CN103710453A - Chemiluminescence reaction-based methylase detection probe, detection kit and detection method - Google Patents
Chemiluminescence reaction-based methylase detection probe, detection kit and detection method Download PDFInfo
- Publication number
- CN103710453A CN103710453A CN201310746076.4A CN201310746076A CN103710453A CN 103710453 A CN103710453 A CN 103710453A CN 201310746076 A CN201310746076 A CN 201310746076A CN 103710453 A CN103710453 A CN 103710453A
- Authority
- CN
- China
- Prior art keywords
- methylase
- primer
- enzyme
- dna
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a chemiluminescence reaction-based methylase detection probe, a detection kit and a detection method. The chemiluminescence reaction-based methylase detection probe provided by the invention is simple in design without being any labeled and modified. Meanwhile, according to the chemiluminescence reaction-based methylase detection probe, methylase and specific incision enzyme depending on methylation are used as a combination, a detection probe with a hairpin structure can be cut apart by depending an interaction of the methylase and the specific incision enzyme so as to generate a primer signal, and thus a chemiluminescence signal is generated. Moreover, any other action of the methylase to hairpin structures can not be recognized by incision enzyme outside the combination, and thus no primer signal can be generated, and therefore, no chemiluminescence signal is generated so that the specificity of the chemiluminescence reaction-based methylase detection probe is very high. In addition, according to the technical scheme adopted by the invention, two advantages of high ligase catalysis efficiency and remarkably enhanced chemiluminescence signal are serially connected, so that the detection sensitivity is greatly improved. The chemiluminescence reaction-based methylase detection probe is wide in application value on aspects of early diagnosis for diseases and screening of drugs.
Description
Technical field
The present invention relates to Molecular Detection field, be specifically related to a kind of methylase detection probes, detection kit and detection method based on chemiluminescence reaction.
Background technology
Methylase (as Dam methylase, Dcm methylase, EcoK I methylase, Sss I methylase) has become the important biomolecule mark of the numerous disease early diagnosiss that comprise cancer, but they are lower at intracellular content, thereby methylase is carried out to High Sensitive Analysis there is very large challenge.
Existing methylase detection technique mainly comprises high-efficient liquid phase chromatogram technology (HPLC), radio-labeling technology, gold nano colorimetric detection method and fluorescence detection.High-efficient liquid phase chromatogram technology need to consume huge material resources and manpower; Radio-labeling technology often need to be introduced radioelement, dangerous; Gold nano grain pretreatment operation is complicated, length consuming time; Often there is the low shortcoming of sensitivity in fluoroscopic examination.
Therefore, be necessary to provide a kind of cost low, simple and can detect fast, with sensitivity the method for methylase.
Summary of the invention
For addressing the above problem, first aspect present invention provides a kind of methylase detection probes based on chemiluminescence reaction.Second aspect present invention provides a kind of methylase detection kit based on chemiluminescence reaction.Third aspect present invention provides a kind of methylase detection method based on chemiluminescence reaction.Fourth aspect present invention provides a kind of methylase detection method based on chemiluminescence reaction, for detection of the concentration C of base enzyme in testing sample.Methylase detection probes based on chemiluminescence reaction provided by the invention without any need for mark and modification, the reagent cost that methylase detection kit based on chemiluminescence reaction provided by the invention adopts is low, methylase detection method based on chemiluminescence reaction provided by the invention has very high sensitivity and specificity, and methylase detection probes, detection kit and the detection method based on chemiluminescence reaction provided by the invention has wide using value aspect disease early diagnosis and drug screening.
Segment A of the present invention is single chain deoxynucleotide.
First aspect, the invention provides a kind of methylase detection probes based on chemiluminescence reaction, described detection probes comprises hair fastener probe, primer-1 and primer-2, described hair fastener probe comprises stem-1, ring and stem-2 successively, described stem-1, ring and stem-2 are single chain deoxynucleotide, described stem-1 and the complementary double-stranded DNA (1) that forms in stem-2, the enzyme that described double-stranded DNA (1) has the recognition site of methylase and relies on methylated restriction endonuclease is cut sequence, wherein, the recognition site of described methylase and the terminal bases of ring distance are 2～8bp;
Described primer-1 is single chain deoxynucleotide, described primer-1 has at least one Segment A, 5 ' end of described Segment A or 3 ' end have the complementary sequence in nicking endonuclease digestion site, the nucleotide sequence of described Segment A and DNA enzyme sequence are complementary, wherein, described DNA enzyme sequence is many G nucleotide sequence with teichmann's crystals binding site; Described primer-1 also has the sequence with the partial nucleotide sequence complementation of described hair fastener probe, and described primer-2 are single chain deoxynucleotide, and described primer-2 are complementary with the nucleotide sequence at two ends, described primer-1.
Preferably, the enzyme that the double-stranded DNA of described hair fastener probe (1) has the recognition site of methylase and relies on methylated restriction endonuclease is cut in sequence, described methylase is Dam methylase or M.Taq I methylase, and the methylated restriction endonuclease of described dependence is Dpn I restriction endonuclease.
Concrete, the recognition site of described Dam methylase is GATC; The methylated restriction endonuclease of described dependence is that the recognition site of Dpn I restriction endonuclease is G*ATC, and wherein G*ATC is Dpn I restriction enzyme site; When S-adenosylmethionine (Sam) exists, Dam methylase adds that in the A base of its recognition site GATC a methyl forms G*ATC, i.e. Dpn I restriction enzyme site.
Under this optimum condition, the hair fastener probe being methylated after modifying can be relied on methylated restriction endonuclease and be identified, and is cut off.Hair fastener probe after being cut off produces the double-stranded DNA of a little hairpin structure and segment, because little hairpin structure annealing temperature is too low, is opened for the DNA of a strand, this single stranded DNA can with the partial sequence complementary pairing of primer-1.
Primer-1 provided by the invention and primer-2 are mixed, with ring-shaped probe, connect agent treated, can obtain ring-shaped probe.
Preferably, described ring-shaped probe connects reagent and comprises: 1 * T4 ligase enzyme damping fluid (6.6 every liter of mmole magnesium chlorides, 10 every liter of mmole dithiothreitol (DTT), the Triphosaden of 0.1 every liter of mmole, the triisopropyl second sulphonyl hydrochloric acid of 66 every liter of mmole), the excision enzyme mixture of T4 ligase enzyme, PH7.9 (magnesium chloride, every liter of glycine-potassium hydroxide of 67 mmole, 10Ge unit's exon Ⅰ, 20Ge unit's excision enzyme III that the dithiothreitol (DTT) of 1 every liter of mmole, 6.7 mmole are every liter).
Preferably, described processing mode is: primer-2 of getting every liter of every liter of 1 micromole's primer-1 and 1 micromole add in 1 * T4 ligase enzyme damping fluid, in 95 degree heating, within 5 minutes, makes two kinds of primed DNA sex change, then slow cooling to 37 degree; Add again 16 degree reaction overnight after the T4 ligase enzyme of 50Ge unit; After ligation, the reaction product of 10 microlitres is joined in the excision enzyme mixture of 10 microlitres and carry out digestion reaction, obtain described ring-shaped probe.
Preferably, described DNA enzyme sequence is the nucleotide sequence as shown in as arbitrary in SEQ ID NO:1～SEQ ID NO:5.
Preferably, the sequence of described Segment A is the nucleotide sequence as shown in as arbitrary in SEQ ID NO:6～SEQ ID NO:10.
Particularly, described SEQ ID NO:1 is GGGTAGGGCGGGTTGGG,
Under this optimum condition,
The sequence of described Segment A is CCCAACCCGCCCTACCC(SEQ ID NO:6);
Described SEQ ID NO:2 is GGGTGGGTGGGTGGGT,
Under this optimum condition,
The sequence of described Segment A is ACCCACCCACCCACCC(SEQ ID NO:7);
Described SEQ ID NO:3 is GTGGGTAGGGCGGGTTGG,
Under this optimum condition,
The sequence of described Segment A is CCAACCCGCCCTACCCAC(SEQ ID NO:8);
Described SEQ ID NO:4 is GTGGGTCATTGTGGGTGGGTGTGG,
Under this optimum condition,
The sequence of described Segment A is CCACACCCACCCACAATGACCCAC(SEQ ID NO:9);
Described SEQ ID NO:5 is GGTGGTGGTGGTTGTGGTGGTGGTGG,
Under this optimum condition,
The sequence of described Segment A is CCACCACCACCACAACCACCACCACC(SEQ ID NO:10).
Particularly, the sequence of described SEQ ID NO:1～SEQ ID NO:5 can form parallel type G-tetra-serobilas in molecule, these G-tetra-serobilas can be with teichmann's crystals (hemin) in conjunction with forming protoheme-G tetramer, this protoheme-G tetramer is a kind of DNA peroxidase, there is the katalysis of peroxidase, its under luminol,3-aminophthalic acid cyclic hydrazide and hydrogen peroxide existence condition, can catalysis luminol (luminol,3-aminophthalic acid cyclic hydrazide) etc. luminescence reagent generation oxidizing reaction produce chemiluminescence signal; In addition, also can other redox luminous substrate generation redox reactions of catalysis and colorific variation, as two in nitric acid-(lucigenin, claims again N to N-methylacridine father-in-law, N dimethyl two acridine nitrate), 2,4,5-triphenyl imidazoles (lophine), 3,4,5-trihydroxybenzoic acid (gallic acid), two (2,4,6-trichlorophenyl) oxalate (peroxide oxalate) or 2,2 '-amino-bis-(3-ethyl-benzothiazoline-6-sulfonic acid) (ABTS).
Preferably, the nicking restriction endonuclease of 5 ' of described DNA enzyme sequence end or 3 ' end is Nt.BspQI nicking restriction endonuclease, Nt.AlwI nicking restriction endonuclease, Nb.Bsm I nicking restriction endonuclease or Nt.BstNBI nicking restriction endonuclease.
Hair fastener probe of the present invention is after relying on the methylated restriction endonuclease cutting single stranded DNA of gained and the partial sequence complementary pairing of described ring-shaped probe, and under polysaccharase effect, the ring-shaped probe of take reacts as amplification template rolls ring, simultaneously, owing to thering is DNA enzyme sequence in ring-shaped probe, the nicking restriction endonuclease of described 5 ' end or 3 ' end, thereby under the effect of nicking enzyme, rolling the DNA enzyme sequence that ring reaction constantly extends generation can constantly be cut by nicking enzyme, the cutting fragment obtaining can be used as again the primer of new rolling circle amplification reaction, so produce a large amount of short DNA enzyme fragments, these DNA enzyme fragments can be combined with hemin formation and be had the G-tetramer of Catalyzed Synthesis By Peroxidase activity, can catalyzing hydrogen peroxide and luminous substrate as luminol, nitric acid is two-N-methylacridine father-in-law, 2, 4, 5-triphenyl imidazoles, 3, 4, 5-trihydroxybenzoic acid, two (2, 4, 6-trichlorophenyl) oxalate or 2, 2 '-amino-bis-(3-ethyl-benzothiazoline-6-sulfonic acid) (ATBS) carry out redox reaction, produce chemiluminescence signal.
The present invention has produced a large amount of short DNA enzyme fragments by the rolling circle amplification mode of continuous generation primer, recycling DNA enzyme can be combined with hemin and be formed the G-tetramer of Catalyzed Synthesis By Peroxidase activity, this two-step reaction is cascaded, make the exponential expansion of chemiluminescence signal, greatly amplify echo signal, thereby can detect in high sensitivity methylase.
Preferably, the nucleotide sequence of described primer-2 is respectively as shown in SEQ ID NO:11.
Preferably, the nucleotide sequence of described hair fastener probe is as shown in SEQ ID NO:12.
Preferably, the nucleotide sequence of described primer-1 is respectively as shown in SEQ ID NO:13.
Second aspect, the invention provides a kind of methylase detection kit based on chemiluminescence reaction, comprising:
Hair fastener probe, primer-1, primer-2, hair fastener probe methylating reagent, rely on methylated endonuclease digestion reagent, ring-shaped probe and connect reagent, roll and change amplification and nicking endonuclease digestion reagent, DNA enzyme detection reagent,
Wherein, the methylated endonuclease digestion reagent of described dependence comprises the methylated restriction endonuclease of dependence, described ring-shaped probe connects reagent and comprises DNA ligase and DNA excision enzyme, described roll change amplification and nicking endonuclease digestion reagent comprise archaeal dna polymerase and nicking restriction endonuclease, described DNA enzyme detection reagent comprises teichmann's crystals and DNA peroxidase detection reagent;
Described hair fastener probe comprises stem-1, ring and stem-2 successively, described stem-1, ring and stem-2 are single chain deoxynucleotide, described stem-1 and the complementary double-stranded DNA (1) that forms in stem-2, the enzyme that described double-stranded DNA (1) has the recognition site of methylase and relies on methylated restriction endonuclease is cut sequence, wherein, the recognition site of described methylase and the terminal bases of ring distance are 2～8bp;
Described primer-1 is single chain deoxynucleotide, described primer-1 has at least one Segment A, 5 ' end of described Segment A or 3 ' end have the complementary sequence in nicking endonuclease digestion site, the nucleotide sequence of described Segment A and DNA enzyme sequence are complementary, wherein, described DNA enzyme sequence is many G nucleotide sequence with teichmann's crystals binding site; Described primer-1 also has the sequence with the partial nucleotide sequence complementation of described hair fastener probe, and described primer-2 are single chain deoxynucleotide, and described primer-2 are complementary with the nucleotide sequence at two ends, described primer-1.
Preferably, the methylating reagent of hair fastener probe comprises: 160 every liter of micromole's S-adenosylmethionine (Sam), 1 * methylase reaction buffer (triisopropyl second sulphonyl hydrochloric acid of 0.05 mole every liter, pH7.5, the sodium chloride of 0.01 mole every liter, the ethylenediamine tetraacetic acid (EDTA) of 0.01 mole every liter, the 2 mercapto ethanol of 5 every liter of mmole), wherein, described hair fastener probe is preferably every liter of 2 micromole.
Under this preferable case, the condition optimization that methylates of hair fastener probe provided by the invention is: the methylase testing sample of getting appropriate concentration, the methylating reagent that adds hair fastener probe and hair fastener probe, 37 degree are hatched after 2 hours 65 degree reactions again and within 10 minutes, are made enzyme deactivation, the hair fastener probe after being methylated.
Preferably, the enzyme that relies on methylated restriction endonuclease is cut reagent and is also comprised: 1 * NEB damping fluid 4(50 mmole Potassium ethanoate, the triisopropyl second sulphonyl acetic acid of 20 mmoles, 10 mmole magnesium acetates, the dithiothreitol (DTT) of 1 mmole, PH7.9), wherein, the methylated restriction endonuclease of described dependence is preferably the 10 every microlitres of unit.
Under this preferable case, the condition optimization that adopts the methylated restriction endonuclease of described dependence to react the hair fastener probe after methylating is: by methylation reaction product and the enzyme that relies on methylated restriction endonuclease cut reagent by volume 1:3 mix, 37 degree are hatched one and a half hours, and then 80 degree reactions make enzyme deactivation for 20 minutes.
Preferably, described ring-shaped probe connects reagent and also comprises: 1 * T4DNA ligase enzyme damping fluid (6.6 every liter of mmole magnesium chlorides, 10 every liter of mmole dithiothreitol (DTT), the Triphosaden of 0.1 every liter of mmole, the triisopropyl second sulphonyl hydrochloric acid of 66 every liter of mmole), the excision enzyme damping fluid of PH7.9 (magnesium chloride, every liter of glycine-potassium hydroxide of 67 mmole that the dithiothreitol (DTT) of 1 every liter of mmole, 6.7 mmole are every liter), wherein, described DNA ligase is preferably T4DNA ligase enzyme, and described DNA excision enzyme is preferably and comprises exon Ⅰ and excision enzyme III; Described exon Ⅰ and excision enzyme III are preferably respectively the every microlitre of the 1 every microlitre of unit and 2 units, and described primer-1 and primer-2 are all preferably every liter of 1 micromole.
Under this preferable case, adopting described ring-shaped probe to connect reagent prepares the mode of ring-shaped probe and is preferably: primer-2 of getting every liter of every liter of 1 micromole's primer-1 and 1 micromole add in 1 * T4 ligase enzyme damping fluid, in 95 degree heating, within 5 minutes, make two kinds of primed DNA sex change, then slow cooling to 37 degree; Add again 16 degree reaction overnight after the T4 ligase enzyme of 50Ge unit; After ligation, the reaction product of 10 microlitres is joined in the excision enzyme mixture of 10 microlitres and carry out digestion reaction, obtain described ring-shaped probe.
Preferably, described rolling changed amplification and nicking endonuclease digestion reagent also comprises: the ring-shaped probe of 30 every liter of nmole (adopting ring-shaped probe provided by the invention to connect reagent place's preparation), 20 every liter of mmole triisopropyl second sulphonyl hydrochloric acid (PH8.8), the ammonium sulfate of 10 every liter of mmole, the Repone K of 10 every liter of mmole, the magnesium sulfate of 6 every liter of mmole, the mixture of tetra-kinds of deoxyribonucleotides of dNTPs(of 400 every liter of micromole), 0.1% Triton X-100, wherein, described archaeal dna polymerase and nicking restriction endonuclease are preferably respectively the every microlitre of the 0.08 every microlitre of unit and 0.13 unit.
Further preferably, described archaeal dna polymerase is Phi29DNA polysaccharase, Bst archaeal dna polymerase large fragment or VentR exo
–archaeal dna polymerase.
Further preferably, described nicking restriction endonuclease is Nt.BspQI nicking restriction endonuclease, Nt.AlwI nicking restriction endonuclease, Nb.Bsm I nicking restriction endonuclease or Nt.BstNBI nicking restriction endonuclease.
Under this preferable case, described in employing, roll and change amplification and the nicking endonuclease digestion reagent mode of reacting is preferably: the hair fastener probe enzyme of getting volume ratio and be 1:19 cut product and described in roll and change amplification and nicking endonuclease digestion reagent mix, 60 degree are hatched 90 minutes.
Preferably, described DNA peroxidase detection reagent comprises: the deionized water of the luminol,3-aminophthalic acid cyclic hydrazide that 105 microlitres contain every liter of 0.5 mmole, 15 microlitres, 75 microlitre 2 * HEPES damping fluids (HEPES of 40 every liter of mmole, 600 mmole sodium-chlor, PH8.0).
Under this optimum condition, teichmann's crystals (hemin) in described DNA enzyme detection reagent is preferably every liter of 75 nmole, the mode that adopts described DNA enzyme detection reagent to detect is preferably: rolling of 15 microlitres changed to amplification and nicking endonuclease digestion product and join in the described DNA enzyme detection reagent of 105 microlitres and obtain mixture, mixture is put into GloMax96 microplate photometer and detect chemiluminescent signal, use the program of automatic sample to add hydrogen peroxide, the timed interval is set to 1.5 seconds, obtains chemiluminescence signal.
Preferably, the enzyme that the double-stranded DNA of described hair fastener probe (1) has the recognition site of methylase and relies on methylated restriction endonuclease is cut in sequence, described methylase is Dam methylase or M.Taq I methylase, and the methylated restriction endonuclease of described dependence is Dpn I restriction endonuclease.
Further preferably, luminol,3-aminophthalic acid cyclic hydrazide described in described DNA peroxidase detection reagent also replaceable be nitric acid two-N-methylacridine father-in-law, 2,4,5-triphenyl imidazoles, 3,4,5-trihydroxybenzoic acid, two (2,4,6-trichlorophenyl) oxalate or 2,2 '-amino-bis-(3-ethyl-benzothiazoline-6-sulfonic acid).
Preferably, described DNA enzyme sequence is the nucleotide sequence as shown in as arbitrary in SEQ ID NO:1～SEQ ID NO:5.
Preferably, the sequence of described Segment A is the nucleotide sequence as shown in as arbitrary in SEQ ID NO:6～SEQ ID NO:10.
Particularly, described SEQ ID NO:1 is GGGTAGGGCGGGTTGGG,
Under this optimum condition,
The sequence of described Segment A is CCCAACCCGCCCTACCC(SEQ ID NO:6);
Described SEQ ID NO:2 is GGGTGGGTGGGTGGGT,
Under this optimum condition,
The sequence of described Segment A is ACCCACCCACCCACCC(SEQ ID NO:7);
Described SEQ ID NO:3 is GTGGGTAGGGCGGGTTGG,
Under this optimum condition,
The sequence of described Segment A is CCAACCCGCCCTACCCAC(SEQ ID NO:8);
Described SEQ ID NO:4 is GTGGGTCATTGTGGGTGGGTGTGG,
Under this optimum condition,
The sequence of described Segment A is CCACACCCACCCACAATGACCCAC(SEQ ID NO:9);
Described SEQ ID NO:5 is GGTGGTGGTGGTTGTGGTGGTGGTGG,
Under this optimum condition,
The sequence of described Segment A is CCACCACCACCACAACCACCACCACC(SEQ ID NO:10).
Preferably, the nicking restriction endonuclease of 5 ' of described DNA enzyme sequence end or 3 ' end is Nt.BspQI nicking restriction endonuclease, Nt.AlwI nicking restriction endonuclease, Nb.Bsm I nicking restriction endonuclease or Nt.BstNBI nicking restriction endonuclease.
Preferably, the nucleotide sequence of described primer-2 is respectively as shown in SEQ ID NO:11.
Preferably, the nucleotide sequence of described hair fastener probe is as shown in SEQ ID NO:12.
Preferably, the nucleotide sequence of described primer-1 is respectively as shown in SEQ ID NO:13.
Third aspect present invention provides a kind of methylase detection method based on DNA peroxidase, comprises the steps:
1) provide hair fastener probe, primer-1, primer-2, hair fastener probe, primer-1, primer-2, hair fastener probe methylating reagent, rely on methylated endonuclease digestion reagent, ring-shaped probe connects reagent, roll and change amplification and nicking endonuclease digestion reagent, DNA enzyme detection reagent
Wherein, the methylated endonuclease digestion reagent of described dependence comprises the methylated restriction endonuclease of dependence, described ring-shaped probe connects reagent and comprises DNA ligase and DNA excision enzyme, described roll change amplification and nicking endonuclease digestion reagent comprise archaeal dna polymerase and nicking restriction endonuclease, described DNA enzyme detection reagent comprises teichmann's crystals and DNA peroxidase detection reagent;
Described hair fastener probe comprises stem-1, ring and stem-2 successively, described stem-1, ring and stem-2 are single chain deoxynucleotide, described stem-1 and the complementary double-stranded DNA (1) that forms in stem-2, described double-stranded DNA (1) has the recognition site of Dam methylase and the restriction enzyme site of described Dpn I restriction endonuclease, wherein, the recognition site of described methylase and the terminal bases of ring distance are 2～8bp;
Described primer-1 is single chain deoxynucleotide, described primer-1 has at least one Segment A, 5 ' end of described Segment A or 3 ' end have the complementary sequence in nicking endonuclease digestion site, the nucleotide sequence of described Segment A and DNA enzyme sequence are complementary, wherein, described DNA enzyme sequence is many G nucleotide sequence with teichmann's crystals binding site; Described primer-1 also has the sequence with the partial nucleotide sequence complementation of described hair fastener probe, and described primer-2 are single chain deoxynucleotide, and described primer-2 are complementary with the nucleotide sequence at two ends, described primer-1; And
2) get methylase sample to be measured, add described hair fastener probe and hair fastener probe methylating reagent to carry out methylation reaction, obtain containing methylated hair fastener probe product; And
3) containing methylated hair fastener probe product, add the methylated endonuclease digestion reagent of dependence to carry out endonuclease reaction gained, obtain single stranded DNA, the partial sequence of described single stranded DNA and primer-1 is complementary; And
4) primer-1 and primer-2 are mixed, with ring-shaped probe connect that reagent is annealed, connection, enzyme cut processing, obtains ring-shaped probe; And
5) get the single stranded DNA of step 3) gained and the ring-shaped probe of step 4) gained and mix, add to roll and change amplification and nicking endonuclease digestion reagent, carry out rolling circle amplification and endonuclease reaction, the enzyme that obtains nicking restriction endonuclease is cut product; And
6) enzyme of getting gained nicking restriction endonuclease is cut product and is added DNA enzyme detection reagent, and detects chemiluminescence signal.
Preferably, the methylating reagent of hair fastener probe comprises: 160 every liter of micromole's S-adenosylmethionine (Sam), 1 * methylase reaction buffer (triisopropyl second sulphonyl hydrochloric acid of 0.05 mole every liter, pH7.5, the sodium chloride of 0.01 mole every liter, the ethylenediamine tetraacetic acid (EDTA) of 0.01 mole every liter, the 2 mercapto ethanol of 5 every liter of mmole), wherein, described hair fastener probe is preferably every liter of 2 micromole.
Under this optimum condition, in described step (2), described hair fastener probe methylating reagent is processed in the process of methylase sample to be measured, the condition of processing is: the methylase testing sample of getting appropriate concentration, the methylating reagent that adds hair fastener probe and hair fastener probe, 37 degree are hatched after 2 hours 65 degree reactions again and within 10 minutes, are made enzyme deactivation, the hair fastener probe after being methylated.
Preferably, the enzyme that relies on methylated restriction endonuclease is cut reagent and is also comprised: 1 * NEB damping fluid (50 mmole Potassium ethanoates, the triisopropyl second sulphonyl acetic acid of 20 mmoles, 10 mmole magnesium acetates, the dithiothreitol (DTT) of 1 mmole, PH7.9), wherein, the methylated restriction endonuclease of described dependence is preferably the 10 every microlitres of unit.
Under this optimum condition, in described step (3), containing methylated hair fastener probe product, add the methylated endonuclease digestion reagent of dependence to carry out endonuclease reaction gained, obtain in the process of single stranded DNA, the condition of processing is: by methylation reaction product and the enzyme of the methylated restriction endonuclease of dependence cut reagent by volume 1:3 mix, 37 degree are hatched one and a half hours, and then 80 degree reactions make enzyme deactivation for 20 minutes.
Preferably, described ring-shaped probe connects reagent and also comprises: 1 * T4DNA ligase enzyme damping fluid (6.6 every liter of mmole magnesium chlorides, 10 every liter of mmole dithiothreitol (DTT), the Triphosaden of 0.1 every liter of mmole, the triisopropyl second sulphonyl hydrochloric acid of 66 every liter of mmole), the excision enzyme damping fluid of PH7.9 (magnesium chloride, every liter of glycine-potassium hydroxide of 67 mmole that the dithiothreitol (DTT) of 1 every liter of mmole, 6.7 mmole are every liter), wherein, described DNA ligase is preferably T4DNA ligase enzyme, and described DNA excision enzyme is preferably and comprises exon Ⅰ and excision enzyme III; Described exon Ⅰ and excision enzyme III are preferably respectively the every microlitre of the 1 every microlitre of unit and 2 units, and described primer-1 and primer-2 are all preferably every liter of 1 micromole.
Under this optimum condition, in described step (4), primer-1 and primer-2 are mixed, with ring-shaped probe connect that reagent is annealed, connection, enzyme cut processing, obtain in the process of ring-shaped probe, the condition of processing is: primer-2 of getting every liter of every liter of 1 micromole's primer-1 and 1 micromole add in 1 * T4 ligase enzyme damping fluid, in 95 degree heating, within 5 minutes, make two kinds of primed DNA sex change, then slow cooling to 37 degree; Add again 16 degree reaction overnight after the T4 ligase enzyme of 50Ge unit; After ligation, the reaction product of 10 microlitres is joined in the excision enzyme mixture of 10 microlitres and carry out digestion reaction, obtain described ring-shaped probe.
Preferably, described rolling changed amplification and nicking endonuclease digestion reagent also comprises: the ring-shaped probe of 30 every liter of nmole (adopting ring-shaped probe provided by the invention to connect reagent place's preparation), 20 every liter of mmole triisopropyl second sulphonyl hydrochloric acid (PH8.8), the ammonium sulfate of 10 every liter of mmole, the Repone K of 10 every liter of mmole, the magnesium sulfate of 6 every liter of mmole, the mixture of tetra-kinds of deoxyribonucleotides of dNTPs(of 400 every liter of micromole), 0.1% Triton X-100, wherein, described archaeal dna polymerase and nicking restriction endonuclease are preferably respectively the every microlitre of the 0.08 every microlitre of unit and 0.13 unit.
Further preferably, described archaeal dna polymerase is Phi29DNA polysaccharase, Bst archaeal dna polymerase large fragment or VentR exo
–archaeal dna polymerase.
Further preferably, described nicking restriction endonuclease is Nt.BspQI nicking restriction endonuclease, Nt.AlwI nicking restriction endonuclease, Nb.Bsm I nicking restriction endonuclease or Nt.BstNBI nicking restriction endonuclease.
Under this optimum condition, in the process of described step (5), the condition of processing is: the hair fastener probe enzyme of getting volume ratio and be 1:19 cut product and described in roll and change amplification and nicking endonuclease digestion reagent mix, 60 degree are hatched 90 minutes.
Preferably, described DNA peroxidase detection reagent comprises: the deionized water of the luminol,3-aminophthalic acid cyclic hydrazide that 105 microlitres contain every liter of 0.5 mmole, 15 microlitres, 75 microlitre 2 * HEPES damping fluids (HEPES of 40 every liter of mmole, 600 mmole sodium-chlor, PH8.0).
Preferably, in described step (6), the teichmann's crystals (hemin) in described DNA enzyme detection reagent is preferably every liter of 75 nmole.
Under this optimum condition, in described step (6), the enzyme of getting gained nicking restriction endonuclease is cut product and is added DNA enzyme detection reagent, and detect in the process of chemiluminescence signal, the condition of processing is: the mode that adopts described DNA enzyme detection reagent to detect is preferably: rolling of 15 microlitres changed to amplification and nicking endonuclease digestion product and join in the described DNA enzyme detection reagent of 105 microlitres and obtain mixture, mixture is put into GloMax96 microplate photometer and detect chemiluminescent signal, use the program of automatic sample to add hydrogen peroxide, the timed interval is set to 1.5 seconds, obtain chemiluminescence signal.
Further preferably, luminol,3-aminophthalic acid cyclic hydrazide described in described DNA peroxidase detection reagent also replaceable be nitric acid two-N-methylacridine father-in-law, 2,4,5-triphenyl imidazoles, 3,4,5-trihydroxybenzoic acid, two (2,4,6-trichlorophenyl) oxalate or 2,2 '-amino-bis-(3-ethyl-benzothiazoline-6-sulfonic acid).
Preferably, the enzyme that the double-stranded DNA of described hair fastener probe (1) has the recognition site of methylase and relies on methylated restriction endonuclease is cut in sequence, described methylase is Dam methylase or M.Taq I methylase, and the methylated restriction endonuclease of described dependence is Dpn I restriction endonuclease.
Preferably, described DNA enzyme sequence is the nucleotide sequence as shown in as arbitrary in SEQ ID NO:1～SEQ ID NO:5.
Preferably, the sequence of described Segment A is the nucleotide sequence as shown in as arbitrary in SEQ ID NO:6～SEQ ID NO:10.
Particularly, described SEQ ID NO:1 is GGGTAGGGCGGGTTGGG,
Under this optimum condition,
The sequence of described Segment A is CCCAACCCGCCCTACCC(SEQ ID NO:6);
Described SEQ ID NO:2 is GGGTGGGTGGGTGGGT,
Under this optimum condition,
The sequence of described Segment A is ACCCACCCACCCACCC(SEQ ID NO:7);
Described SEQ ID NO:3 is GTGGGTAGGGCGGGTTGG,
Under this optimum condition,
The sequence of described Segment A is CCAACCCGCCCTACCCAC(SEQ ID NO:8);
Described SEQ ID NO:4 is GTGGGTCATTGTGGGTGGGTGTGG,
Under this optimum condition,
The sequence of described Segment A is CCACACCCACCCACAATGACCCAC(SEQ ID NO:9);
Described SEQ ID NO:5 is GGTGGTGGTGGTTGTGGTGGTGGTGG,
Under this optimum condition,
The sequence of described Segment A is CCACCACCACCACAACCACCACCACC(SEQ ID NO:10).
Preferably, the nicking restriction endonuclease of 5 ' of described DNA enzyme sequence end or 3 ' end is Nt.BspQI nicking restriction endonuclease, Nt.AlwI nicking restriction endonuclease, Nb.Bsm I nicking restriction endonuclease or Nt.BstNBI nicking restriction endonuclease.
Preferably, the nucleotide sequence of described primer-2 is respectively as shown in SEQ ID NO:11.
Preferably, the nucleotide sequence of described hair fastener probe is as shown in SEQ ID NO:12.
Preferably, the nucleotide sequence of described primer-1 is respectively as shown in SEQ ID NO:13.
Fourth aspect, the invention provides a kind of methylase detection method based on chemiluminescence reaction, and the concentration C for detection of base enzyme in testing sample, comprises the steps:
By the chemiluminescence signal substitution following formula of the methylase detection method gained based on DNA peroxidase as described in the third aspect
Ic=147614.4+34572.3log
10C
In formula, the luminous intensity that Ic is described chemiluminescence signal, described concentration C is in every milliliter of testing sample, to contain the units of methylase.
Preferably, described methylase is Dam methylase.
The methylase detection probes, detection kit and the detection method that the invention provides based on chemiluminescence reaction have following beneficial effect:
1. hair fastener probe, primer-1 and primer-2 simplicity of design.Hairpin probe provided by the invention is as long as contain the sequence for methylase identification on neck structure, without any need for modification; As long as primer-1 comprise nicking enzyme restriction enzyme site, with the site of hair fastener probe complementation, the sequence of primer-2 is the sequence of primer-1 liang end complementation, this makes probe be easy to design, feasibility is strong.
2. specificity is high.The technical program using methylase and specific rely on methylated restriction endonuclease as being used in combination, only have both interactions hairpin structure could be cut, produce primer signal, thereby produce chemiluminescence signal; And all can not be identified by the restriction endonuclease outside this combination after any other methylase effect hairpin structure, can not produce primer signal, thereby there is no chemiluminescence signal, make the specificity of the technical program very high.
3. highly sensitive.Technical scheme of the present invention is together in series the high two kinds of advantages that significantly strengthen with chemiluminescence signal of ligase enzyme catalytic efficiency, has greatly improved detection sensitivity.
4. cost is low.Chemoluminescence has the highly sensitive and wide feature of linearity range, and cheap, has wide using value aspect biomedical research and medical diagnosis on disease.
Accompanying drawing explanation
The structural representation of the hair fastener probe that Fig. 1 provides for the embodiment of the present invention 1;
The methylase detection method schema based on DNA peroxidase that Fig. 2 provides for the embodiment of the present invention 2;
The chemiluminescence signal of each concentration methylase solution that Fig. 3 provides for the embodiment of the present invention 3;
The different concns methylase that Fig. 4 provides for the embodiment of the present invention 3 and the variation relation matched curve of chemiluminescence intensity;
The chemiluminescence signal of the sample that Fig. 5 provides for comparative example 1 of the present invention;
The polyacrylamide gel electrophoresis detected result that the methylase that Fig. 6 provides for comparative example 2 of the present invention and enzyme are tested conscientiously;
The amplified reaction real-time fluorescence detected result of the sample that Fig. 7 provides for comparative example 2 of the present invention;
The agarose gel electrophoresis result of the amplified production of the sample that Fig. 8 provides for comparative example 2 of the present invention;
The chemiluminescence signal of the sample that Fig. 9 provides for comparative example 2 of the present invention;
Figure 10 carries out experimental result as inhibitor for the 5 FU 5 fluorouracil that comparative example 3 of the present invention provides.
Embodiment
Method used in following embodiment is ordinary method if no special instructions, concrete steps can be referring to: < < Molecular Cloning:A Laboratory Manual > > (Sambrook, J., Russell, David W., Molecular Cloning:A Laboratory Manual, 3
rdedition, 2001, NY, Cold Spring Harbor).The primer and DNA sequence dna are synthetic by the raw work in Shanghai.
Embodiment 1
The 5 ' distolateral chain (stem-1) of hair fastener probe and the structural representation of the complementary formation double-stranded 1 of the 3 ' distolateral chain (stem-2) that Fig. 1 provides for the embodiment of the present invention, this hair fastener probe comprises two strands 1 and ring.Wherein, the enzyme that described double-stranded DNA 1 has the recognition site of methylase and relies on methylated restriction endonuclease is cut sequence, and wherein, the recognition site of described methylase and the terminal bases of ring distance are 2～8bp;
In conjunction with Fig. 1, take Dam methylase as example, the present embodiment provides a kind of methylase detection probes based on chemiluminescence reaction, comprises the steps:
(1) external synthetic hair fastener probe, nucleotide sequence (5 ' end is to 3 ') is as shown in SEQ ID NO:12;
(2) according to primers-1 of hair fastener probe and primer-2, as long as primer-1 comprise nicking enzyme restriction enzyme site, with the site of hair fastener probe complementation, the sequence of primer-2 is the sequence of primer-1 liang end complementation, and the nucleotide sequence of described primer-1 and primer-2 (5 ' end is to 3 ') is respectively as shown in SEQ ID NO:13, SEQ ID NO:11;
Particularly, the nucleotide sequence of described hair fastener probe, primer-1 and primer-2 is as shown in table 1 below:
The nucleotide sequence of table 1. hair fastener probe, primer-1 and primer-2
In hair fastener probe and primer-1 as shown in table 1, use runic and the underscore of hair fastener probe Dam methylase recognition site indicate, and italic represents the ring region sequence of hair fastener probe; The sequence of the restriction enzyme site of the nicking restriction endonuclease in primer-1 indicates with underscore, the sequence of Segment A is (with the sequence of DNA enzyme sequence complementation, this DNA enzyme sequence is as shown in SEQ ID NO:1, the sequence of this Segment A is as shown in SEQ ID NO:6) by italic, represent, sequence 5 ' the end of Segment A has the complementary sequence with the restriction enzyme site of nicking restriction endonuclease, with underscore, indicates; In primer-2, underscore is partly and 5 ends (as shown in the runic in 5 ends of the primer-1) complementary sequence of primer-1 that the part that there is no underscore is 3 ends (as shown in the runic in 3 ends of the primer-1) complementary sequence with primer-1; Under this optimum condition, the sequence of primer-2 is consistent with the italic Sequence in hair fastener probe.
(3) anneal of synthetic rear linear hair fastener probe: by probe annealing buffer dilution for synthetic hair fastener probe, hatch 3～5 minutes for 95 ℃, then be cooled to the nucleotide single-chain that room temperature makes described hair fastener probe and be folded to form described hairpin structure, be i.e. structure as shown in Figure 1.
(4) preparation of ring property probe:
Linear primer-1 and primer-2 are provided, wherein, the two ends of primer-2 respectively with a linear primer-1 two terminal bases complementary pairing;
Configuration ligation system is 20 microlitres: the primed DNA that contains every liter of 1 micromole, 1 every liter of micromole's linear ring DNA probe, 1 * T4 ligase enzyme damping fluid (6.6 every liter of mmole magnesium chlorides, 10 every liter of mmole dithiothreitol (DTT), the Triphosaden of 0.1 every liter of mmole, the triisopropyl second sulphonyl hydrochloric acid of 66 every liter of mmole);
In 95 degree heating, within 5 minutes, make two kinds of primer-1 and primer-2 sex change, then slow cooling to 37 degree; In mixture, add 16 degree reaction overnight after the T4 ligase enzyme of 50Ge unit; After ligation, the reaction product of 10 microlitres is joined to the excision enzyme mixture (PH7.9 of 10 microlitres, magnesium chloride, every liter of glycine-potassium hydroxide of 67 mmole, 10Ge unit's exon Ⅰ, 20Ge unit's excision enzyme III that the dithiothreitol (DTT) that comprises every liter of 1 mmole, 6.7 mmole are every liter) in carry out digestion reaction, after mixing, 37 degree reaction is 2 hours, then 95 degree reactions make excision enzyme inactivation for 10 minutes; Obtain rolling the ring probe of ring reaction.
The Dam methylase of take provides a kind of methylase detection method schema based on DNA peroxidase as example, as shown in Figure 2.As shown in Figure 2, this detection method roughly can be divided into three steps, the first step is the endonuclease digestion reaction that methylates and methylate responsive: the sequence GATC on hair fastener probe stem structure can be identified specifically by methyltransgerase Dam, and adds a methyl in double-stranded A base; Methylated hairpin structure can be identified and cut off by restriction endonuclease Dpn I, has produced a little hairpin structure and double-stranded DNA, because the annealing temperature of this little hairpin structure and double-stranded DNA is too low, causes it to be just transformed at normal temperatures the DNA of strand.Second step is rolling circle amplification reaction and nicking enzyme endonuclease reaction: the single stranded DNA that little hairpin structure is transformed into and the pairing of ring-shaped probe DNA base complementrity, the mixture of archaeal dna polymerase and tetra-kinds of deoxyribonucleotides of dNTPs() under effect, the circular DNA of take extends as amplification template, and extended fragment and circular DNA form duplex structure; The nicking enzyme recognition site (this nicking enzyme is only identified duplex structure) of the duplex structure of nicking enzyme Nb.Bsm I identification subsequently, and in this site, new synthetic chain is carried out to nicking, this has just produced new primer; This primer can with other circular DNA combination, under archaeal dna polymerase effect, again extend, and sequence after again extending can be by nicking enzyme Nb.BsmI nicking, then by archaeal dna polymerase, extended again, this extension repeatedly and nicking circulation have formed the rolling circle amplification reaction of continuous generation primer, it is converted into index amplification by linear amplification, and amplification produces short oligonucleotide fragment exponentially to be increased, and in this fragment, a part of DNA sequence dna has the activity (DNA enzyme) of enzyme.The 3rd step is chemiluminescence reaction detection signal: under alkaline condition, described DNA endonuclease capable is combined with hemin and is formed the G-tetramer, this tetramer can catalysis luminol,3-aminophthalic acid cyclic hydrazide and the redox reaction of hydrogen peroxide, produce chemiluminescent signal, thereby realized the High Sensitive Analysis of methylase.
In conjunction with Fig. 2, the present embodiment provides a kind of methylase detection kit based on DNA peroxidase and the detection method of using this test kit, comprises the steps:
(1) sample preparation
Provide Dam methylase as testing sample;
(2) the endonuclease digestion reaction that methylates and methylate responsive
Methylation reaction:
The methylation reaction system of preparing 50 microlitres: 2 every liter of micromole's hair fastener probe, 1 * methylase reaction buffer (triisopropyl second sulphonyl hydrochloric acid of 0.05 mole every liter, pH7.5, the sodium chloride of 0.01 mole every liter, the ethylenediamine tetraacetic acid (EDTA) of 0.01 mole every liter, the 2 mercapto ethanol of 5 every liter of mmole), the dam methyltransgerase of every liter of S-adenosylmethionine of 160 micromole (SAM), appropriate concentration
By the methylation reaction system of described 50 microlitres after 37 degree are hatched 2 hours again 65 degree reactions within 10 minutes, make enzyme deactivation;
The endonuclease digestion reaction that methylates responsive:
The endonuclease reaction system of preparing 150 microlitres: 1 * NEB damping fluid (50 mmole Potassium ethanoates, the triisopropyl second sulphonyl acetic acid of 20 mmoles, 10 mmole magnesium acetates, the dithiothreitol (DTT) of 1 mmole, PH7.9), the restriction endonuclease Dpn I of the 10 every microlitres of unit,
The enzyme that reaction product all after methylation reaction is joined to 150 microlitres is cut in mixture and is carried out endonuclease reaction, and 37 degree are hatched one and a half hours, and then 80 degree reactions make enzyme deactivation for 20 minutes.
(3) constantly produce the rolling circle amplification reaction of primer
Get product 1 microlitre after endonuclease reaction, join in the mixture of 19 microlitres, the mixture of tetra-kinds of deoxyribonucleotides of dNTPs(that magnesium sulfate, 400 micromole that Repone K, 6 mmole that ammonium sulfate, 10 mmole that the ring-shaped probe that the mixture of described 19 microlitres contains every liter of 30 nmole, every liter of triisopropyl second sulphonyl hydrochloric acid of 20 mmole (PH8.8), 10 mmole are every liter are every liter are every liter are every liter), 0.1% Triton X-100, the archaeal dna polymerase of 0.16 unit, 3 the nicking enzyme Nb.Bsm of unit I, 60 degree are hatched 90 minutes.
