CN114807240B

CN114807240B - Template molecule connected with aptamer and kit thereof

Info

Publication number: CN114807240B
Application number: CN202110081407.1A
Authority: CN
Inventors: 黄新波; 刘宇辰; 汪铭霞; 桂耀庭; 孟佳林
Original assignee: Shenzhen Second Peoples Hospital; Peking University Shenzhen Hospital
Current assignee: Shenzhen Second Peoples Hospital; Peking University Shenzhen Hospital
Priority date: 2021-01-21
Filing date: 2021-01-21
Publication date: 2024-02-06
Anticipated expiration: 2041-01-21
Also published as: CN114807240A

Abstract

A template molecule connected with an aptamer and a kit thereof, wherein the aptamer with specific affinity with a targeted gene editing protein is connected in series at the 3 'end and/or the 5' end of the template molecule. After the template molecule is connected with the aptamer in series, the aptamer has specific affinity with the targeted gene editing protein, so that when the aptamer is applied to homologous recombination repair, the homologous recombination repair efficiency of the gene can be remarkably improved, the aptamer can also be applied to gene transcription regulation, the gene editing off-target rate can be reduced, and the like.

Description

Template molecule connected with aptamer and kit thereof

Technical Field

The invention relates to the technical field of gene editing, in particular to a template molecule connected with an aptamer and a kit thereof.

Background

CRISPR/Cas9 (Clustered regularly interspaced short palindromic repeats, CRISPR/CRISPR-associated protein 9) is currently the most commonly used gene editing tool. Cas9 proteins can be sheared at specific genomic sites under the guidance of guide RNAs (sgrnas) to form DNA double-strand breaks (DSBs) that are repaired by non-homologous end joining or homologous recombination repair pathways. In the absence of homologous repair templates, the repair is by Non-homologous end joining (Non-homologous end joining, NHEJ), which leads to gene mutation after repair. Homologous recombination repair (homologous recombination repair, HRR) can occur when repair templates with homology to both ends of the DSB are present. By designing a homology template sequence, a gene fragment can be inserted near a DSB site, point mutation can be induced, and the like, so that gene editing is realized.

The existing homologous recombination repair templates comprise single-stranded DNA, double-stranded DNA, plasmids and the like, wherein the single-stranded DNA has better effect and is most convenient to synthesize. However, the efficiency of homologous recombination repair is generally low and the workload is high. In order to improve the homologous recombination repair efficiency of the gene, the length of the homologous sequences at the left side and the right side of the repair site can be increased, and when the length of the sequences is increased, the homologous recombination repair efficiency can be improved, but the difficulty of synthesizing a long sequence template is high, and the cost is high. Or connecting a nuclear positioning sequence on the homologous recombination template to promote the transfer of the template like cell nucleus and improve the homologous recombination efficiency, wherein the nuclear positioning sequence is an amino acid sequence, so that the modification difficulty is high and the cost is high.

Disclosure of Invention

According to a first aspect, in one embodiment there is provided a template molecule having an aptamer attached thereto, the template molecule having an aptamer attached to its 3 'and/or 5' end that has a specific affinity for a targeted gene editing protein.

According to a second aspect, in one embodiment there is provided a kit comprising a template molecule according to the first aspect.

According to a third aspect, there is provided in one embodiment a targeted gene editing method comprising: co-transfecting the gene editing system and the template molecule in the first aspect to a transfection carrier to obtain a target product, wherein an aptamer with specific affinity with the targeted gene editing protein is connected in series at the 3 'end and/or the 5' end of the template molecule.

According to the template molecule connected with the aptamer and the kit thereof, after the template molecule is connected with the aptamer in series, the aptamer has specific affinity with the targeted gene editing protein, so that the repair efficiency of homologous recombination can be remarkably improved when the aptamer is applied to homologous recombination repair, the aptamer can also be applied to gene transcription regulation, the off-target rate of gene editing is reduced, and the like.

Drawings

FIG. 1 is a schematic diagram of an embodiment of a homologous recombination repair design.

FIG. 2 shows a diagram of the sequencing peaks of mutant GFP (510-513 del AAC) according to one embodiment.

Fig. 3 and 4 show schematic structural diagrams of Cas9 proteins according to an embodiment.

FIG. 5 shows a graph comparing the gene repair efficiencies of the homologous repair templates donor DNA (40), donor DNA (55) and donor DNA (75) according to an example.

