome solutions of 1 μ l, lucifuge under conditions of 37 DEG C
Reaction 1 hour.Fully wash microsphere with tris buffer solution after the completion of reaction and remove unconjugated haemachrome, be eventually adding
The abts solution of 4mmol/l and the 4mmol/l h of firm configuration2o2The each 50 μ l of solution, react 5 minutes at 37 DEG C, directly carry out purple
Outer absorption detecting.Select the absorbance at 420nm as measured value, define δ a420nm=a420nm- a0, wherein a420nmFor sample
Measured value, a0It is background value when 0 for Salmonella dna concentration.Result shows: 10ng salmonella gene group dna is (about
Series connection g- tetra- serobilas based on rolling circle amplification 3.4amol) being established-haemachrome dna enzyme signal amplifying technique identification, produce
Detection signal, and as reference, 100ng genome of E.coli dna fails to produce discernible signal, illustrates that this technology can use
Effective analysis of Salmonella in actual sample.
As seen from the above embodiment, the signal amplification technique that the present invention provides will connect cyclic amplification technology, rolling circle amplification
And g- tetra- serobilas-haemachrome dna enzyme catalysiss system effectively combines, the detection to Salmonella dna is limited to 0.03pmol/l,
Testing cost is low, simple to operate, sensitivity is high, detection is quick and whether can contain Salmonella by naked eyes judgement sample
The features such as, it is suitable for developing into Salmonella field quick detection technology.
The above is only the preferred embodiment of the present invention it is noted that ordinary skill people for the art
For member, under the premise without departing from the principles of the invention, some improvements and modifications can also be made, these improvements and modifications also should
It is considered as protection scope of the present invention.
Claims (10)
1. a kind of series connection g- tetra- serobilas-label-free method for amplifying signal of haemachrome dna enzyme based on rolling circle amplification, walks including following
Rapid:
1) using affinity elution liquid and biotinylation capture probe, Streptavidin functionalized microsphere is processed, obtain pre- place
Reason microsphere；
2) sample gene group dna is circulated amplification and purification, obtains being cyclized dna；
3) by described step 1) the pretreatment microsphere that obtains and described step 2) carry out after the cyclisation dna mixing that obtains rolling ring and expand
Increase, obtain rolling circle amplification product；
4) by described step 3) rolling circle amplification product that obtains is combined with haemachrome, obtains the rolling circle amplification product of signal amplification,
The rolling circle amplification product that described signal amplifies forms the detection signal amplifying；
Described step 1) and step 2) between do not have time sequencing limit.
2. method according to claim 1 is it is characterised in that described step 1) particularly as follows:
By described Streptavidin functionalized microsphere after the washing of affinity elution liquid and centrifugation, mix with biotinylation capture probe
Close, vibrate, recentrifuge washs, and obtains pretreatment microsphere；
The rotating speed of described centrifugation is 3000～4000rpm, and the time of described centrifugation is 2～8min；
The temperature of described vibration is 25～45 DEG C, and the time of described vibration is 0.5～1.5h；
The rotating speed of described recentrifuge is 3000～4000rpm, and the time of described recentrifuge is 2～8min.
3. method according to claim 1 and 2 is it is characterised in that described affinity elution liquid includes the component of following concentration:
15～25mmol/ltris-hcl, 0.5～1.5mol/lnacl, 0.5～1.5mmol/l edta-2na and volumetric concentration are
0.0005% triton-x100；
The ph value of described affinity elution liquid is 7.0～8.0.
4. method according to claim 1 is it is characterised in that described step 2) in the system of cyclic amplification be 65～80 μ l
ddh2O, 5～15 μ l 10 × high temperature conjunction enzyme reaction buffer solution, 3～8 μ l cyclization dna, 5～15 μ l sample gene groups dna and
0.1～0.8 μ lampligase；
The process of described cyclic amplification is: first 25～45 DEG C of reaction 5～12min, then 94 DEG C of reaction 25～35s, last 25～45
DEG C reaction 5～12min, totally 20～30 circulation.
5. method according to claim 4 is it is characterised in that the sequential structure of described cyclization dna is:
5’cgtcaattgctgcggttaagcgtgctgaagtcaagttaaaacccaacccgccctacccaaaatgcttcttc
tgcgggtaa3’.
6. method according to claim 1 is it is characterised in that the reagent that described purification uses includes 10 × exonuclease
Iii reaction buffer, amplification dna, exonuclease, exonuclease and water.