(4) chemiluminescence reaction detection signal
Prepare the reagent of following concentration: the hemin solution (use dmso solution) that the luminol solution of 25 every liter of mmole (using the dissolution of sodium hydroxide of 0.1 mole every liter), 25 micromole are every liter, is distributed into aliquot and is stored in-20 degree refrigerators; Hydroxyethyl piperazine second thiosulfonic acid (HEPES) solution of 40 every liter of mmole, PH9.0.
The amplified production of 15 microlitres is joined to the hemin, the deionized water of 15 microlitres of every liter of luminol,3-aminophthalic acid cyclic hydrazide, 75 nmole that 105 microlitres contain every liter of 0.5 mmole, in the mixture of 75 microlitre 2 * HEPES damping fluids (HEPES of 40 every liter of mmole, 600 mmole sodium-chlor, PH8.0), incubated at room half an hour.Mixture is put into GloMax96 microplate photometer and detect chemiluminescent signal, use the program of automatic sample to add hydrogen peroxide, the timed interval is set to 1.5 seconds.
The present embodiment provides a kind of methylase detection method based on DNA peroxidase, and the method, by preparation standard curve, can directly draw the concentration of methylase, comprises the steps:
By methylase be configured to concentration known solution (methylase concentration is respectively 0.025,0.05,0.1,0.5,1,2,2.5,25,50,73,120,120,200,400 every milliliter of unit), the methylase detection kit based on DNA peroxidase that employing the present embodiment 2 provides and the detection method of using this test kit detect the chemiluminescence signal of each concentration methylase solution, as shown in Figure 3, and preparation standard curve, as shown in Figure 4.Fig. 3 has shown the variation relation (error line represents the standard deviation of 3 experiments) of different concns methylase and chemiluminescence intensity, and concentration interval is every milliliter of 0.025 Zhi0.5 unit.Fig. 4 adopts the logarithmic value of chemiluminescence intensity as ordinate zou, the logarithmic value of methylase concentration is X-coordinate matched curve (error line represents the standard deviation of 3 experiments), present good linear relationship, its linear equation is Ic=147614.4+34572.3log
10c(relation conefficient is 0.997), through calculating, the detectability of this technical scheme can reach 1.29 * 10
-4every milliliter of individual unit.The sensitivity that methylase detection probes based on chemiluminescence reaction provided by the invention and detection method are described is very high.
According to gained linear equation Ic=147614.4+34572.3log
10c(relation conefficient is 0.997), by the chemiluminescence intensity substitution equation of embodiment 3 gained methylase sample to be measured, directly draw the concentration (every milliliter of unit) of methylase to be measured.
Comparative example 1
In order to absolutely prove beneficial effect of the present invention, the invention provides the comparative example 1 of embodiment 2, the Dam methyltransgerase being about in embodiment 2 is changed to CpG methyltransgerase (M.SssI), other steps are constant, in addition, this comparative example also provides blank, and this blank is compared with embodiment 2, lack Dam methyltransgerase, other steps are constant; Detected result as shown in Figure 5.As seen from Figure 5, when processing hairpin structure, CpG methyltransgerase only has very weak signal, and very approaching with blank.This is because Dam methyltransgerase is identified the GATC sequence in double chain DNA sequence, and can be to the VITAMIN B4 residue (N in the sequence of left side
6) modification that methylates, and M.SssICpG methyltransgerase identify sequence 5 in double-stranded dinucleotides ' ... C G...3 ', and by all cytosine(Cyt) residue (C
5) methylate, therefore, after cytosine(Cyt) on hair fastener probe neck structure in this comparative example is methylated, can not be identified by restriction endonuclease dpn I, therefore do not have signal primer to produce, even under the existence of polysaccharase and nicking restriction endonuclease, amplified reaction also there will not be, do not produce DNA enzyme fragment, therefore do not have chemiluminescence signal to produce.
This comparative example illustrates that methylase detection probes and the detection method based on chemiluminescence reaction provided by the invention can distinguish Dam methyltransgerase and CpG methyltransgerase significantly, and specificity is very good.
Comparative example 2
In order to further illustrate beneficial effect of the present invention, the invention provides the comparative example 2 of embodiment 2, comprise control group 1～3, compare with embodiment 2, the difference of control group 1～2 is as following table 2, other steps identical with step 1～2 of embodiment 2 (wherein, control group 3 is the positive control of control group 1～2, in the same manner as in Example 2):
Table 2 control group 1～3 is compared with arranging of embodiment 2
| ? | Control group 1 | |
|
|
| Dam methylase | + | - | + | + |
| DpnI restriction endonuclease | - | + | + | + |
This control group 1～3, for methylating of the embodiment of the present invention 2 verified conscientiously with enzyme, is cut product result by enzyme and is carried out native polyacrylamide gel electrophoresis analysis.Fig. 6 is the polyacrylamide gel electrophoresis detected result that methylase and enzyme are tested conscientiously, and in table 2 and Fig. 6, "-" represents in this experimental group reaction system that, without this material, "+" represents to have added this material in this experimental group reaction system.In Fig. 6, swimming lane 1 is for only adding methylase, and swimming lane 2 is for only having added Dpn I restriction endonuclease, and swimming lane 3 is for adding methylase and Dpn I restriction endonuclease, and m road is the reference of marker(molecular mass); As shown in Figure 6, only adding methyltransgerase (swimming lane 1) and only add Dpn I restriction endonuclease (swimming lane 2), is still a band, and has occurred a new band after adding two kinds of enzymes (swimming lane 3) reaction.
The present invention has also carried out real-time fluorescence detection to amplified reaction, is divided into and adds nicking restriction endonuclease and do not add two kinds of situations of nicking restriction endonuclease (as described in control group 4～7) when amplified reaction, and result as shown in Figure 7.Wherein, compare with embodiment 2, the difference of control group 1～2 also comprises each control group corresponding curve in Fig. 7 as following table 3(table 3), other steps are identical (wherein with the step of embodiment 2, control group 3 is the positive control of control group 1～2, in the same manner as in Example 2):
Table 3 control group 4～7 comparison is set
In table 3, "-" represents in this experimental group reaction system that, without this material, "+" represents to have added this material in this experimental group reaction system.
As seen from Figure 7, control group 7 adds the fluorescent signal of Vent (exo-) polysaccharase and nicking restriction endonuclease Nb.Bsm I (curve 1) to rise rapidly simultaneously, reaches very soon plateau, shows that the efficiency of cyclic amplification is very high; And 6 of control groups while adding polysaccharase the fluorescent signal of (curve 2) very slow what increase, even to plateau, the intensity of fluorescent signal is also the former 1/7th, and lack during in reaction any when Dam methyltransgerase and restriction endonuclease Dpn I (curve 3 or 4), all do not have fluorescent signal to produce, this is because hairpin structure is not cut off, and therefore can not produce signal primer, thereby can not cause amplified reaction, just can't detect fluorescent signal.
Amplified production is carried out to agarose gel electrophoresis analysis, result as shown in Figure 8, a, b, c and d represent respectively the detected result of control group 4,5,7 and 6, m road is the reference of marker(molecular mass), swimming lane a is for adding dam methyltransgerase and nicking restriction endonuclease Nb.bsm I, swimming lane b is for adding restriction endonuclease Dpn I and Nb.bsm I nicking restriction endonuclease, swimming lane c is for adding dam methyltransgerase, restriction endonuclease Dpn I and Nb.bsm I nicking restriction endonuclease, and swimming lane d is for adding restriction endonuclease Dpn I and dam methyltransgerase.Only can see and add Dam methyltransgerase, restriction endonuclease Dpn I, Vent(exo-) polysaccharase and nicking restriction endonuclease Nb.Bsm I in the situation that, just there is nucleotide fragments to occur, and in other situations, all do not occur nucleotide fragments; Then detect chemiluminescence reaction signal, result is as Fig. 9, and ordinate zou is chemiluminescence intensity, and X-coordinate a, b, c and d represent respectively the detected result of control group 4,5,7 and 6, result only shows that, in the situation that four kinds of enzymes all add, chemiluminescent intensity obviously strengthens.
Comparative example 3
In order to further illustrate beneficial effect of the present invention, the invention provides the comparative example 3 of embodiment 2, this embodiment adopts 5 FU 5 fluorouracil to test as the inhibitor of Dam methylase, and result is as shown in figure 10.Can see, when inhibitor concentration improves, the relative reactivity of Dam methylase reduces.
The foregoing is only preferred embodiment of the present invention, not in order to limit the present invention, all any modifications of doing within the spirit and principles in the present invention, be equal to and replace and improvement etc., within all should being included in protection scope of the present invention.
Claims (11)
1. the methylase detection probes based on chemiluminescence reaction, it is characterized in that, described detection probes comprises hair fastener probe, primer-1 and primer-2, described hair fastener probe comprises stem-1, ring and stem-2 successively, described stem-1, ring and stem-2 are single chain deoxynucleotide, described stem-1 and the complementary double-stranded DNA (1) that forms in stem-2, the enzyme that described double-stranded DNA (1) has the recognition site of methylase and relies on methylated restriction endonuclease is cut sequence, wherein, the recognition site of described methylase and the terminal bases of ring distance are 2～8bp;
Described primer-1 is single chain deoxynucleotide, described primer-1 has at least one Segment A, 5 ' end of described Segment A or 3 ' end have the complementary sequence in nicking endonuclease digestion site, the nucleotide sequence of described Segment A and DNA enzyme sequence are complementary, wherein, described DNA enzyme sequence is many G nucleotide sequence with teichmann's crystals binding site; Described primer-1 also has the sequence with the partial nucleotide sequence complementation of described hair fastener probe, and described primer-2 are single chain deoxynucleotide, and described primer-2 are complementary with the nucleotide sequence at two ends, described primer-1.
2. the methylase detection probes based on chemiluminescence reaction as claimed in claim 1, it is characterized in that, the enzyme that the double-stranded DNA of described hair fastener probe (1) has the recognition site of methylase and relies on methylated restriction endonuclease is cut in sequence, described methylase is Dam methylase or M.Sss I methylase, and the methylated restriction endonuclease of described dependence is Dpn I restriction endonuclease.
3. the methylase detection probes based on chemiluminescence reaction as claimed in claim 1, is characterized in that, in described primer-1, described DNA enzyme sequence is the nucleotide sequence as shown in SEQ ID NO:1～5; 5 ' end of described DNA enzyme sequence or the nicking restriction endonuclease of 3 ' end are Nb.Bsm I nicking restriction endonuclease, Nt.BspQI nicking restriction endonuclease, Nt.AlwI nicking restriction endonuclease or Nt.BstNBI nicking restriction endonuclease.
4. the methylase detection probes based on chemiluminescence reaction as claimed in claim 1, is characterized in that, the nucleotide sequence of described primer-2 is as shown in SEQ ID NO:6.
5. the methylase detection kit based on chemiluminescence reaction, is characterized in that, comprising:
Hair fastener probe, primer-1, primer-2, hair fastener probe methylating reagent, rely on methylated endonuclease digestion reagent, ring-shaped probe and connect reagent, roll and change amplification and nicking endonuclease digestion reagent, DNA enzyme detection reagent,
Wherein, the methylated endonuclease digestion reagent of described dependence comprises the methylated restriction endonuclease of dependence, described ring-shaped probe connects reagent and comprises DNA ligase and DNA excision enzyme, described roll change amplification and nicking endonuclease digestion reagent comprise archaeal dna polymerase and nicking restriction endonuclease, described DNA enzyme detection reagent comprises teichmann's crystals and DNA peroxidase detection reagent;
Described hair fastener probe comprises stem-1, ring and stem-2 successively, described stem-1, ring and stem-2 are single chain deoxynucleotide, described stem-1 and the complementary double-stranded DNA (1) that forms in stem-2, the enzyme that described double-stranded DNA (1) has the recognition site of methylase and relies on methylated restriction endonuclease is cut sequence, wherein, the recognition site of described methylase and the terminal bases of ring distance are 2～8bp;
Described primer-1 is single chain deoxynucleotide, described primer-1 has at least one Segment A, 5 ' end of described Segment A or 3 ' end have the complementary sequence in nicking endonuclease digestion site, the nucleotide sequence of described Segment A and DNA enzyme sequence are complementary, wherein, described DNA enzyme sequence is many G nucleotide sequence with teichmann's crystals binding site; Described primer-1 also has the sequence with the partial nucleotide sequence complementation of described hair fastener probe, and described primer-2 are single chain deoxynucleotide, and described primer-2 are complementary with the nucleotide sequence at two ends, described primer-1.
6. the methylase detection kit based on chemiluminescence reaction as claimed in claim 5, it is characterized in that, the enzyme that the double-stranded DNA of described hair fastener probe (1) has the recognition site of methylase and relies on methylated restriction endonuclease is cut in sequence, described methylase is Dam methylase or M.Sss I methylase, and the methylated restriction endonuclease of described dependence is Dpn I restriction endonuclease.
7. the methylase detection kit based on chemiluminescence reaction as claimed in claim 5, is characterized in that, in described primer-1, described DNA enzyme sequence is the nucleotide sequence as shown in SEQ ID NO:1～5; 5 ' end of described DNA enzyme sequence or the nicking restriction endonuclease of 3 ' end are Nt.BspQI nicking restriction endonuclease, Nt.AlwI nicking restriction endonuclease, Nb.Bsm I nicking restriction endonuclease or Nt.BstNBI nicking restriction endonuclease.
8. the methylase detection kit based on chemiluminescence reaction as claimed in claim 5, is characterized in that, the nucleotide sequence of described primer-2 is as shown in SEQ ID NO:6.
9. the methylase detection kit based on chemiluminescence reaction as claimed in claim 5, it is characterized in that, described DNA peroxidase detection reagent comprise luminol, nitric acid two-N-methylacridine father-in-law, 2,4,5-triphenyl imidazoles, 3,4,5-trihydroxybenzoic acid, two (2,4,6-trichlorophenyl) oxalate or 2,2 '-amino-bis-(3-ethyl-benzothiazoline-6-sulfonic acid).
10. the methylase detection method based on chemiluminescence reaction, is characterized in that, comprises the steps:
1) provide hair fastener probe, primer-1, primer-2, hair fastener probe, primer-1, primer-2, hair fastener probe methylating reagent, rely on methylated endonuclease digestion reagent, ring-shaped probe connects reagent, roll and change amplification and nicking endonuclease digestion reagent, DNA enzyme detection reagent
Wherein, the methylated endonuclease digestion reagent of described dependence comprises the methylated restriction endonuclease of dependence, described ring-shaped probe connects reagent and comprises DNA ligase and DNA excision enzyme, described roll change amplification and nicking endonuclease digestion reagent comprise archaeal dna polymerase and nicking restriction endonuclease, described DNA enzyme detection reagent comprises teichmann's crystals and DNA peroxidase detection reagent;
Described hair fastener probe comprises stem-1, ring and stem-2 successively, described stem-1, ring and stem-2 are single chain deoxynucleotide, described stem-1 and the complementary double-stranded DNA (1) that forms in stem-2, described double-stranded DNA (1) has the recognition site of Dam methylase and the restriction enzyme site of described Dpn I restriction endonuclease, wherein, the recognition site of described methylase and the terminal bases of ring distance are 2～8bp;
Described primer-1 is single chain deoxynucleotide, described primer-1 has at least one Segment A, 5 ' end of described Segment A or 3 ' end have the complementary sequence in nicking endonuclease digestion site, the nucleotide sequence of described Segment A and DNA enzyme sequence are complementary, wherein, described DNA enzyme sequence is many G nucleotide sequence with teichmann's crystals binding site; Described primer-1 also has the sequence with the partial nucleotide sequence complementation of described hair fastener probe, and described primer-2 are single chain deoxynucleotide, and described primer-2 are complementary with the nucleotide sequence at two ends, described primer-1; And
2) get methylase sample to be measured, add described hair fastener probe and hair fastener probe methylating reagent to carry out methylation reaction, obtain containing methylated hair fastener probe product; And
3) containing methylated hair fastener probe product, add the methylated endonuclease digestion reagent of dependence to carry out endonuclease reaction gained, obtain single stranded DNA, the partial sequence of described single stranded DNA and primer-1 is complementary; And
4) primer-1 and primer-2 are mixed, with ring-shaped probe connect that reagent is annealed, connection, enzyme cut processing, obtains ring-shaped probe; And
5) get the single stranded DNA of step 3) gained and the ring-shaped probe of step 4) gained and mix, add to roll and change amplification and nicking endonuclease digestion reagent, carry out rolling circle amplification and endonuclease reaction, the enzyme that obtains nicking restriction endonuclease is cut product; And
6) enzyme of getting gained nicking restriction endonuclease is cut product and is added DNA enzyme detection reagent, and detects chemiluminescence signal.