FIG. 6 is a graph showing comparison of gene repair efficiencies of the homologous repair templates, donor DNA (40) -aptamer, and aptamer-donor DNA (40) according to an example.

Detailed Description

The invention will be described in further detail below with reference to the drawings by means of specific embodiments. Wherein like elements in different embodiments are numbered alike in association. In the following embodiments, numerous specific details are set forth in order to provide a better understanding of the present application. However, one skilled in the art will readily recognize that some of the features may be omitted, or replaced by other elements, materials, or methods in different situations. In some instances, some operations associated with the present application have not been shown or described in the specification to avoid obscuring the core portions of the present application, and may not be necessary for a person skilled in the art to describe in detail the relevant operations based on the description herein and the general knowledge of one skilled in the art.

Furthermore, the described features, operations, or characteristics of the description may be combined in any suitable manner in various embodiments. Also, various steps or acts in the method descriptions may be interchanged or modified in a manner apparent to those of ordinary skill in the art. Thus, the various orders in the description and drawings are for clarity of description of only certain embodiments, and are not meant to be required orders unless otherwise indicated.

The numbering of the components itself, e.g. "first", "second", etc., is used herein merely to distinguish between the described objects and does not have any sequential or technical meaning. The terms "coupled" and "connected," as used herein, are intended to encompass both direct and indirect coupling (coupling), unless otherwise indicated.

The nucleic acid aptamer, namely the aptamer for short, is a small section of nucleotide sequence or short polypeptide obtained by in vitro screening, and can be combined with the corresponding ligand with high affinity and strong specificity. The Aptamer (Aptamer) is typically a DNA (deoxyribonucleic acid), RNA (ribonucleic acid) sequence, XNA (nucleic acid analogue) or peptide.

According to a first aspect, in some embodiments, there is provided a template molecule having an aptamer attached thereto, the template molecule having an aptamer attached to the 3 'and/or 5' end thereof that has a specific affinity for a targeted gene editing protein.

In some embodiments, the aptamer may be a single stranded nucleotide sequence.

In some embodiments, the aptamer comprises at least one of the nucleotide sequences set forth in SEQ ID NO.1 through SEQ ID NO. 15.

The sequence of each aptamer is specifically as follows:

AACACGACACAAGTTCGAAGGACGAACGTCATGCAAGTGGGC(SEQ ID NO.1)；

AACACGACTCCACTGTGCGTCGCGAACTCTGCCACGGTCGTG(SEQ ID NO.2)；

AACACGACGCAGCTGTGGCCAGCGAACTGTGTGGGAGTGGGC(SEQ ID NO.3)；

AAGCCCACTGGTCTGTGGACAACGAACGCCGGTGTGGTCGTG(SEQ ID NO.4)；

AACACGACGTGTCTGTGAATCACACAGTCCAACAATGTCGTG(SEQ ID NO.5)；

AACACGACGGCGCTGTGCCGGTCACAGCGTGTGGATGTGGGC(SEQ ID NO.6)；

AACACGACCTCTCTGTGAAGGTCGAACGTCGTGCTAGTCGTG(SEQ ID NO.7)；

AACACGACCCCGCTGTGATTCGCGAACAAATAGCGCGTCGTG(SEQ ID NO.8)；

AAGCCCACACGTCTGTGAGAGGCGAACATATGCATGGTCGTG(SEQ ID NO.9)；

AACACGACACTCGTTCGCGCACCACAGCGCGTTGTCGTCGTG(SEQ ID NO.10)；

AACACGACTCCACTGTGCCTCTCGAACCATGAGCCTGTCGTG(SEQ ID NO.11)；

AACACGACGGAACTGTGCGTCGCACAGGCCGCTGGTGTCGTG(SEQ ID NO.12)；

AAGCCCACATGCCTGTGCTTCGCACAGCGCATCACGGTCGTG(SEQ ID NO.13)；

AACACGACGCCACTGTGAACAACGAACCCATCGCCAGTGGGC(SEQ ID NO.14)；

AAGCCCACAGCCCTGTGCTTCTCACAGGGATCCATAGTGGGC(SEQ ID NO.15)。

in some embodiments, the aptamer comprises any one of the nucleotide sequences set forth in SEQ ID NO.1 through SEQ ID NO. 15.

The aptamer has universality and can be connected with any homologous repair template.

In some embodiments, the template molecule is a single stranded DNA template molecule.

In some embodiments, the template molecule comprises a cognate repair template.

The homologous repair template contains a region homologous to the target sequence or its complement.

In some embodiments, when the template molecule is a homologous repair template, the homologous repair template comprises, in order, an upstream homology arm, an exogenous DNA molecule, and a downstream homology arm.

In some embodiments, when the template molecule is a homologous repair template, the length of the upstream homology arm, the downstream homology arm, the repair site, of the homologous repair template is greater than or equal to 30nt, including but not limited to 30nt, 31nt, 32nt, 33nt, 34nt, 35nt, 36nt, 37nt, 38nt, 39nt, 40nt, 41nt, 42nt, 43nt, 44nt, 45nt, 46nt, 47nt, 48nt, 49nt, 50nt, 51nt, 52nt, 53nt, 54nt, 55nt, 56nt, 57nt, 58nt, 59nt, 60nt, 61nt, 62nt, 63nt, 64nt, 65nt, 66nt, 67nt, 68nt, 69nt, 70nt, 71nt, 72nt, 73nt, 74nt, 75nt, 76nt, 77nt, 78nt, 79nt, 80nt, 90nt, 100nt, 110, 120nt, 130nt, 140, 150, 160nt, 170nt, 180nt, 190nt, 300nt, or more.

In some embodiments, the upstream homology arm and the downstream homology arm of the repair site of the homologous repair template are independently 40-200nt in length.

In some embodiments, the targeted gene editing protein includes, but is not limited to, at least one of a CRISPR protein, a TALEN protein, a ZFN protein, or derivatives thereof.

In some embodiments, the CRISPR protein includes, but is not limited to, at least one of Cas9, cas9 derivatives, cpf 1.

In some embodiments, the Cas9 includes, but is not limited to, at least one of streptococcus pyogenes Cas9, streptococcus thermophilus Cas9, cas9 from meningococcal serogroup a/serotype 4A, staphylococcus aureus Cas 9.

In some embodiments, the Cas9 derivative includes a mutant that includes a site mutation but still has site recognition and cleavage activity.

In some embodiments, the Cas9 derivative includes, but is not limited to, at least one of the following derivatives: a Cas9 mutant comprising at least one of the site mutations D10A, D10N, H840A, H840N, H840Y but still having site recognition and cleavage activity, and a Cas9 mutant comprising at least one of the site mutations N497A, R661A, Q695A, Q926A to reduce Cas9 off-target effects.

According to a second aspect, in some embodiments, there is provided a kit comprising the template molecule of the first aspect.

In some embodiments, the kit further comprises an sgRNA designed for the target sequence.

In some embodiments, the sgrnas contain base sequences that can be complementarily paired to the target sequence or its complement.

In some embodiments, the kit further comprises a targeted gene editing protein.

In some embodiments, when the targeted gene editing protein is Cas9, the target sequence comprises the position to be edited, PAM, and an sgRNA recognition region located upstream of PAM.

In some embodiments, the kit further comprises a gene editing system.

In some embodiments, the gene editing system further comprises at least one of a CRISPR-Cas9 system or a variant system thereof.

The CRISPR-Cas9 system refers to a set of systems consisting of CRISPR (Clustered regularly interspaced short palindromic repeats, regularly clustered interval short palindromic repeats) and Cas9 (CRISPR-associated protein) together, which is a natural defense system for bacteria to defend against phage DNA injection and plasmid transfer. The system is reused by human beings, is used for constructing a DNA targeting platform guided by RNA, and is mainly used for genome editing, transcription disturbance, epigenetic regulation and the like.

In some embodiments, the CRISPR-Cas9 system contains a vector that can express a Cas9 protein or a derivative thereof. The skilled person can select a suitable vector, which may be a phage, plasmid, or viral vector, or an artificial chromosome, such as a bacterial or yeast artificial chromosome. In other words, the vectors of embodiments of the invention comprise a polynucleotide of interest capable of being expressed in a host cell or an isolated fraction thereof. Vectors are also generally suitable as cloning vectors, i.e.replicable in microbial systems; the cloning vector may be designed for replication in one host, while the construct for expressing the Cas9 isogenic editing protein is designed for expression in the same or a different host. Vectors comprising the polypeptides and proteins of embodiments of the invention may also comprise a selectable marker for propagation or selection in a host cell. The vector may be introduced into a prokaryotic or eukaryotic cell by conventional transformation or transfection techniques.

In some embodiments, variant systems of the CRISPR-Cas9 system include, but are not limited to, CRISPR-dCas9 systems.

In some embodiments, the kit further comprises a container for separately storing each component. Typically, the different components are stored in different containers or in different chambers of the containers, and the respective components are mixed and reacted prior to use.

In some embodiments, the kit further comprises instructions for directing a user to use the kit.

According to a third aspect, in some embodiments, there is provided a targeted gene editing method comprising: co-transfecting the gene editing system and the template molecule in the first aspect to a transfection carrier to obtain a target product, wherein an aptamer with specific affinity with the targeted gene editing protein is connected in series at the 3 'end and/or the 5' end of the template molecule.

In some embodiments, the gene editing system includes, but is not limited to, at least one of a CRISPR-Cas9 system or a variant system thereof.

In some embodiments, the transfection vector includes, but is not limited to, at least one of a cell, an animal.

In some embodiments, the cells may be eukaryotic cells and/or prokaryotic cells, more particularly mouse cells, human cells, and the like.

In some embodiments, the invention uses single-stranded DNA with 3 'and 5' ends connected in series with Cas9 protein aptamer to co-transfect cells with CRISPR-Cas9 system, which can significantly improve the efficiency of homologous recombination repair.

In some embodiments, in order to improve the efficiency of gene homologous recombination repair, the invention designs an excellent single-stranded DNA aptamer sequence, wherein the single-stranded DNA aptamer sequence with specific affinity with Cas9 protein is connected in series at the 3 'end and/or the 5' end of a homologous repair template, and the repair template after being connected in series and a CRISPR/Cas9 system are used for cotransfecting cells, so that the efficiency of gene homologous recombination repair is obviously improved.

In some embodiments, a method of improving the efficiency of homologous recombination repair in CRISPR/Cas9 gene editing is provided by concatenating a single stranded DNA aptamer sequence with Cas 9-specific affinity at the 3 'end or 5' end of a single stranded DNA template.

In some embodiments, as shown in fig. 1, a method for improving the efficiency of homologous recombination repair in CRISPR/Cas9 gene editing is provided, comprising the specific steps of:

designing the sgRNA sequence, namely designing the sgRNA sequence according to the GFP gene mutation site, and shearing the sequence near the mutation site under the combined action of Cas 9;

designing a homologous repair single-stranded DNA template, wherein the step comprises designing the homologous repair single-stranded DNA template aiming at a gene fracture site;

a step of synthesizing a single-stranded DNA template, which comprises respectively synthesizing single-stranded DNA templates of which 3 'ends and 5' ends are connected with Cas9 aptamer sequences in series;

and a transfection step, which comprises the steps of transfecting the CRISPR/Cas9 system and the single-stranded DNA template into cells by a liposome transfection method, and carrying out gene repair on mutation sites.

In FIG. 1, in the absence of homologous repair templates (i.e., ssDNA), the repair is in the form of Non-homologous end joining (Non-homologous end joining, NHEJ), which results in a mutation of the gene after repair; when a single-stranded DNA template for homologous repair is designed for a gene fracture site, repair (Post editing repair) occurs after shearing, and the homologous recombination repair efficiency is low (Low efficiency of homology-directed repair); after designing a homologous repair single-stranded DNA template aiming at a gene fracture site, connecting an aptamer on the homologous repair single-stranded DNA template, so that the aptamer has specific affinity with Cas9 protein, and can repair in time while shearing, and the homologous recombination repair efficiency is high (Hihger efficiency of homology-directed repair).

In some embodiments, GFP gene repair efficiency can be quantitatively measured using flow cytometry.

In some embodiments, a kit for gene editing is provided comprising a CRISPR-Cas9 system and a single stranded DNA template of Cas9 protein aptamer in tandem with the 3 'and 5' ends.

In some embodiments, the benefits of the present invention include: the single-stranded DNA with 3 'and 5' ends connected with the Cas9 protein aptamer in series is used for co-transfecting cells with the CRISPR-Cas9 system, so that the efficiency of homologous recombination repair can be remarkably improved.

In some embodiments, the invention can achieve regulation of gene transcription, improving gene editing accuracy.

In the following examples, CRISPR-Cas9 vector was designed and synthesized by hantao biotechnology (Shanghai), modified single stranded DNA template was synthesized by kusnezoff biotechnology, inc, and 10 μmol/L was prepared with double distilled water, transfection reagent Lipofectamine 3000 was purchased from invitrogen, and gene sequencing was performed by biological engineering (Shanghai).

The cells in the following examples were human kidney epithelial cell line 293 cells stably transfected with a mutant GFP gene (as shown in SEQ ID NO. 16) and were given by the university of Winz medical science valley peak teacher.

Example 1

Fig. 1 is a schematic diagram of the design of the present embodiment.

The operation steps of this embodiment are as follows:

1. cell culture and GFP mutation site sequencing

The monoclonal cell line integrated with GFP (510_513del AAC) gene is given by a valley peak teacher of the university of Wenzhou medical science, and carries the inactivated mutant GFP gene, and the gene can restore green fluorescence after repair. The nucleotide sequence of GFP (510_513delAAC) gene is shown as SEQ ID NO. 16. DMEM (available from Invitrogen, ca, usa) in cell culture medium by volume: fetal bovine serum: L-Glutamine: diabody solution = 90:10:1:1, the initial concentration of the diabody solution was 1000U/mL. PCR sequencing was performed by designing primers (forward direction: 5'-GACGACGGCAACTACAAG-3', SEQ ID NO.21; reverse direction: 5'-TCCATGCCGAGAGTGATC-3', SEQ ID NO. 22) near the mutation site, and the sequencing primers were used to verify that the cell strain was a GFP mutant monoclonal cell, and the verification result is shown in FIG. 1.

The GFP (510_513del AAC) sequence is as follows:

the complement of the underlined sequence can be complementarily paired with the forward primer.

The sequence marked by the single wavy line is shown in FIG. 2, and the mutant sequence lacks AAC (the position of the base deletion).

The sequences shown in the double-lined lower line are sequences which can be complementarily paired with part of the spacer sequence (spacer sequence) of the sgRNA.

2. Design and synthesis of sgRNA aiming at GFP gene mutation site

The sgRNA sequence designed for GFP mutation site (510_513del AAC) was designed and synthesized by hantao biotechnology (shanghai) limited. The sgRNA sequence is shown in SEQ ID NO.17, specifically 5'-GATGCCGTTCTTCTGCTTGT-3'.

3. Homologous repair template single-stranded DNA synthesis

In this example, 3 homologous repair sequences, which are respectively a donor DNA (40), a donor DNA (55) and a donor DNA (70), are designed for the vicinity of the mutation site of the gene, wherein 40, 55 and 70 represent the base lengths of the upstream and downstream homology arms of the repair site, for example, the donor DNA (40) represents that the base lengths of the upstream and downstream homology arms of the repair site are 40nt. Cas9 aptamer sequences (aptamers) in tandem with homologous repair templates were screened by exponential enriched ligand system evolution technology (Systematic Evolution of Ligands by Exponential Enrichment, SELEX). The sequence of the homologous repair template (donor DNA 40) is shown as SEQ ID NO.18, the sequence of the homologous repair template (donor DNA 55) is shown as SEQ ID NO.19, the sequence of the homologous repair template (donor DNA 70) is shown as SEQ ID NO.20, the aptamer1 shown as SEQ ID NO.1 is respectively connected in series to the 3' ends of the three homologous repair templates, the repair efficiency of the three homologous repair templates is measured by a flow cytometry, the homologous repair template with the highest repair efficiency is screened, then the repair efficiency of the homologous repair template with the highest repair efficiency is compared with the repair efficiency of different aptamer sequences on the basis of the homologous repair template with the highest repair efficiency, and subsequent experiments find that the repair efficiency of the homologous repair template (donor DNA 40) is the highest, so that the repair efficiency of the donor DNA40 is compared with the repair template with the different aptamer sequences.

Specifically, based on a homologous repair template with highest repair efficiency, when comparing the repair efficiencies of different aptamer sequences, the Cas9 aptamer sequences used are respectively shown as SEQ ID NO.1 to SEQ ID NO.5, and the Cas9 aptamer sequences are connected in series to the 3 'end (donor DNA-aptamer) of the homologous repair template to obtain a 3' end tandem repair template (donor DNA 40-aptamer); cas9 aptamer sequence is connected in series to 5 'end (aptamer-donor DNA) of homologous repair template, and the sequence is synthesized in vitro and subjected to thio modification by obtaining 5' end series repair template (aptamer-donor DNA 40).

The structure of the Cas9 protein is shown in figures 3 and 4, and the Cas9 aptamer sequence has specific affinity with the Cas9 protein, so that the recombination efficiency of the homologous repair template is improved.

The homologous repair template (donor DNA 40) sequence without tandem Cas9 aptamer sequence is as follows:

wherein, the marked sequence of the single wavy line is a repair site, and the AAC base sequence is inserted.

The 3' -end tandem repair template (DNA 40-aptamer) sequence is as follows:

the sequence marked by a single straight line is a Cas9 aptamer sequence with specific affinity with Cas9 protein, and the sequence can improve the recombination efficiency of the repair template.

The marked sequence of the single wavy line is a repair site, and the AAC base sequence is inserted.

The sequence of the 5' -end tandem repair template (aptamer-donor DNA 40) is as follows:

In the above-mentioned donor DNA40, donor DNA40-aptamer, aptamer-donor DNA40, "+" means thio modification.

The homologous repair template (donor DNA 55) sequence without tandem Cas9 aptamer sequence is as follows:

5'-T a T CATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCA T C G-3' (SEQ ID No. 19), wherein "x" represents a thio modification.

The homologous repair template (donor DNA 70) sequence without tandem Cas9 aptamer sequence is as follows:

5' -T a C AACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTG C T G-3 (SEQ ID No. 20), wherein "x" represents a thio modification.

The method of ligating the aptamer with the pair of the donor DNA 55 and the donor DNA 70 was performed with reference to the donor DNA 40.

4. Cell transfection

37℃、5％CO ₂ 293-GFP (510_513del AAC) monoclonal cells were cultured under incubator conditions. The day before transfection, cells were counted and plated in 12 well plates to achieve a confluence of cell growth of 70-80% at the time of transfection.

A1.5 mL EP tube was taken, 1. Mu.g of CRISPR/Cas9 recombinant plasmid, 15pmol of repair template mixture, 2.5. Mu. L p3000 solution (p 3000 solution is a component of transfection kit (containing p3000 and lipo 3000) for auxiliary transfection) was added to 60. Mu.L of serum-free medium (i.e.cell culture medium in step 1, but without the addition of diabodies and serum) and gently mixed. mu.L of Lipofectamin3000 (available from Invitrogen, calif.) reagent was added to 60. Mu.L of serum-free medium. The diluted two-tube solution was gently mixed to form a plasmid/Lipofectamin complex. After 15 minutes at room temperature, the mixture was added to a 12-well plate and mixed with gentle shaking. The culture plate is placed in an incubator, the culture medium is replaced after 4-6 hours, the cells are observed under a microscope after 48 hours of culture, and the cells are collected after photographing, so that the next experiment is prepared.

5. Flow cytometry

After 48 hours of transfection, cells were washed once with PBS (phosphate buffer), collected by digestion with EDTA-free pancreatin, centrifuged at 1000rpm for 5min, and the supernatant was discarded. The cells were washed once with PBS solution, and the supernatant was discarded and the washing was repeated once more. Cells were resuspended using 500. Mu.L of PBS solution and analyzed for GFP fluorescence positivity using a flow cytometer (EPICS, XL-4, beckman, calif., USA). The fluorescence GFP positive rate of the cell can reflect the efficiency of homologous recombination repair of GFP genes, and the ratio of the fluorescence GFP positive rate of the cell relative to the fluorescence GFP positive rate of the cell of the donor DNA (40) template group without the tandem aptamer is expressed as a percentage by taking the fluorescence GFP positive rate of the cell of the donor DNA (40) template group without the tandem aptamer as a control, and is shown as the ordinate of the graph of FIG. 6, namely the relative repair efficiency (%) of GFP when the 3 'end and the 5' end of the donor DNA (40) template are respectively connected with different aptamers. The results showed that among the homologous repair templates, the donor DNA (40), the donor DNA (55) and the donor DNA (70), the repair efficiency of the donor DNA (40) template was higher (FIG. 5). As shown in FIG. 6, the repair efficiency of mutant GFP gene homologous recombination was significantly improved by the repair templates of the donor DNA (40) -aptamer and the aptamer-donor DNA (40) homology, compared to the repair efficiency of the donor DNA (40) template. Further, as shown in FIG. 6, the repair efficiencies of the different aptamer sequences shown in SEQ ID No.1 to SEQ ID No.5 were compared based on the homologous repair template donor DNA (40) with the highest repair efficiency, and aptamer1, aptamer2, aptamer3, aptamer4, and aptamer5 represent the aptamers shown in SEQ ID No.1 to SEQ ID No.5, respectively. It can be seen that the repair efficiency of the donor DNA (40) -aptamer1 is higher than that of the aptamer1-donor DNA (40), and the repair efficiency of the donor DNA (40) -aptamer1 and the repair efficiency of the aptamer1-donor DNA (40) are higher than that of other aptamer repair templates, which indicates that the repair efficiency of the aptamer shown in SEQ ID NO.1 is higher than that of other aptamers. As can also be seen from fig. 6, the same aptamer is attached to different ends of the homologous repair template, and the repair efficiencies are not the same; different aptamers are linked at the same end of the homologous repair template, and the repair efficiencies are also different.

In some embodiments, the invention discloses a method for improving the repair efficiency of homologous recombination in CRISPR/Cas9 gene editing, which is to connect in series a single-stranded DNA aptamer sequence with specific affinity with Cas9 protein at the 3 'end or the 5' end of a homologous repair template, and to transfect cells with the CRISPR/Cas9 system after connecting in series the repair template, so as to obviously improve the repair efficiency of homologous recombination in gene editing. The invention uses the tandem homologous repair template and CRISPR/Cas9 system to transfect cells together, which can obviously improve the homologous recombination repair efficiency of genes.

The foregoing description of the invention has been presented for purposes of illustration and description, and is not intended to be limiting. Several simple deductions, modifications or substitutions may also be made by a person skilled in the art to which the invention pertains, based on the idea of the invention.

SEQUENCE LISTING

<110> Shenzhen second people Hospital (Shenzhen conversion medical institute); shenzhen hospital of Beijing university

<120> a template molecule to which an aptamer is attached, and kit therefor

<130> 20I30727

<160> 22

<170> PatentIn version 3.3

<210> 1

<211> 42

<212> DNA

<213> artificial sequence

<400> 1

aacacgacac aagttcgaag gacgaacgtc atgcaagtgg gc 42

<210> 2

<211> 42

<212> DNA

<213> artificial sequence

<400> 2

aacacgactc cactgtgcgt cgcgaactct gccacggtcg tg 42

<210> 3

<211> 42

<212> DNA

<213> artificial sequence

<400> 3

aacacgacgc agctgtggcc agcgaactgt gtgggagtgg gc 42

<210> 4

<211> 42

<212> DNA

<213> artificial sequence

<400> 4

aagcccactg gtctgtggac aacgaacgcc ggtgtggtcg tg 42

<210> 5

<211> 42

<212> DNA

<213> artificial sequence

<400> 5

aacacgacgt gtctgtgaat cacacagtcc aacaatgtcg tg 42

<210> 6

<211> 42

<212> DNA

<213> artificial sequence

<400> 6

aacacgacgg cgctgtgccg gtcacagcgt gtggatgtgg gc 42

<210> 7

<211> 42

<212> DNA

<213> artificial sequence

<400> 7

aacacgacct ctctgtgaag gtcgaacgtc gtgctagtcg tg 42

<210> 8

<211> 42

<212> DNA

<213> artificial sequence

<400> 8

aacacgaccc cgctgtgatt cgcgaacaaa tagcgcgtcg tg 42

<210> 9

<211> 42

<212> DNA

<213> artificial sequence

<400> 9

aagcccacac gtctgtgaga ggcgaacata tgcatggtcg tg 42

<210> 10

<211> 42

<212> DNA

<213> artificial sequence

<400> 10

aacacgacac tcgttcgcgc accacagcgc gttgtcgtcg tg 42

<210> 11

<211> 42

<212> DNA

<213> artificial sequence

<400> 11

aacacgactc cactgtgcct ctcgaaccat gagcctgtcg tg 42

<210> 12

<211> 42

<212> DNA

<213> artificial sequence

<400> 12

aacacgacgg aactgtgcgt cgcacaggcc gctggtgtcg tg 42

<210> 13

<211> 42

<212> DNA

<213> artificial sequence

<400> 13

aagcccacat gcctgtgctt cgcacagcgc atcacggtcg tg 42

<210> 14

<211> 42

<212> DNA

<213> artificial sequence

<400> 14

aacacgacgc cactgtgaac aacgaaccca tcgccagtgg gc 42

<210> 15

<211> 42

<212> DNA

<213> artificial sequence

<400> 15

aagcccacag ccctgtgctt ctcacaggga tccatagtgg gc 42

<210> 16

<211> 735

<212> DNA

<213> artificial sequence

<400> 16

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac atcgaggacg gcagcgtgca gctcgccgac 540

cactaccagc agaacacccc catcggcgac ggccccgtgc tgctgcccga caaccactac 600

ctgagcaccc agtccgccct gagcaaagac cccaacgaga agcgcgatca catggtcctg 660

ctggagttcg tgaccgccgc cgggatcact ctcggcatgg acgagctgta caagtccgga 720

ctcagatctc gataa 735

<210> 17

<211> 20

<212> DNA

<213> artificial sequence

<400> 17

gatgccgttc ttctgcttgt 20

<210> 18

<211> 83

<212> DNA

<213> artificial sequence

<400> 18

gcagaagaac ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt 60

gcagctcgcc gaccactacc agc 83

<210> 19

<211> 113

<212> DNA

<213> artificial sequence

<400> 19

tatcatggcc gacaagcaga agaacggcat caaggtgaac ttcaagatcc gccacaacat 60

cgaggacggc agcgtgcagc tcgccgacca ctaccagcag aacaccccca tcg 113

<210> 20

<211> 153

<212> DNA

<213> artificial sequence

<400> 20

tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 60

ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 120

aacaccccca tcggcgacgg ccccgtgctg ctg 153

<210> 21

<211> 18

<212> DNA

<213> artificial sequence

<400> 21

gacgacggca actacaag 18

<210> 22

<211> 18

<212> DNA

<213> artificial sequence

<400> 22

tccatgccga gagtgatc 18

Claims

1. A template molecule linked to an aptamer, characterized in that the 3 'end and/or the 5' end of the template molecule is in tandem with an aptamer having a specific affinity with a targeted gene editing protein;

the aptamer is a nucleotide sequence shown as SEQ ID NO. 1.

2. The template molecule of claim 1, wherein the template molecule is a single-stranded DNA template molecule.

3. The template molecule of claim 2, wherein the template molecule is selected from the group consisting of homologous repair templates; the homologous repair template sequentially comprises an upstream homology arm, an exogenous DNA molecule and a downstream homology arm.

4. The template molecule of claim 3, wherein the length of the upstream homology arm and the downstream homology arm of the repair site of the homologous repair template is equal to or greater than 30 nt.

5. The template molecule of claim 1, wherein the targeted gene editing protein is selected from at least one of a CRISPR protein, a TALEN protein, a ZFN protein, or derivatives thereof.

6. The template molecule of claim 5, wherein the CRISPR protein is selected from at least one of Cas9, cas9 derivatives, cpf 1.

7. The template molecule of claim 6, wherein the Cas9 is selected from at least one of streptococcus pyogenes Cas9, streptococcus thermophilus Cas9, cas9 from neisseria meningitidis serogroup a/serotype 4A, staphylococcus aureus Cas 9.

8. A kit comprising the template molecule of any one of claims 1-7.

9. The kit of claim 8, further comprising sgrnas designed for a target sequence;

the sgRNA contains a base sequence complementarily paired with the target sequence or its complement.

10. The kit of claim 8, further comprising a targeted gene-editing protein.

11. The kit of claim 10, wherein the targeted gene editing protein is selected from at least one of CRISPR proteins, TALEN proteins, ZFN proteins, or derivatives thereof.

12. The kit of claim 8, further comprising a gene editing system.

13. The kit of claim 8, further comprising a container for separately storing each component.

14. The kit of claim 8, further comprising instructions for directing a user to use the kit.

15. A targeted gene editing method, comprising: co-transfecting a gene editing system and the template molecule according to any one of claims 1-7 to a transfection vector to obtain a target product, wherein an aptamer with specific affinity with a targeted gene editing protein is connected in series at the 3 'end and/or the 5' end of the template molecule.

16. The targeted gene editing method of claim 15, wherein the transfection vector is selected from at least one of a cell and an animal.