7. method according to claim 1 it is characterised in that raw material that described rolling circle amplification uses include described 10 ×
Phi29dna polymerase buffer, phi29dna polymerase, dtt and dntp.
8. method according to claim 1 is it is characterised in that described step 4) in rolling circle amplification product and haemachrome knot
It is combined in and carry out under pbs solution and the system of tris buffer.
9. method according to claim 1 is it is characterised in that the sequential structure of described capture probe is:
biotin-teg-aaaaaaaaaaaacttgacttcagcacgct.
10. the test kit that a kind of series connection g- tetra- serobilas-label-free signal of haemachrome dna enzyme based on rolling circle amplification amplifies, including
Streptavidin functionalized microsphere described in claim 1-9, affinity elution liquid, biotinylation capture probe, haemachrome, 10 ×
High temperature conjunction enzyme reaction buffer solution, ampligase, cyclization dna, the reagent of purification use, the raw material of rolling circle amplification use, pbs
Solution and tris buffer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610772798.0A CN106367497B (en) | 2016-08-30 | 2016-08-30 | Tandem G-quadruplex-heme DNA enzyme label-free signal amplification method based on rolling circle amplification |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610772798.0A CN106367497B (en) | 2016-08-30 | 2016-08-30 | Tandem G-quadruplex-heme DNA enzyme label-free signal amplification method based on rolling circle amplification |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106367497A true CN106367497A (en) | 2017-02-01 |
| CN106367497B CN106367497B (en) | 2020-02-04 |
Family
ID=57902323
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610772798.0A Active CN106367497B (en) | 2016-08-30 | 2016-08-30 | Tandem G-quadruplex-heme DNA enzyme label-free signal amplification method based on rolling circle amplification |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106367497B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107236795A (en) * | 2017-06-06 | 2017-10-10 | 江南大学 | A kind of method that Magneto separate RCA synthetic dnases detect staphylococcus aureus |
| CN108486233A (en) * | 2018-03-23 | 2018-09-04 | 江南大学 | A kind of method of Visual retrieval GM food |
| CN109406596A (en) * | 2018-12-13 | 2019-03-01 | 合肥工业大学 | A kind of electrochemical sensor, preparation method and application detecting microRNA-21 |
| CN110452965A (en) * | 2019-05-28 | 2019-11-15 | 临沂大学 | Fusarium prolifertum Visual detection methods based on recombination enzymatic amplification and G- tetrad |
| CN111398389A (en) * | 2020-04-24 | 2020-07-10 | 军事科学院军事医学研究院军事兽医研究所 | DNA nano structure, electrochemical aptamer biosensor system, and preparation method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102586450A (en) * | 2012-03-06 | 2012-07-18 | 中国科学院上海微系统与信息技术研究所 | Rolling circle amplification-based colorimetric assay method for target nucleic acids or proteins |
| CN103710453A (en) * | 2013-12-30 | 2014-04-09 | 深圳先进技术研究院 | Chemiluminescence reaction-based methylase detection probe, detection kit and detection method |
| CN105018474A (en) * | 2014-08-22 | 2015-11-04 | 江苏省原子医学研究所 | Probe based on G-quadruplex-chlorine heme DNA enzyme and application of probe |
-
2016
- 2016-08-30 CN CN201610772798.0A patent/CN106367497B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102586450A (en) * | 2012-03-06 | 2012-07-18 | 中国科学院上海微系统与信息技术研究所 | Rolling circle amplification-based colorimetric assay method for target nucleic acids or proteins |
| CN103710453A (en) * | 2013-12-30 | 2014-04-09 | 深圳先进技术研究院 | Chemiluminescence reaction-based methylase detection probe, detection kit and detection method |
| CN105018474A (en) * | 2014-08-22 | 2015-11-04 | 江苏省原子医学研究所 | Probe based on G-quadruplex-chlorine heme DNA enzyme and application of probe |
Non-Patent Citations (5)
| Title |
|---|
| BADAOGU1: "链霉亲和素磁珠使用说明书", 《豆丁网》 * |
| HONG-XIN JIANG ET AL: "Amplified detectionofDNAligaseandpolynucleotide kinase/phosphatase onthebasisofenrichmentofcatalytic G-quadruplexDNAzymebyrollingcircleamplification", 《BIOSENSORS ANDBIOELECTRONICS》 * |
| YUNA GUO ET AL: "Label-freeandhighlysensitiveelectrochemicaldetectionof E.coli based onrollingcircleamplifications coupledperoxidase-mimicking DNAzymeamplification", 《BIOSENSORS ANDBIOELECTRONICS》 * |
| 卢宇等: "不同的G四链体结构对DNAzyme活性的影响", 《中国生物化学与分子生物学报》 * |
| 孔德明: "G-四链体-氯化血红素DNA酶在传感器设计中的应用", 《化学进展》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107236795A (en) * | 2017-06-06 | 2017-10-10 | 江南大学 | A kind of method that Magneto separate RCA synthetic dnases detect staphylococcus aureus |
| CN108486233A (en) * | 2018-03-23 | 2018-09-04 | 江南大学 | A kind of method of Visual retrieval GM food |
| CN109406596A (en) * | 2018-12-13 | 2019-03-01 | 合肥工业大学 | A kind of electrochemical sensor, preparation method and application detecting microRNA-21 |
| CN109406596B (en) * | 2018-12-13 | 2021-01-01 | 合肥工业大学 | Electrochemical sensor for detecting microRNA-21, preparation method and application thereof |
| CN110452965A (en) * | 2019-05-28 | 2019-11-15 | 临沂大学 | Fusarium prolifertum Visual detection methods based on recombination enzymatic amplification and G- tetrad |
| CN111398389A (en) * | 2020-04-24 | 2020-07-10 | 军事科学院军事医学研究院军事兽医研究所 | DNA nano structure, electrochemical aptamer biosensor system, and preparation method and application thereof |
| CN111398389B (en) * | 2020-04-24 | 2022-05-17 | 军事科学院军事医学研究院军事兽医研究所 | DNA nano structure, electrochemical aptamer biosensor system, and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106367497B (en) | 2020-02-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106367497A (en) | Series G-quadruplex-heme DNA enzyme label-free signal amplification method based on rolling-circle amplification | |
| CN107190079B (en) | Quick detection technology and kit for five food-borne pathogenic bacteria micro-fluidic chip | |
| Pillai | Rapid molecular detection of microbial pathogens: breakthroughs and challenges | |
| CN103436608B (en) | Rapid detection method based on nucleic acid aptamers and kit | |
| CN106434902B (en) | Multiplex PCR detects bacillus cereus virulence gene primer sets and kit and its detection method | |
| CN107254550B (en) | SPR sensor for detecting HIV related gene and preparation and application thereof | |
| CN106916906A (en) | A kind of Primer composition and its kit for detecting infectious diarrhea pathogen | |
| CN104745589A (en) | Screening method and application of nucleic acid aptamers for specifically recognizing streptomycin | |
| CN107630108A (en) | A kind of RCA methods for detecting zika virus | |
| Liu et al. | A graphene oxide and exonuclease-aided amplification immuno-sensor for antigen detection | |
| CN104975098A (en) | Method for rapid fluorescence detection of polynucleotide target objects simultaneously at room temperature and constant temperature | |
| CN102094090B (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
| CN106645050A (en) | Aptamer used for detecting lactoferrin content, and application thereof | |
| CN106093023A (en) | A kind of colorimetric sensor detecting mercury ion and preparation method thereof | |
| CN101215600A (en) | Detection probe and detection method for nucleic acid aim sequence | |
| CN108504753A (en) | A method of detection staphylococcus aureus live bacteria in milk | |
| CN101565753B (en) | Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof | |
| Zhou et al. | CRISPR Cas12a‐based “sweet” biosensor coupled with personal glucose meter readout for the point‐of‐care testing of Salmonella | |
| CN101824482B (en) | Detection kit for vibrio cholerae O1 group and detection method thereof | |
| CN107893123A (en) | Enterobacter cloacae 16SrDNA and primer sets Yg2 and its application in terms of enterobacter cloacae Molecular Detection | |
| CN105063200B (en) | A kind of method of determining sample kanamycins concentration | |
| CN104165999A (en) | Homogeneous chemiluminescence immune assay method based on adjacent position striking effect | |
| CN109825519B (en) | Detection carrier based on glucometer detection | |
| CN104561010B (en) | Homocysteine aptamer HCy5 and preparation method thereof | |
| CN101979660A (en) | Brucella detection kit and using method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |