CN106318973B - A kind of gene regulation device and gene regulation method based on CRISPR-Cas9 - Google Patents
A kind of gene regulation device and gene regulation method based on CRISPR-Cas9 Download PDFInfo
- Publication number
- CN106318973B CN106318973B CN201610741981.4A CN201610741981A CN106318973B CN 106318973 B CN106318973 B CN 106318973B CN 201610741981 A CN201610741981 A CN 201610741981A CN 106318973 B CN106318973 B CN 106318973B
- Authority
- CN
- China
- Prior art keywords
- gene regulation
- ligand
- regulation device
- cas9
- sgrna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/10—Vectors comprising a non-peptidic targeting moiety
Abstract
The invention discloses a kind of gene regulation device and gene regulation method based on CRISPR-Cas9, the gene regulation device includes a nucleotide sequence, itself it is a sgRNA or becomes a sgRNA through transcription, the sgRNA includes two parts in structure: the second part with the protein bound first part of inactivation Cas9 and the 3 ' ends for being connected to first part, wherein there is one section of antisense sequences at 5 ' ends of first part, second part is aptamer Sequence comprising ligand binding moiety and aptamer stem；When ligand is not present, antisense sequences are combined with the pairing of aptamer stem；When there are ligand, antisense sequences are dissociated with aptamer stem to be combined with target dna pairing.By the way that the RNA riboswitch of specific biological signal will be combined to be integrated into sgRNA, establish the bridge of cell signal intensity and Gene expression intensities, it can be on the basis of identifying bio signal, any one of activation or silencing target gene establish manual contact between signal ligand and cytogene.
Description
Technical field
The present invention relates to gene technology field more particularly to a kind of gene regulation devices and base based on CRISPR-Cas9
Because regulating and controlling method.
Background technique
Eukaryocyte has complicated biological behaviour, and such as proliferation, apoptosis, migration and differentiation, these are by cell signal
Access and genetic neural network regulate and control closely.And the key node of cell-signaling pathways transformation be to establish specific input signal with
The close ties of output signal.Unlike signal access realizes complex biological reaction to synthesising biological scholar in order to better understand
Mechanism has started to design the various engineering cells with novel signal access.Existing correlative study is novel to constructing in the recent period
Sensor and signal processing system be made that and illustrate and probe into well, but this kind of signal processing system can not ideally will be special
The detection of specific signal and the expression foundation of endogenous gene contact.Therefore, pass through the original net of current technology means engineered cells
The topological structure of network is still a significant challenge.
CRISPR-Cas system repeats short palindromic sequence cluster (clusteredregularly interspaced by regularity
Short palindromic repeats, CRISPR) and CRISPR GAP-associated protein GAP (CRISPR-associated protein,
Cas it) forms, and CRISPR-Cas9 technology is derived from II type CRISPR system of bacterium.The CRISPR-Cas9 to attract attention is one
The emerging genome editor mediated with RNA of kind and modification technique, are led by guide RNA (single guide RNA, sgRNA)
To DNA identification, editor and modification.Recently, correlative study confirmation recombinates in escherichia coli Escherichia coli and human cell
CRISPR-Cas9 system can be used as a kind of genome adjusting tool.In those references, by by effector and inactivation nucleic acid
Restriction endonuclease Cas9 (endonuclease-deficient Cas9) fusion reaches genetic transcription and inhibits and activate.Researcher is also
Under conditions of designing under blue light illumination, the photoinduction CRISPR-Cas9 system of activation endogenous gene transcription.Because
The convenience of sgRNA design, CRISPR-Cas9 system must be by sharp extensively in multiple fields such as fundamental biological knowledge, synthetic biologies
With.However, being limited to complicated and diversified biological signals, CRISPR-Cas9 technology fails that endogenous gene net is ideally transformed
Network.
Summary of the invention
The present invention provides a kind of gene regulation device and gene regulation method based on CRISPR-Cas9.
According to the first aspect of the invention, the present invention provides a kind of gene regulation device based on CRISPR-Cas9, the base
Because regulation device includes a nucleotide sequence, the nucleotide sequence itself is a sgRNA or becomes a sgRNA through transcription, should
SgRNA includes two parts in structure: with the protein bound first part of inactivation Cas9 and be connected to above-mentioned first part
The second part at 3 ' ends, wherein there is one section of antisense sequences at 5 ' ends of above-mentioned first part, above-mentioned second part is aptamer sequence portion
Point comprising ligand binding moiety and aptamer stem；When ligand is not present, above-mentioned antisense sequences and above-mentioned aptamer stem are matched
In conjunction with；When there are ligand, above-mentioned antisense sequences are dissociated with above-mentioned aptamer stem to be combined with target dna pairing.
Further, the corresponding DNA sequence dna of above-mentioned sgRNA is as shown in any sequence in NO:17~50 SEQ ID.