11. 1 kinds of methylase detection methods based on chemiluminescence reaction, the concentration C for detection of base enzyme in testing sample, is characterized in that, comprises the steps:
By the chemiluminescence signal substitution following formula of the methylase detection method gained based on DNA peroxidase as claimed in claim 10
Ic=147614.4+34572.3log
10C
In formula, the luminous intensity that Ic is described chemiluminescence signal, described concentration C is in every milliliter of testing sample, to contain the units of methylase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310746076.4A CN103710453A (en) | 2013-12-30 | 2013-12-30 | Chemiluminescence reaction-based methylase detection probe, detection kit and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310746076.4A CN103710453A (en) | 2013-12-30 | 2013-12-30 | Chemiluminescence reaction-based methylase detection probe, detection kit and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103710453A true CN103710453A (en) | 2014-04-09 |
Family
ID=50403804
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310746076.4A Pending CN103710453A (en) | 2013-12-30 | 2013-12-30 | Chemiluminescence reaction-based methylase detection probe, detection kit and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103710453A (en) |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104212792A (en) * | 2014-04-22 | 2014-12-17 | 上海大学 | Nicking endonuclease-based netted rolling cycle amplification system and use thereof |
| CN106367497A (en) * | 2016-08-30 | 2017-02-01 | 湖南工程学院 | Series G-quadruplex-heme DNA enzyme label-free signal amplification method based on rolling-circle amplification |
| CN106884047A (en) * | 2017-02-15 | 2017-06-23 | 济南大学 | The method that miRNA 155 is detected based on aptamer |
| CN107151694A (en) * | 2016-09-30 | 2017-09-12 | 山东大学 | The Cascaded amplification strategy of ring mediation is used for highly sensitive detection dnmt rna activity |
| CN107217100A (en) * | 2017-06-29 | 2017-09-29 | 中国农业大学 | Nucleic acid screening biology sensor based on DNA enzymatic chimeric primers |
| CN107760762A (en) * | 2017-09-30 | 2018-03-06 | 山东师范大学 | A kind of fluorescence chemical sensor and its detection method of detection DNA adenine methyltransferases |
| CN109142332A (en) * | 2018-08-12 | 2019-01-04 | 河北英茂生物科技有限公司 | A kind of β2Broadspectrum specificity molecularly imprinted polymer, chemical luminescence reagent kit and the detection method of receptor agonist and application |
| CN109182465A (en) * | 2018-08-03 | 2019-01-11 | 中山大学 | A kind of high-throughput nucleic acid epigenetic modification quantitative analysis method |
| CN109406477A (en) * | 2018-12-29 | 2019-03-01 | 济南大学 | Active biological sensor of a kind of detection dnmt rna and preparation method thereof |
| CN109750088A (en) * | 2019-03-22 | 2019-05-14 | 重庆医科大学 | Sensor based on TdT-RCA and its application in dnmt rna detection |
| CN109868304A (en) * | 2017-12-04 | 2019-06-11 | 沈阳药科大学 | Glucose oxidase-DNAzyme composite hydrogel and its application in glucose detection |
| CN110646487A (en) * | 2019-10-14 | 2020-01-03 | 宁波大学 | Electrochemical method based on G4 stacked self-assembly and application of electrochemical method in hydrogen peroxide and terminal transferase detection |
| CN112094889A (en) * | 2020-08-31 | 2020-12-18 | 山东师范大学 | Chemiluminescence sensor and application in detection of bacterial or human methyltransferase |
-
2013
- 2013-12-30 CN CN201310746076.4A patent/CN103710453A/en active Pending
Non-Patent Citations (2)
| Title |
|---|
| YA-PING ZENG,ET AL: "Sensitive Detection of DNA Methyltransferase Using Hairpin Probe-Based Primer Generation Rolling Circle Amplification-Induced Chemiluminescence", 《ANALYTICAL CHEMISTRY》 * |
| 周兴旺等: "发夹型荧光分子探针用于DNA 甲基化酶的活性分析及其在药物筛选中的应用", 《化学学报》 * |
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104212792A (en) * | 2014-04-22 | 2014-12-17 | 上海大学 | Nicking endonuclease-based netted rolling cycle amplification system and use thereof |
| CN106367497B (en) * | 2016-08-30 | 2020-02-04 | 湖南工程学院 | Tandem G-quadruplex-heme DNA enzyme label-free signal amplification method based on rolling circle amplification |
| CN106367497A (en) * | 2016-08-30 | 2017-02-01 | 湖南工程学院 | Series G-quadruplex-heme DNA enzyme label-free signal amplification method based on rolling-circle amplification |
| CN107151694A (en) * | 2016-09-30 | 2017-09-12 | 山东大学 | The Cascaded amplification strategy of ring mediation is used for highly sensitive detection dnmt rna activity |
| CN106884047A (en) * | 2017-02-15 | 2017-06-23 | 济南大学 | The method that miRNA 155 is detected based on aptamer |
| CN106884047B (en) * | 2017-02-15 | 2021-03-23 | 济南大学 | Method for detecting miRNA-155 based on aptamer |
| CN107217100A (en) * | 2017-06-29 | 2017-09-29 | 中国农业大学 | Nucleic acid screening biology sensor based on DNA enzymatic chimeric primers |
| CN107760762A (en) * | 2017-09-30 | 2018-03-06 | 山东师范大学 | A kind of fluorescence chemical sensor and its detection method of detection DNA adenine methyltransferases |
| CN109868304A (en) * | 2017-12-04 | 2019-06-11 | 沈阳药科大学 | Glucose oxidase-DNAzyme composite hydrogel and its application in glucose detection |
| CN109182465A (en) * | 2018-08-03 | 2019-01-11 | 中山大学 | A kind of high-throughput nucleic acid epigenetic modification quantitative analysis method |
| CN109142332A (en) * | 2018-08-12 | 2019-01-04 | 河北英茂生物科技有限公司 | A kind of β2Broadspectrum specificity molecularly imprinted polymer, chemical luminescence reagent kit and the detection method of receptor agonist and application |
| CN109142332B (en) * | 2018-08-12 | 2021-07-20 | 河北英茂生物科技有限公司 | Beta is2Broad-spectrum specific molecularly imprinted polymer of receptor stimulant, chemiluminescence kit, detection method and application |
| CN109406477A (en) * | 2018-12-29 | 2019-03-01 | 济南大学 | Active biological sensor of a kind of detection dnmt rna and preparation method thereof |
| CN109750088A (en) * | 2019-03-22 | 2019-05-14 | 重庆医科大学 | Sensor based on TdT-RCA and its application in dnmt rna detection |
| CN110646487A (en) * | 2019-10-14 | 2020-01-03 | 宁波大学 | Electrochemical method based on G4 stacked self-assembly and application of electrochemical method in hydrogen peroxide and terminal transferase detection |
| CN110646487B (en) * | 2019-10-14 | 2022-06-14 | 宁波大学 | Electrochemical sensor for detecting hydrogen peroxide and terminal transferase and application |
| CN112094889A (en) * | 2020-08-31 | 2020-12-18 | 山东师范大学 | Chemiluminescence sensor and application in detection of bacterial or human methyltransferase |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103710453A (en) | Chemiluminescence reaction-based methylase detection probe, detection kit and detection method | |
| Vaisvila et al. | Enzymatic methyl sequencing detects DNA methylation at single-base resolution from picograms of DNA | |
| Lucia et al. | An ultrasensitive, rapid, and portable coronavirus SARS-CoV-2 sequence detection method based on CRISPR-Cas12 | |
| Dedeurwaerder et al. | Evaluation of the Infinium Methylation 450K technology | |
| Vaisvila et al. | EM-seq: detection of DNA methylation at single base resolution from picograms of DNA | |
| López-Valls et al. | CASCADE: Naked eye-detection of SARS-CoV-2 using Cas13a and gold nanoparticles | |
| AU2017339984B2 (en) | Method for multiplex detection of methylated DNA | |
| Aberg et al. | A MBD-seq protocol for large-scale methylome-wide studies with (very) low amounts of DNA | |
| CN109161579B (en) | Ligase-based isothermal amplification method and application thereof in polynucleotide kinase detection | |
| CN103667513A (en) | Telomerase activity detecting probe, reagent kit and method | |
| Zhu et al. | Sensitive detection of methylated DNA using the short linear quencher–fluorophore probe and two-stage isothermal amplification assay | |
| Archer et al. | Selective and flexible depletion of problematic sequences from RNA-seq libraries at the cDNA stage | |
| Jiang et al. | Coupling hybridization chain reaction with DNAzyme recycling for enzyme-free and dual amplified sensitive fluorescent detection of methyltransferase activity | |
| Yoon et al. | Highly sensitive multiplex detection of microRNA using light-up RNA aptamers | |
| Heiss et al. | Detection of nucleic acid modifications by chemical reagents | |
| Balamurugan et al. | Identification of spermatozoa by tissue‐specific differential DNA methylation using bisulfite modification and pyrosequencing | |
| CN107151694A (en) | The Cascaded amplification strategy of ring mediation is used for highly sensitive detection dnmt rna activity | |
| Liu et al. | Label-free and ultrasensitive detection of polynucleotide kinase activity at the single-cell level | |
| Wu et al. | A label-free colorimetric isothermal cascade amplification for the detection of disease-related nucleic acids based on double-hairpin molecular beacon | |
| AU2022301095A1 (en) | Method for isothermal amplification of nucleic acid target sequences | |
| Xu et al. | Label-free fluorescence strategy for sensitive detection of exonuclease activity using SYBR Green I as probe | |
| CN104278090A (en) | Method for determining activity of DNA ligase | |
| Chen et al. | Intracellular self-enhanced rolling circle amplification to image specific miRNAs within tumor cells | |
| Wang et al. | Direct enzymatic sequencing of 5-methylcytosine at single-base resolution | |
| Han et al. | Methylation-sensitive transcription-enhanced single-molecule biosensing of DNA methylation in cancer cells and tissues |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent of invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhang Chunyang Inventor after: Long Die Inventor after: Zeng Yaping Inventor after: Hu Juan Inventor before: Zeng Yaping Inventor before: Zhang Chunyang |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: CENG YAPING ZHANG CHUNYANG TO: ZHANG CHUNYANG LONG YI CENG YAPING HU JUAN |
|
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140409 |