Further, above-mentioned ligand is exogenous ligand or endogenic ligand.
Further, above-mentioned exogenous ligand is theophylline or tetracycline, and above-mentioned endogenic ligand is phage capsid protein
MS2。
Further, above-mentioned aptamer is theophylline aptamer, tetracycline aptamer or phage capsid protein MS2 aptamer.
Further, said gene regulation device further includes an albumen, and above-mentioned albumen includes at least inactivation Cas9 albumen portion
Point, optionally include the activating transcription factor merged with above-mentioned Cas9 protein part.
Further, above-mentioned activating transcription factor is VP64 albumen.
Further, above-mentioned albumen is dCas9-VP64 fusion protein and/or dCas9 albumen.
Further, said gene regulation device further includes a ligand, and above-mentioned ligand is in conjunction with above-mentioned ligand binding moiety.
According to the second aspect of the invention, the present invention provides a kind of gene regulation method based on CRISPR-Cas9, the base
Because regulation method uses the gene regulation device of first aspect, the above method includes that said gene regulation device is imported cell
In, and in the presence of inactivating Cas9 albumen and ligand molecular, the expression of goal of regulation and control DNA.
The beneficial effects of the present invention are: creatively by the way that the RNA riboswitch of specific biological signal will be combined --- it is suitable
Body Sequence is integrated into sgRNA, establishes " bridge " of cell signal intensity and Gene expression intensities, above-mentioned recombination
CRISPR-Cas9 system can be on the basis of identifying any bio signal, any one of activation or silencing target gene,
Manual contact is established between signal ligand and cytogene.
Detailed description of the invention
Fig. 1 is the operation principle schematic diagram of a kind of gene expression regulation method of embodiment, including recombination sgRNA silencing
The general introduction of target gene (a) or activation target gene (b), sgRNA include two parts in structure: with inactivation Cas9 albumen
(dCas9) first part (M) that combines and the 3 ' second parts (N) held for being connected to first part (M), wherein first part
(M) there is one section of antisense sequences (M1) at 5 ' ends, and second part (N) is aptamer Sequence comprising ligand binding moiety (N1)
With aptamer stem (N2).In the case where there is no signal A (or B), that is, be not present ligand when, the antisense sequences (M1) of sgRNA with
Aptamer stem (N2) pairing combines, and at this moment sgRNA is in "Off" state；With signal A (or B), that is, exist
When ligand, recombination sgRNA structure changes, state " opening ", at this point, the antisense sequences (M1) of sgRNA and the pairing of its target dna are tied
It closes, is produced by the output of dCas9-VP64 fusion protein or dCas9 protein activation or silencing B (or A) signal.
Fig. 2 is the experimental result picture for showing exogenous ligand modulability transcriptional activation and silencing, and the mRNA of VEGF is with respect to table
It is detected up to level using qRT-PCR method, the measurement of vegf protein level is measured using ELISA method.In HEK293 cell when
The effect of dCas9/dCas9-VP64, the table of VEGF mRNA and albumen water are relied in the presence of tetracycline (a and b)/theophylline (c and d)
It is lowered/increases up to level, the figure is according to independent experiment three times as a result, value is averaged plus-minus standard deviation.
Fig. 3 is the experimental result picture for showing endogenic ligand modulability transcriptional activation and silencing, MALAT1 and UCA1's
MRNA relative expression levels are detected using qRT-PCR method.DCas9/ is relied in the presence of MS2 protein in HEK293 cell
The mRNA relative expression levels of the effect of dCas9-VP64, MALAT1 (a and b) and UCA1 (c and d) are lowered/increase, the figure root
According to independent experiment three times as a result, value is averaged plus-minus standard deviation.
Fig. 4 is shown by the recombinant C RISPR-Cas9 β-catenin signal path established and NF-kB signal path
The result figure of manual contact, (a) recombination input signal and contacting for output signal help to establish new phenotype；(b)β-catenin
Manual contact is established between signal transduction pathway and NF-kB signal path；(c) β-catenin/NF-kB signal path downstream
The mRNA relative expression levels of gene are detected using qRT-PCR method, by detecting the mRNA of DPAGT1 and APCDD1 with respect to water
The flat stimulation for embodying LTD4；MRNA relative level by detecting BFL1 and MET embodies LTD4 in transfection CRISPR-Cas9
Stimulation afterwards；(d) the mRNA relative expression levels of β-catenin/NF-kB signal path downstream gene use qRT-PCR
Method detection.By detect BFL1 and MET mRNA relative level embody TNF-a stimulation, by detection DPAGT1 and
The mRNA relative level of APCDD1 embodies stimulation of the TNF-a after transfecting CRISPR-Cas9；The figure is according to independent real three times
It tests as a result, value is averaged plus-minus standard deviation.
Specific embodiment
Below by specific embodiment combination attached drawing, invention is further described in detail.
Fig. 1 shows the operation principle schematic diagram of a kind of gene expression regulation method of embodiment, including recombination sgRNA
The general introduction of silencing of target genes (a) or activation target gene (b), sgRNA include two parts in structure: with inactivation Cas9 albumen
(dCas9) first part (M) that combines and the 3 ' second parts (N) held for being connected to first part (M), wherein first part
(M) there is one section of antisense sequences (M1) at 5 ' ends, and second part (N) is aptamer Sequence comprising ligand binding moiety (N1)
With aptamer stem (N2).In the case where there is no signal A (or B), that is, be not present ligand when, the antisense sequences (M1) of sgRNA with
Aptamer stem (N2) pairing combines, and at this moment sgRNA is in "Off" state；With signal A (or B), that is, exist
When ligand, recombination sgRNA structure changes, state " opening ", at this point, the antisense sequences (M1) of sgRNA and the pairing of its target dna are tied
It closes, is produced by the output of dCas9-VP64 fusion protein or dCas9 protein activation or silencing B (or A) signal.
In the present invention, ligand can be exogenous ligand or endogenic ligand.Wherein, exogenous ligand such as theophylline or
Tetracycline, endogenic ligand such as phage capsid protein MS2.Correspondingly, aptamer can be theophylline aptamer, tetracycline aptamer or
Phage capsid protein MS2 aptamer.
It should be noted that so-called " gene regulation device " of the invention, includes at least a nucleotide sequence, the nucleotide
Sequence itself is a sgRNA or becomes a sgRNA through transcription, which has the characteristics that foregoing description in structure.Also
It is to say, in some cases, gene regulation device inherently sgRNA of the invention, is in CRISPR-Cas9 system
On the basis of sgRNA, engineered obtained sequential structure, this sgRNA is (including but unlimited by certain gene transfer strategy
Turn in electricity) import it is intracellular, dCas9 albumen or with the fusion protein (such as dCas9-VP64) of dCas9 protein fusion with
And in the presence of corresponding exogenous ligand or endogenic ligand, it can activate or the corresponding target gene of silencing is expressed.Another
Under some cases, gene regulation device of the invention is by transcribing the available core with the sgRNA of above structure
Nucleotide sequence, the nucleotide sequence can show as recombinant plasmid, which is transferred into the cell, can transcribe and provide
State the sgRNA of design feature, thus dCas9 albumen or with the fusion protein of dCas9 protein fusion (such as dCas9-
VP64) and in the presence of corresponding exogenous ligand or endogenic ligand, it can activate or the corresponding target gene of silencing is expressed.
It needs to be emphasized that as long as gene regulation device of the invention has the structure feature of foregoing description,
To its particular sequence and with no restrictions, that is to say, that any nucleotide sequence, as long as it is one with above structure feature
SgRNA becomes a sgRNA with above structure feature through transcription, that is, can be described as gene regulation device of the invention.
In a preferred embodiment of the present invention, gene regulation device further includes an albumen, which includes at least inactivation
Cas9 protein part optionally includes the activating transcription factor (such as VP64 albumen) merged with Cas9 protein part.
In a preferred embodiment of the present invention, gene regulation device further includes a ligand, the ligand of the ligand and sgRNA
Bound fraction combines.
The technical solution and technical effect that the present invention will be described in detail by the following examples.It should be appreciated that embodiment is only
Illustratively, it should not be understood as limiting the scope of the invention.
I. technology and method
1. the building of gene regulatory elements
Pass through transfected plasmids pcDNA-dCas9-HA (Plasmid#61355, Addgene) and plasmid M-SPn-VP64 respectively
(Plasmid#48674, Addgene) enables HEK293T cell transient expression inactivation Cas9 albumen or Cas9-VP64 fusion protein.
The building process of sgRNA plasmid: design Related cDNAs are inserted into the Bam of plasmid pGPU6/GFP/Neo after synthesis
HI/Bbs I site.
The building process of pcDNA3-MS2: the cDNA sequence of MS2 gene is inserted into the BamHI/ of plasmid pcDNA3
EcoRI。
2. cell culture and transfection
T24 (bladder cancer cell), HEK293T (the dirty cell of human embryo kidney (HEK)) are purchased from American Type Culture collection
(American Type Culture Collection, ATCC, Manassas, USA).Cell line with 10% fetal calf serum
(Invitrogen) and 1% dual anti-DMEM culture medium (Invitrogen, CA) culture, adherent growth, 37 DEG C and 5%CO2
Under the conditions of cultivate, 0.05% pancreatin had digestive transfer culture.For transient transfection studies, according to Lipofectamine2000 specification, when
After cell density reaches 70-80%, cell is handled using the mixed liquor of Lipofectamin2000 reagent and plasmid.
3.RNA is extracted and real-time quantitative PCR
Total RNAs extraction extracts reagent (Invitrogen, Grand Island, NY, USA) operation according to TRIzol RNA and says
Bright progress, Nanodrop measure the content and concentration of total serum IgE.Total serum IgE is according to RevertAidTM First Strand cDNA
Synthesis Kit (Fermentas, Hanover, MD) Reverse Transcriptase kit operating instruction reverse transcription is at cDNA.Real-time quantitative
PCR utilizes ABI according to All-in-OneTM qPCR Mix reagent (GeneCopoiea Inc, Rockville, MD) operating instruction
7000 quantitative fluorescent PCR system of PRISM (Applied Biosystems, Foster City, CA, USA) executes.PCR cycle
Parameter is as shown below: 95 DEG C are kept for 15 minutes, and then 40 recycle: 94 DEG C are kept for 15 seconds, and 55 DEG C are kept for 30 seconds and 72 DEG C protecting
It holds 30 seconds.It tests every time at least in triplicate.Internal reference crt gene is GAPDH gene, and all data are referring to the expression of GPADH
Make normalized.The primer sequence that PCR is used is as shown in table 1.
Primer used in 1. real time fluorescent quantitative qPCR of table
| Title | Sequence |
| VEGF-F | ACAGACACCGCTCCTAGCCC(SEQ ID NO:1) |
| VEGF-R | CGAGAACAGCCCAGAAGTTGG(SEQ ID NO:2) |
| MALAT1-F | AAAGCAAGGTCTCCCCACAAG(SEQ ID NO:3) |
| MALAT1-R | GGTCTGTGCTAGATCAAAAGGCA(SEQ ID NO:4) |
| UCA1-F | ACGCTAACTGGCACCTTGTT(SEQ ID NO:5) |
| UCA1-R | TGGGGATTACTGGGGTAGGG(SEQ ID NO:6) |
| APCDD1-F | GGATCATCTATCGGTCAGACG(SEQ ID NO:7) |
| APCDD1-R | TGGGTCACATCCTGCTGGATG(SEQ ID NO:8) |
| MET-F | GCAGAAACCCCCATCCAGAATGTC(SEQ ID NO:9) |
| MET-R | GGCCCCTGGTTTACTGACATACGC(SEQ ID NO:10) |
| DPAGT1-F | CAATGCCATCAATATCCTA(SEQ ID NO:11) |
| DPAGT1-R | AATCACCTTCCAACTCTA(SEQ ID NO:12) |
| BFL1-F | ATAACACAGGAGAATGGAT(SEQ ID NO:13) |
| BFL1-R | AGTATTGCTTCAGGAGAG(SEQ ID NO:14) |
| GAPDH-F | CGCTCTCTGCTCCTCCTGTTC(SEQ ID NO:15) |
| GAPDH-R | ATCCGTTGACTCCGACCTTCAC(SEQ ID NO:16) |
4. enzyme linked immunosorbent assay (ELISA) vegf protein concentration
Vegf protein concentration mensuration is carried out according to enzyme linked immunosorbent assay (ELISA) operating instruction.Briefly, it collects and cracks
106A sample cell, is collected after centrifugation the clear liquid on cell.Microplate reader (Bio-Rad, Hercules, CA) passes through detection colorimetric
Reaction and optical density (OD value) quantitative vegf protein.Then OD value is converted into the protein concentration by standard curve.It is real every time
Test progress at least three times.
II. experimental result
1. the building of signal transformer regulation plasmid
Inventor be based on CRISPR-Cas9 and its deriving technology and building one, nucleic acid switch establish exogenous ligand with it is interior
The gene regulation device (as shown in Figure 1) of source property gene manual contact, the device incorporate nucleic acid switch and (refer to aptamer sequence portion
Point) and sgRNA, after receiving special exogenous signals, dCas9 and dCas9-VP64 fusion protein silencing or activation target base can be passed through
Cause.When specific signals A (or B) combine aptamer molecule structure after can induce sgRNA antisense chain structure change, allow to
Its corresponding DNA sequence dna targeting interferes transcription after combining, and finally causes the change of another signal B (or A).Believe when lacking specificity
Number when, because sgRNA antisense strand by the antisense strand of aptamer stem combine, on the transcription of target gene do not have influence.This method
Existing sgRNA is changed into input a signal into and exports the RNA element to link together with heterologous signal.
2. exogenous ligand controllability transcriptional activation and silencing
In order to further verify this regulation method in people's HEK293T cell, select endogenous VEGF gene as target
Gene.The sgRNA of four targeting VEGF is devised, while the tetracycline aptamer after the insertion modification of the end 3' of each sgRNA is (suitable
Ligand).The stem of tetracycline aptamer antisense strand can match after pressing aforementioned modification with the antisense strand domain complementarity of sgRNA.qRT-
PCR and ELISA's the result shows that, only existing for the tetracycline under the conditions of, dCas9 and recombination sgRNA complex just have and have
The silencing efficiency (as shown in Figure 2 a) of effect.In HEK239T cell inner expression dCas9-VP64 fusion protein, sgRNA is same
It activated gene can be expressed under tetracycline stimulation.After tetracycline is added, four designed sgRNA are respectively with dCas9-VP64
VEGFA mRNA and protein expression level (as shown in Figure 2 b) are remarkably improved after co-expression.It is this in order to further verify
SgRNA is transformed by replacing tetracycline aptamer with theophylline aptamer in the validity of modular design method.And it is improved
The stem of sgRNA is consistent with previously designed sequence.As theophylline aptamer sgRNA and the common table of dCas9 or dCas9-VP64
Up to when, and theophylline stimulation under obtain effect similar to the above (as illustrated in figures 2 c and 2d).
In Fig. 2, the mRNA relative expression levels of VEGF are detected using qRT-PCR method, and the measurement of vegf protein level uses
ELISA method measurement.In HEK293T cell in the presence of tetracycline (figure a and figure b)/theophylline (figure c and figure d), rely on
The expression of the effect of dCas9/dCas9-VP64, VEGF mRNA and albumen is lowered/increases.According to independent experiment three times
As a result, value is averaged plus-minus standard deviation.Scheme in a, the ordinate of left figure indicates VEGF mRNA relative expression levels, coordinate value
It is 0.0,0.2,0.4~1.2 respectively from the bottom to top；The ordinate of right figure indicates that VEGA protein level, coordinate value divide from the bottom to top
It is not 0,100,200~600, unit is pg/ml；Blank column indicates Tetracycline (-), i.e., no tetracycline stimulation；It is real
Stem indicates Tetracycline (+), that is, has tetracycline stimulation；It is dCas9, dCas9+ respectively from left to right for abscissa
SgRNA1, dCas9+sgRNA2, dCas9+sgRNA3 and dCas9+sgRNA4.Scheme in b and the difference of figure a is the vertical seat of left figure
Scale value is 0,1,2~10 from bottom to top, and the ordinate value of right figure is 0,500,1000~2500 from the bottom to top, on abscissa, from
Left-to-right is dCas9-VP64, dCas9-VP64+sgRNA5, dCas9-VP64+sgRNA6, dCas9-VP64+sgRNA7 respectively
And dCas9-VP64+sgRNA8.It is dCas9, dCas9+sgRNA9, dCas9+ respectively that the main distinction for scheming c and figure a, which is abscissa,
SgRNA10, dCas9+sgRNA11 and dCas9+sgRNA12.It is dCas9- respectively that the main distinction for scheming d and figure b, which is abscissa,
VP64, dCas9-VP64+sgRNA13, dCas9-VP64+sgRNA14, dCas9-VP64+sgRNA15 and dCas9-VP64+
sgRNA16.The DNA sequence dna of sgRNA1~16 is respectively as shown in NO:17~32 SEQ ID in table 2.
3. endogenic ligand modulability transcriptional activation and silencing.
In order to further verify recombinant C RISPR-Cas9 system response can be carried out to endogenous protein and adjust dependency basis
Because of expression, phage capsid protein MS2 aptamer is integrated on the corresponding construction of sgRNA and tests its corresponding effect.Selection
Long-chain non-coding RNA MALAT1 and UCA1 are as target gene.In HEK293T cell tests, MS2 and recombinant C RISPR- is expressed
Cas9 system is compared with the system that do not express MS2 or do not express sgRNA, and the expression of MALAT1 has otherness.Wherein express
DCas9 can induce silencing MALAT1 expression (as shown in Figure 3a), and expressing dCas9-VP64 can induce activation MALAT1 expression (such as
Shown in Fig. 3 b).When target gene is changed to UCA1, by recombinant C RISPR-Cas9 system achieve same effect (such as Fig. 3 c and
Shown in 3d).Above data prompt can be established out between endogenous protein and gene expression by recombinant C RISPR-Cas9 system
Manual contact.In Fig. 3, the DNA sequence dna of sgRNA17~32 is respectively as shown in NO:33~48 SEQ ID in table 2.
4. the manual contact of β-catenin signal path and NF-kB signal path
By previous experiences, synthesising biological scholar often designs alternative gene net to create new function in cell
Network.Since above experimental result prompts recombinant C RISPR-Cas9 system that can effectively establish in two specific signals
Completely new connection, therefore inventor just attempts the topological structure (as shown in fig. 4 a) of remodeling cell classical signals network.Pass through this
Kind method, establishes two kinds of manual contact between β-catenin signal path and NF-kB signal path.It is set specifically
In meter, the activation of β-catenin signal can activate NF-kB signal path, and when NF-kB signal is activated can inhibit β-
Catenin signal path (as shown in Figure 4 b).β-catenin or NF-kB aptamer are identified into NF-kB (p65) in conjunction with sgRNA
Or β-catenin (CTNNB1), and dCas9 or dCas9-VP64 is expressed in bladder cancer cell lines T24.The result shows that when thin
When β-catenin activator LTD4 being added in born of the same parents, downstream gene (DPAGT1 and APCDD1) expression of β-catenin is mentioned
It is high.Compared with negative control, only LTD4 can significantly improve the downstream gene of NF-kB under recombinant C RISPR-Cas9 effect
The mRNA expression (as illustrated in fig. 4 c) of (BFL1 and MET).TNF-a is detected by detecting the expression of BFL1 and MET
To the stimulation of NF-kB signal path.In experimental group and control group, two above gene table is to equal under TNF-a stimulation
It significantly improves.At the same time, only DPAGT1 and APCDD1mRNA expression detects aobvious downward (such as Fig. 4 d in dCas9 experimental group
It is shown).Result above confirms that the gene regulation mode can effectively adapt the signal network of endogenous cellular again.Fig. 4
In, the DNA sequence dna of sgRNA33~34 is respectively as shown in NO:49~50 SEQ ID in table 2.
β-catenin signal path that Fig. 4 is established by recombinant C RISPR-Cas9 and NF-kB signal path it is artificial
System.(a) recombinating input signal and contacting for output signal helps to establish new phenotype.(b) β-catenin signal transduction pathway with
Manual contact is established between NF-kB signal path.(c) mRNA of β-catenin/NF-kB signal path downstream gene is opposite
Expression is detected using qRT-PCR method.MRNA relative level by detecting DPAGT1 and APCDD1 embodies the thorn of LTD4
Swash effect.MRNA relative level by detecting BFL1 and MET embodies stimulation of the LTD4 after transfecting CRISPR-Cas9.
(d) the mRNA relative expression levels of β-catenin/NF-kB signal path downstream gene are detected using qRT-PCR method.Pass through
The mRNA relative level for detecting BFL1 and MET embodies the stimulation of TNF-a.By the mRNA phase for detecting DPAGT1 and APCDD1
To the horizontal stimulation for embodying TNF-a after transfecting CRISPR-Cas9.According to independent experiment three times as a result, value is averaged
Add and subtract standard deviation.
The corresponding DNA sequence dna of 2 sgRNAs of table
Note: in the present invention, the corresponding DNA sequence dna of sgRNA is subject to content documented by table 2.
5. conclusion
In this research, it is specific to signal progress is set certainly as a result to confirm that recombinant C RISPR-Cas9 system can be createed
The cell of response.It is better understood with the design principle of nature gene network by this method.Benefit from cell signal editor
The progress of technology, various powerful applications will be presented in fundamental biological knowledge and applied biology field.
The above content is specific embodiment is combined, further detailed description of the invention, and it cannot be said that this hair
Bright specific implementation is only limited to these instructions.For those of ordinary skill in the art to which the present invention belongs, it is not taking off
Under the premise of from present inventive concept, a number of simple deductions or replacements can also be made.
Claims (10)
1. a kind of gene regulation device based on CRISPR-Cas9, which is characterized in that the gene regulation device includes a nucleosides
Acid sequence, the nucleotide sequence itself is a sgRNA or becomes a sgRNA through transcription, which includes two in structure
Part: with the protein bound first part of inactivation Cas9 and 3 ' second parts held of the first part are connected to, wherein institute
There is one section of antisense sequences at the 5 ' ends for stating first part, and the second part is aptamer Sequence comprising ligand binding moiety
With aptamer stem；When ligand is not present, the antisense sequences are combined with aptamer stem pairing；When there are ligand, institute
Antisense sequences are stated to dissociate with the aptamer stem to be combined with target dna pairing；The corresponding DNA sequence dna such as SEQ of the sgRNA
Shown in any sequence in NO:17 ~ 50 ID.
2. gene regulation device according to claim 1, which is characterized in that the ligand is exogenous ligand or endogenous
Ligand.
3. gene regulation device according to claim 2, which is characterized in that the exogenous ligand is theophylline or Fourth Ring
Element, the endogenic ligand are phage capsid protein MS2.
4. gene regulation device according to claim 1, which is characterized in that the aptamer is that theophylline aptamer, tetracycline are suitable
Body or phage capsid protein MS2 aptamer.
5. gene regulation device according to claim 1-4, which is characterized in that the gene regulation device also wraps
An albumen is included, the albumen includes at least inactivation Cas9 protein part.
6. gene regulation device according to claim 5, which is characterized in that the gene regulation device further include with it is described
The activating transcription factor of Cas9 protein part fusion.
7. gene regulation device according to claim 5, which is characterized in that the activating transcription factor is VP64 albumen.
8. gene regulation device according to claim 5, which is characterized in that the albumen is dCas9-VP64 fusion protein
And/or dCas9 albumen.
9. gene regulation device according to claim 1-4, which is characterized in that the gene regulation device also wraps
A ligand is included, the ligand is in conjunction with the ligand binding moiety.
10. a kind of gene regulation method based on CRISPR-Cas9, which is characterized in that the gene regulation method uses right
It is required that the described in any item gene regulation devices of 1-9, the method includes the gene regulation device is imported in cell, and
In the presence of inactivating Cas9 albumen and ligand molecular, the expression of goal of regulation and control DNA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610741981.4A CN106318973B (en) | 2016-08-26 | 2016-08-26 | A kind of gene regulation device and gene regulation method based on CRISPR-Cas9 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610741981.4A CN106318973B (en) | 2016-08-26 | 2016-08-26 | A kind of gene regulation device and gene regulation method based on CRISPR-Cas9 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106318973A CN106318973A (en) | 2017-01-11 |
| CN106318973B true CN106318973B (en) | 2019-09-13 |
Family
ID=57791240
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610741981.4A Active CN106318973B (en) | 2016-08-26 | 2016-08-26 | A kind of gene regulation device and gene regulation method based on CRISPR-Cas9 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106318973B (en) |
Families Citing this family (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6261500B2 (en) | 2011-07-22 | 2018-01-17 | プレジデント アンド フェローズ オブ ハーバード カレッジ | Evaluation and improvement of nuclease cleavage specificity |
| US20150044192A1 (en) | 2013-08-09 | 2015-02-12 | President And Fellows Of Harvard College | Methods for identifying a target site of a cas9 nuclease |
| US9359599B2 (en) | 2013-08-22 | 2016-06-07 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US9388430B2 (en) | 2013-09-06 | 2016-07-12 | President And Fellows Of Harvard College | Cas9-recombinase fusion proteins and uses thereof |
| US9340799B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | MRNA-sensing switchable gRNAs |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| WO2016022363A2 (en) | 2014-07-30 | 2016-02-11 | President And Fellows Of Harvard College | Cas9 proteins including ligand-dependent inteins |
| US20190225955A1 (en) | 2015-10-23 | 2019-07-25 | President And Fellows Of Harvard College | Evolved cas9 proteins for gene editing |
| KR102547316B1 (en) | 2016-08-03 | 2023-06-23 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Adenosine nucleobase editing agents and uses thereof |
| AU2017308889B2 (en) | 2016-08-09 | 2023-11-09 | President And Fellows Of Harvard College | Programmable Cas9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| KR20240007715A (en) | 2016-10-14 | 2024-01-16 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Aav delivery of nucleobase editors |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| EP3592777A1 (en) | 2017-03-10 | 2020-01-15 | President and Fellows of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| CN107245493B (en) * | 2017-03-24 | 2021-02-19 | 陕西师范大学 | Vector for expressing aptamer ribozyme modified sgRNA regulated and controlled by theophylline and application |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| WO2019023680A1 (en) | 2017-07-28 | 2019-01-31 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (pace) |
| WO2019139645A2 (en) | 2017-08-30 | 2019-07-18 | President And Fellows Of Harvard College | High efficiency base editors comprising gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CN108753818B (en) * | 2018-04-24 | 2022-01-28 | 深圳市第二人民医院 | RNA signal connector, target mRNA translation regulation method, logic gate and application |
| CN109706168B (en) * | 2019-01-08 | 2020-12-25 | 清华大学 | Vector for promoting expression of Kluyveromyces marxianus target gene |
| CA3130488A1 (en) | 2019-03-19 | 2020-09-24 | David R. Liu | Methods and compositions for editing nucleotide sequences |
| CN110777159B (en) * | 2019-12-03 | 2023-05-05 | 苏州缔因安生物科技有限公司 | CRISPR-Cas 9-based nucleic acid detection system and application thereof |
| CN111073902B (en) * | 2019-12-30 | 2022-04-26 | 广东省微生物研究所（广东省微生物分析检测中心） | CRISPR/dCas9 vector for improving expression level of gliotoxin biosynthesis gene and construction method and application thereof |
| GB2614813A (en) | 2020-05-08 | 2023-07-19 | Harvard College | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| CN114807240B (en) * | 2021-01-21 | 2024-02-06 | 深圳市第二人民医院(深圳市转化医学研究院) | Template molecule connected with aptamer and kit thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103820441A (en) * | 2014-03-04 | 2014-05-28 | 黄行许 | Method for human CTLA4 gene specific knockout through CRISPR-Cas9 (clustered regularly interspaced short palindromic repeat) and sgRNA(single guide RNA)for specially targeting CTLA4 gene |
| CN104531705A (en) * | 2014-12-09 | 2015-04-22 | 中国农业大学 | Method for knocking off animal myostatin gene by using CRISPR-Cas9 system |
| CN105543223A (en) * | 2015-12-25 | 2016-05-04 | 华侨大学 | Method for transcribing sgRNA (small guide Ribonucleic Acid) based on miRNA/shRNA (micro Ribonucleic Acid/short hairpin Ribonucleic Acid) transcription processing mechanism |
| CN105765070A (en) * | 2013-09-06 | 2016-07-13 | 哈佛大学的校长及成员们 | Switchable CAS9 nucleases and uses thereof |
-
2016
- 2016-08-26 CN CN201610741981.4A patent/CN106318973B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105765070A (en) * | 2013-09-06 | 2016-07-13 | 哈佛大学的校长及成员们 | Switchable CAS9 nucleases and uses thereof |
| CN103820441A (en) * | 2014-03-04 | 2014-05-28 | 黄行许 | Method for human CTLA4 gene specific knockout through CRISPR-Cas9 (clustered regularly interspaced short palindromic repeat) and sgRNA(single guide RNA)for specially targeting CTLA4 gene |
| CN104531705A (en) * | 2014-12-09 | 2015-04-22 | 中国农业大学 | Method for knocking off animal myostatin gene by using CRISPR-Cas9 system |
| CN105543223A (en) * | 2015-12-25 | 2016-05-04 | 华侨大学 | Method for transcribing sgRNA (small guide Ribonucleic Acid) based on miRNA/shRNA (micro Ribonucleic Acid/short hairpin Ribonucleic Acid) transcription processing mechanism |
Non-Patent Citations (1)
| Title |
|---|
| Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex;Konermann et al;《Nature》;20150129;第517卷;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106318973A (en) | 2017-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106318973B (en) | A kind of gene regulation device and gene regulation method based on CRISPR-Cas9 | |
| Yao et al. | Zkscan 1 gene and its related circular rna (circ zkscan 1) both inhibit hepatocellular carcinoma cell growth, migration, and invasion but through different signaling pathways | |
| Li et al. | The long noncoding RNA GAS5 negatively regulates the adipogenic differentiation of MSCs by modulating the miR-18a/CTGF axis as a ceRNA | |
| Ludlow et al. | NOVA1 regulates hTERT splicing and cell growth in non-small cell lung cancer | |
| Smrt et al. | MicroRNA miR-137 regulates neuronal maturation by targeting ubiquitin ligase mind bomb-1 | |
| Yang et al. | MicroRNA‐21 represses human cystathionine gamma‐lyase expression by targeting at specificity protein‐1 in smooth muscle cells | |
| Moro et al. | MicroRNA-dependent regulation of biomechanical genes establishes tissue stiffness homeostasis | |
| Li et al. | Double-strand break repair deficiency in NONO knockout murine embryonic fibroblasts and compensation by spontaneous upregulation of the PSPC1 paralog | |
| CN107405357A (en) | Multiple shRNAs and its application | |
| Liang et al. | Suppressive effect of microRNA‐29b on hepatic stellate cell activation and its crosstalk with TGF‐β1/Smad3 | |
| Lee et al. | Altered expression of miR-202 in cerebellum of multiple-system atrophy | |
| Mathew et al. | The highly conserved codon following the slippery sequence supports− 1 frameshift efficiency at the HIV-1 frameshift site | |
| Gete et al. | Mechanisms of angiogenic incompetence in Hutchinson–Gilford progeria via downregulation of endothelial NOS | |
| JP2007502129A (en) | Short interfering RNA libraries and methods of synthesis and use | |
| CN112899238B (en) | Compound screening cell model based on RNA-m6A modification level and construction and application thereof | |
| Zhao et al. | ILEI is an important intermediate participating in the formation of TGF‐β1–induced renal tubular EMT | |
| Tardos et al. | SR proteins ASF/SF2 and SRp55 participate in tissue factor biosynthesis in human monocytic cells | |
| CN112111595A (en) | Method for screening compound capable of up-regulating EFTUD2 expression | |
| JP7084033B2 (en) | Methods of expressing protein genes in response to miRNA expression | |
| Zeitelhofer et al. | High‐efficiency transfection of short hairpin RNAs‐encoding plasmids into primary hippocampal neurons | |
| Xu et al. | Circular RNA circ‐TNRC6B inhibits the proliferation and invasion of esophageal squamous cell carcinoma cells by regulating the miR‐452‐5p/DAG1 axis | |
| Long et al. | RNAe in a transgenic growth hormone mouse model shows potential for use in gene therapy | |
| CN103952410B (en) | The shRNA of a kind of effective suppression rat FoxO3a genetic expression and application thereof | |
| CN103952406B (en) | The siRNA of targeting STAT3 gene of suppression people's malignant glioma propagation and expression vector thereof and application | |
| Kováčová | of Thesis: Factors influencing the AG-dependence of the 3'splice sites |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |