CN106318969A - 3T super-virus carrier for wheat transformation, and preparation method and application of 3T super-virus carrier - Google Patents

Abstract

The invention relates to a 3T super-virus carrier for wheat transformation, and a preparation method and application of the 3T super-virus carrier. The 3T super-virus carrier for the wheat transformation has a structure as shown in figure 1, and has a sequence as shown in SEQ ID No. 2. The carrier takes p1011-V as a framework, and is obtained by inserting new T regions into Sac II restriction enzyme cutting sites. The 3T super-virus carrier is a plant expression vector which contains three sections of T regions and has a section of super-virus genes G capable of promoting agrobacterium-mediated transformation. According to the 3T super-virus carrier, a plurality of genes can be connected in the different T regions, and the plurality of genes can be inserted into different positions through the same carrier, so that the probability of gene expression silencing, caused by a gene position effect, of exogenous genes of a transgenic plant is greatly reduced, and the influence on the polygene controlled trait is also greatly reduced; furthermore, selectable marker genes and target genes are stored in the different T regions, so that the separation of the selectable marker genes and the target genes is realized in an insertion process of the exogenous gene.

Description

A kind of Wheat Transformation 3T surpasses poisonous carrier and its preparation method and application

Technical field

The invention belongs to field of crop genetic breeding, be specifically related to a kind of Wheat Transformation three T and surpass poisonous carrier and preparation side thereof Method and application.

Background technology

1. the breeding objective of Semen Tritici aestivi

Semen Tritici aestivi (Triticum aestivum) is one of world's staple food crop, and its yield and quality is related to society Economic life.Along with population increases and the development of national economy, more grain is needed to meet the life requirement of people.But Soil erosion causes farmland constantly to be reduced and global warming makes grain yield in recent years increase and inconspicuous.According to phase Close data analysis, analyze global yield of wheat in recent years, find that yield of wheat is unstable, and amplification is less, the volume increase of Semen Tritici aestivi Have become as one of problem of concern.

In the face of the biggest challenge, any method that can improve grain yield is all worth utilizing.For cereal crops Breed improvement, people mainly take the mode of traditional breeding method and transgenic.Both essential distinctions are: the former is hybridized by emasculation Promoting the variation of parental gene group, the later stage, with merit as index, utilizes field test, screening to obtain required merit Wheat breed.Transgenic technology is utilized to cause plant gene directed variation and produce merit, compared to conventional hybridization breeding, Transgenic technology can break reproduction isolation, expands the scope of plant gene variation further.Plant tissue culture is that Semen Tritici aestivi turns base Because of the key of technology, traditional breeding method is carried out under field conditions (factors), so cycle length, climate environmental effect are big.Transgenic technology Utilizing tissue culture, whole process can be carried out at incubator and greenhouse, is prevented effectively from the impact of environmental factors.Transgenic technology master Including: gene clone, genes of interest Function Identification, genes of interest insert Plant Genome and obtain kind by Physiological Appraisal Improvement commercially valuable plant.Plant Genome inserts the method for exogenous gene particle bombardment and Agrobacterium-mediated Transformation method With pollen tube passage method etc..

2. Wheat Transformation method

Semen Tritici aestivi is allohexaploid plant, genome is big, gene regulation is difficult, the wound healing that the outer implant of Semen Tritici aestivi is induced simultaneously Tissue generally exists that wound healing embryo is poor, differentiation rate is low, converts the problems such as cell regeneration difficulty, is universally acknowledged to be most difficult to conversion Raise crop.Scientist realizes the conversion to Semen Tritici aestivi by various methods, but current topmost Wheat Transformation technology is gene Marksmanship and agriculture bacillus mediated.The first in the world strain transgenic wheat is that Vasil passed through particle bombardment by gus, bar gene in 1992 Import wheat breed Pavon.Within 1997, Cheng utilizes agrobacterium-mediated transformation that GUS and npt II has been proceeded to Semen Tritici aestivi first.Except Particle gun and agrobacterium-mediated transformation, pollen tube passage method, microinjection, Laser microbeam puncture, PEG method and electric shocking method etc. are also Receive more and more attention.

3, agriculture bacillus mediated principle

Agrobacterium has natural gene conversion system, is existence gram negative bacteria in soil, including crown gall agriculture bar Bacterium (Agrobacterium tumefaciens) and Agrobacterium rhizogenes (Agrobacterium rhizogenes).Root of hair agriculture bar Containing Ri plasmid in bacterium, injury can be caused to produce hair-like.Current agriculture bacillus mediated mainly utilize Agrobacterium tumefaciems, Agrobacterium tumefaciems contains the Ti-plasmids that can induce crown gall nodule, and plasmid is mainly by transferable T district, virulent gene and crown gall alkali metabolism Gene coding region.T district is mainly characterized by the repetitive sequence that the right and left is a length of 25bp respectively, is that synthesis is raw in right boundary The gene that long hormone, the basic element of cell division are relevant with crown gall alkali.Virulent gene be multistage virulent gene composition: VirA, VirB, VirC, VirD etc..Under natural endowment, dicotyledonous plant cells can produce aldehydes matter after coming to harm, on the one hand induction agriculture bar Bacterium attached plant cell surface；On the other hand induce the gene expression of Vir district together with the monosaccharide of plant cell wall surface, by with VirA protein-interacting (Toyoda-Yamamoto et al., 2000), activates virA albumen, has cross-film histidine protein By virG protein activation after the virA autophosphorylation of kinase function, the virG of phosphorylation activates vir district as transcription regulatory factor The isogenic expression of virB, virC, virD, virE.VirD1 is topoisomerase albumen, and DNA structure can be made to become lax. VirD1 albumen identification and be combined at the right boundary of T-DNA, has specific cleavage single stranded DNA restriction endonuclease effect VirD2, will cut at T-DNA right margin.With the help of DNA untwists acid, virD2 albumen holds covalent bond with the 5 ' of T mono-chain, Avoid T-DNA by Exonucleolytic enzymatic degradation.Single-stranded template is replicated the T-DNA that synthesis is new, new chain generation by DNA replication dna enzyme from right to left For old chain, old chain is released (Dombek et al., 1997).For preventing T-DNA not by intracellular nuclease degradation, VirE2 albumen is combined formation T-complex with free nucleic acid-protein complex.It is made up of virB albumen on plant cell wall Passage helps T-complex to pass cell wall and the cell membrane of Agrobacterium.After the nuclear localization signal of virD2 and virE2 is identified, T-complex enters nucleus and is integrated in Plant Genome.

4, agrobacterium mediation converted method development:

Agriculture bacillus mediated principle studied clear after, increasing unifacial leaf obtains transgenic by Agrobacterium-mediated Transformation Seedling.Agrobacterium-mediated Transformation Mature Embryos of Rice induction wound healing (Hieietal., 1994), maize transformation rataria (Ishidaetal., 1996) the callus ratio, infected is between 1 to 30%.1984, the test of Shaw etc. showed, Agrobacterium is to phenols Compound has chemotaxis, and this chemotaxis depends on virA and virG gene.Potrykus (1990) mentions frumentum and plants The main cause that thing is difficult to convert is not as itself not being dicotyledonous, and is because them and can not produce phenols chemical substance work For signaling molecule.But about 1996, east sunshine and Li Baojian are by studying Oryza sativa L. signaling molecule, propose monocotyledon natural Can not be infected by Agrobacterium under state, be not as producing phenols inductive substance, and be because monocotyledon and only giving birth to Certain stage specific part in growth process produces aldehydes matter.Researcher individually adds acetosyringone by conversion process Substantially increase transformation efficiency, but be successfully obtained transgenic seedling and also need to the cell that regeneration capacity is strong.Within 1987, christy sends out When existing plant cell is cultivated in vitro, the wound healing of induction is divided into 3 classes, and wherein the regeneration capacity of embryo callus is the strongest, and Embryo callus is prone to preserve for a long time.Hieietal. (1994) and Ishidaetal (1996) refer not only to out have and divide more by force The cell of change ability and regeneration capacity is the key of Agrobacterium-mediated Transformation, proposes the composition of culture medium, carrier, Agrobacterium spy simultaneously Property, the genotype of selection markers and plant all Agrobacterium-mediated Transformation is produced impact.

5. agrobacterium strains and carrier

The natural host of Agrobacterium is dicotyledon, so overwhelming majority agrobacterium strains, carrier and marker gene are For dicotyledon.Most Agrobacterium is infected for dicotyledon, and a part of bacterial strain of minority had both been suitable for dicotyledonous Can be used for again unifacial leaf to convert: the receptor scope of LBA4404 bacterial strain and A281 bacterial strain is wide and transformation efficiency is high (Komari, 1989).Oryza sativa L. Agrobacterium-mediated Transformation in early days, Hiei is successful with LBA4404 and EHA101 rice transformation in 1994；2014 Ishida EHA101 and EHA105 transformed wheat；Within 2008, Hensel finds higher than LBA4404 at Fructus Hordei Vulgaris AGL1 conversion ratio.

The selection of agrobacterium strains, except transformation efficiency to be considered, also to pay attention to the shadow growing plant cell growth Ring.The RNAi carrier of HCP1 is imported in wheat leaf blade cell by EHA105, LBA4404 and C58C1 in 2015 by Liu Peng etc., profit Use Rohringer staining analysis, analyze the Agrobacterium ability to Infectikon, select the suitableeest to infect bacterial strain.Rohringer contaminates The blade that the different agrobacterium strains of color result display infected, EHA105 infect after to the injury of plant cell than other two kinds of bacterium Strain is obvious, illustrates that EHA105 has relatively high toxicity, can cause receptor defense response.C58C1 bacterial strain not only has higher purpose Gene expression efficiency, and less to the toxicity of blade, and all C58C1 that choose are as the suitableeest test strain.Along with people are to T The research of district's transforming principle, Someya in 2013 finds in Agrobacterium that the expression of 1-aminocyclopropane-1-carboxylic acid deaminase can reduce and plants Thing cell produces ethylene thus improves T district and convert.It is worth mentioning that bacterial concentration when Agrobacterium is infected and co-culture the time Also it is the aspect that should be noted that during Wheat Transformation.

Same for unifacial leaf Agrobacterium-mediated Transformation, the carrier of conversion improves the most accordingly.The Agrobacterium of A281 has very Strong infection ability, people clone a part for virulent gene from A281 and are building up to conversion carrier obtain and have higher turn " super binary vector " (the Komari et al., 1996) of change power.Ishida will be containing " super binary vector " in 2007 LBA4404 maize transformation, and succeed.

6. homologous recombination method

People mainly utilize enzyme action interconnection technique to realize the structure of carrier in early days, and this process to experience repeatedly purpose fragment PCR amplification, restricted enzyme select the problems such as limited, digesting efficiency is low, so increasing researcher begins look for newly The approach of carrier construction.Homologous recombination is paid close attention to widely in the use of vector construction, and under natural conditions, homologous recombination is sent out Raw at meiosis tetrad, contain the DNA fragmentation cross exchanged of homologous sequence between non sister chromatid, it is achieved base Restructuring because of level.External homologous recombination adds about 15bp homologous sequence mainly by purpose fragment two ends, at RecA and With linearizing carrier generation homologous recombination (Dubin et al., 2004) under the effect of the protein such as RecB, RecC, RecD. This technology only needs a PCR amplification, directly uses PCR primer to recombinate, is greatly reduced probability and the amplification of gene mutation The use of enzyme；Endonuclease reaction has only to carry out for carrier, does not improves digesting efficiency merely with single endonuclease digestion, reduces non-specific Section, eliminates the restriction that restricted enzyme is selected by genes of interest simultaneously.The strategy of this carrier construction, overcomes tradition enzyme action The shortcomings such as the efficiency connected is low, expense is high, improve the success rate (horse is the bravest, 1996) of vector construction greatly.

Summary of the invention

There is genes of interest be inserted into by internal to solve current Semen Tritici aestivi Agrobacterium-mediated Transformation, silenced gene expression and Traits of Wheat is improved the problems such as inconspicuous by individual gene, and the present invention is by the existing carrier for Efficiency of Wheat Transformation and use Surpass poisonous carrier in double T of rice transformation and carry out carrier by homologous recombination (Homologous Recombination) technology Transformation, constructs a new carrier, has polygenes, many sites, the feature that once converts.This carrier is used to carry out once Efficiency of Wheat Transformation, can insert multiple genes of interest transgenic wheats obtaining, can not only realize riddled basins and mesh The separation of gene, can utilize once to convert simultaneously and insert multiple genes of interest at Semen Tritici aestivi diverse location.

Wheat Transformation 3T of the present invention surpasses poisonous carrier 3T-v, and its structure is as it is shown in figure 1, its sequence such as SEQ ID NO.2.Described 3T-v is with p1011-V as skeleton, inserts the new T district containing available multiple clone site at SacII restriction enzyme site Obtain, it is thus achieved that for the super poisonous carrier 1 containing three sections of T-DNA of wheat transgenic.

The Wheat Transformation carrier that the present invention is obtained, inserts not respectively not only by selection markers and genes of interest In same T-DNA, successfully get rid of the Transgene-safty problem that selection markers is brought.Simultaneously this carrier contain three sections transferable The T district of gene, wherein one section has connected hygromycin selection gene, and additionally available multiple clone site is all contained in Liang Duan T district, can divide Do not insert multiple exogenous gene, greatly expand carrier attachable genes of interest number, the simultaneously exogenous gene in difference T district and insert Entering the diverse location in acceptor gene group, very big reduction exogenous gene causes exogenous gene expression silence due to position effect Probability and the problem such as controlled by multiple genes trait expression is inconspicuous.3T-v carrier contains virulent gene G, can promote Agrobacterium Transformed wheat.

Accompanying drawing explanation

Fig. 1 3T surpasses poisonous carrier structure chart.

Fig. 2 P1011-V T district clones

M:Marker2504；The T district fragment of 1 to 4:T district clone.

Fig. 3 synthesizes the 3rd section of T district and P1011-V former T district's comparison.

Fig. 4 3T-V bacterium colony PCR

M:Marker2504；The PCR in the 3rd section of T district of 1 to 4:3T-v identifies.

Fig. 5 connects callus GUS dyeing after the 3T-V transformed wheat of GUS and GFP

A:(3T-v) the WHEAT CALLUS GUS dyeing that+GUS+GFP Agrobacterium is infected

The WHEAT CALLUS GUS dyeing that B:P1011-V Agrobacterium is infected.

Fig. 6 connects callus GFP Fluirescence observation after the 3T-V transformed wheat of GUS and GFP

A: (3T-V)+GUS+GFP transformed calli under white light source；B: the callus of exciting light figure below A；

C: P1011-V transformed calli under white light source；D: the callus of exciting light figure below C.

Detailed description of the invention

Embodiment 1:

One, experiment material

Double T surpass poisonous carrier p1011-V (CN104388462A), new polyclone fragment (Hua Da gene chemical synthesis), DH5 α large intestine Bacillus competence, homologous recombination enzyme: CloneExpress^TMII one step cloning kit (Vazyme company).

Two, the extraction of plasmid DNA

(1) the positive bacterium colony in picking experimentation is inoculated in the 2ml LB fluid medium containing kanamycin respectively In, 37 DEG C are shaken bacterium 12～16h.

(2) column equilibration step: the balance liquid BL, 12000rpm that add 500ul in adsorption column CP3 are centrifuged 1min, outwell Waste liquid in collecting pipe, places back in adsorption column in collecting pipe

(3) taking 1-5ml bacterium solution, add in centrifuge tube, 4 DEG C, 12000rpm is centrifuged 1min, absorbs supernatant as far as possible.

(4) in the centrifuge tube leave bacterial sediment, add 250ul solution P1, use the thorough suspension bacteria liquid of pipettor.

(5) in centrifuge tube, add 250ul solution P2, leniently spin upside down 6-8 time and make thalline fully crack.

(6) in centrifuge tube, add 350ul solution P3, the most leniently spin upside down 6-8 time, fully mix, now go out Existing white flock precipitate.12000rpm is centrifuged 10min.

(7) taking supernatant and transfer in adsorption column CP3, sucking-off precipitation of trying not, 12000rpm is centrifuged 1min, outwells receipts Waste liquid in collector, puts into adsorption column CP3 in collecting pipe.

(8) adding 600ul rinsing liquid PW in adsorption column CP3,12000rpm is centrifuged 1min, outwells giving up in collecting pipe Liquid, puts into adsorption column CP3 in collecting pipe.

(9) repetitive operation step 8.

(10) putting in collecting pipe by adsorption column CP3,12000rpm is centrifuged 2min, is gone by rinsing liquid remaining in adsorption column Remove.

(12) adsorption column CP3 is placed in a clean centrifuge tube, drips 50-100ul to the middle part of adsorbed film Elution buffer EB, room temperature is placed 2min, 12000rpm and is centrifuged 2min, collected by plasmid solution in the centrifuge tube of 1.5ml.

Three, analytical sequence, designs homologous primer

According to p1011-V carrier design cloning primer:

3T-2T-Clone-F5:CATTTGTATGTGGGCCGCG(SEQ ID NO.3)、3T-2T-Clone-R5: ATAGCAGCGGAGGGGTTGG (SEQ ID NO.4), its amplification length from p1011-v is the carrier of 3344bp, and its sequence is such as Shown in SEQ ID NO.5.

Analyze according to self restriction enzyme site of p1011-V carrier, select available multiple clone site that new T district contains (MluI, SacI, SmaI), and the sequence of carrier homologous sequence (new MCS) is added at multiple clone site two ends:

TGAACGATCGGGGAAATTCGACGCGTCCGCGGCCCGGGCTCTAGAGTCGACCTGCAGA(SEQ ID NO.6), fragment is by Hua Da gene chemical synthesis；

According to the requirement of homologous recombination technique, the sequence for carrier and two ends, newly synthesized T district separately designs primer.Clone Primer: homology+new T district-F1:GAGCCGATTTTGAAATGGCAGGATATATTGTGG (SEQ ID NO.7)

Homology+new T district-R1:TGCTGCCTGTGATCAGTTTACCCGCC (SEQ ID NO.8)

Its intermediate carrier amplification from building process obtains the fragment (newly synthesized T district) that new T section length is 2888bp, its Sequence is as shown in SEQ ID NO.1.

Three, PCR extension and homologous recombination

(1). the synthesis of new T district

1, PCR amplification:

Use Phanta^TMSuper Fidelity DNA Polymerase (Vazyme, P501-01), 3T-2T-Clone- F5,3T-2T-Clone-R5 are primer, expand the former T district fragment of 3344bp from plasmid p1011-V, and it expands post-fragment sequence Such as SEQ ID NO.5, electrophoretogram is shown in Fig. 2, connects T-Vector pMDTM19 (Simple), it is thus achieved that P19S-T matter after glue recovery Grain.Its amplification system and amplification program are shown in Tables 1 and 2.

Table 1 former T district PCR reaction system

Table 2 former T district PCR response procedures

2, homologous recombination:

Homologous recombination reaction system is prepared according to table 3,37 DEG C, 30 minutes.It is subsequently placed in ice-water bath 5 minutes.Convert sense By state bacillus coli DH 5 alpha, whole coated plates after bacterium solution centrifugal concentrating.In 37 DEG C of incubators, it is inverted overnight incubation.Choose 23 single bacterium Fall and be dissolved in respectively in 20 μ l LB culture fluid, respectively take the template that 1 μ l bacterium solution is identified as bacterium colony PCR, the program that bacterium colony PCR identifies With table 2, identify that the positive bacterium solution obtained is exactly the bacterium solution containing newly synthesized T district plasmid, new T district and the former T district sequence of p1011-V Fig. 3 is shown in row comparison, extracts plasmid and obtains P19S-3T.

Table 3 new T district homologous recombination system

(2) .3T surpasses poisonous carrier (3T-v) synthesis

1, PCR amplification:

With PhantaTM Super Fidelity DNA Polymerase (Vazyme, P501-01), homology+new T district- F1, homology+new T district-R1 is that primer obtains new T district fragment from P19S-3T amplification, and glue reclaims standby.Its amplification system and amplification Program reference table (PRT) 4 and table 5.

Table 4 expands the PCR reaction system in new T district from P19S-3T

Table 5 expands the PCR response procedures in new T district from P19S-3T

2, homologous recombination:

Homologous recombination reaction system is prepared with reference to table 6,37 DEG C, 30 minutes.It is subsequently placed in ice-water bath 5 minutes.Convert sense By state bacillus coli DH 5 alpha, whole coated plates after bacterium solution centrifugal concentrating.In 37 DEG C of incubators, it is inverted overnight incubation.Choose 23 single bacterium Fall and be dissolved in respectively in 20 μ l LB culture fluid, respectively take the template that 1 μ l bacterium solution is identified as bacterium colony PCR, the program that bacterium colony PCR identifies With table 4, table 5, identify that the positive bacterium solution obtained is exactly the bacterium solution containing newly synthesized T district plasmid, extract plasmid and obtain 3T-v load Body, 3T-V bacterium colony PCR is shown in Fig. 4.Obtained 3T-v carrier structure such as Fig. 1, its sequence such as SEQ ID NO.2.

Table 6 3T-v homologous recombination system

Wherein, preparation and the conversion of the competence DH5 α used in step 3 are as follows:

Calcium Chloride Method prepares competent cell (Bio Basic, No.BS525)

(1) take a small amount of frozen strain Escherichia coli (E.coli) DH5 α, LB plating medium is carried out streak culture, permanent Temperature incubator (37 DEG C) is cultivated 16～20h.

(2) one single bacterium colony of picking, is inoculated in containing in 2ml SOB culture fluid, on constant-temperature table (37 DEG C, 250rpm/min) Cultivate 12～16h.

(3) culture of inoculation 1ml is to (including 100ml SOC culture fluid) in 500ml conical flask, constant-temperature table (37 DEG C, 250rpm/min) above cultivate to OD600 ≈ 0.35.

(4) culture being placed in rapidly 20min in ice bath, period slowly shakes up and makes the full and uniform cooling of content.Simultaneously 2 50ml centrifuge tubes are placed in pre-cooling on ice, prepare for next step.

(5) being transferred in the centrifuge tube of pre-cooling by antibacterial, 4 DEG C, 4000rpm is centrifuged 15min, supernatant discarded.

(6) with the suspended bacterial that the solution A of 16ml is careful, 15min is placed on ice.

(7) 4 DEG C, 4000rpm is centrifuged 15min, collects thalline.

(8) with 4ml solution B Eddy diffusion antibacterial, subpackage, 80 μ l/ pipes, liquid nitrogen flash freezer ,-70 DEG C of preservations.

(9), when being used for converting, 100pg to 10ng DNA is added in competent cell (dissolving on ice).

(10) cell and DNA mixture place 30min on ice, then cultivate 5min or 42 DEG C of cultivation 90s, the most again for 37 DEG C Secondary place 2min on ice.

(11) 1ml SOC culture medium, 37 DEG C of gentle wave and culture 1h are added.

(12) 12～16h are cultivated during cell, constant incubator (37 DEG C) are cultivated in coating on selective medium.

Embodiment 2: the application of carrier of the present invention

One, experiment material

PEGAD and pFGUS3 (buying in China plasmid vector strain cell pnca gene preservation center), 3T-v, escherichia coli DH5 α, Agrobacterium EHA105, homologous recombination enzyme: CloneExpressTM II one step cloning kit (Vazyme company)

Two, PCR expands GUS and GFP gene

Use homology GFP-F2:CAGGTCGACTCTAGAGGATCCATGGTGAGCAAGGGCGAGG (SEQ ID NO.11), homology GFP-R2:TACTAGTCGACGTCAGGATCCTCAGGCCGCTGCCGCA (SEQ ID NO.12)；Homology GUS-F2:

GACTCTAGACCCGGGCCGCGGATGGTAGATCTGAGGGTAAA (SEQ ID NO.13), homology

GUS-R2:GGGAAATTCACGCGTCCGCGGTCACACGTGGTGGTGG (SEQ ID NO.14) is respectively from pEGAD The GFP (SEQ ID NO.9) and GUS (SEQ ID NO.10) containing carrier homologous sequence in two ends is amplified respectively with pFGUS3.

Three, homologous recombination

Use GUS and GFP that homologous sequence is contained at two ends, respectively at 3T-v carrier homologous recombination, the system of homologous recombination With reference to table 6.37 DEG C, 30 minutes.It is subsequently placed in ice-water bath 5 minutes.Transformed competence colibacillus bacillus coli DH 5 alpha, bacterium solution centrifugal concentrating Rear all coated plates.In 37 DEG C of incubators, it is inverted overnight incubation.Choose 23 single bacterium colonies to be dissolved in respectively in 20 μ l LB culture fluid, respectively take The template that 1 μ l bacterium solution is identified as bacterium colony PCR, the program that bacterium colony PCR identifies, with table 4 and table 5, just identifies the positive bacterium solution obtained It is the bacterium solution of 3T-v plasmid containing GUS and GFP, extracts plasmid.

Four, the preparation of Agrobacterium EHA105 competence and Plastid transformation Agrobacterium

1, prepared by Agrobacterium competence:

(1) picking list bacterium colony, is inoculated in 5ml LB fluid medium, 28 DEG C, and 200rpm cultivates 16h；

(2) amplification culture is in 50ml LB fluid medium, 28 DEG C, and 200rpm cultivates to OD600=0.4-0.6 (about 6h)；

(3) 50ml centrifuge tube ice bath 30min, 4 DEG C, 5000rpm is centrifuged 5min, reclaims cell, outwells supernatant gently；

(4) TE of 5ml pre-cooling is resuspended, 4 DEG C, and 5000rpm is centrifuged 5min, reclaims cell, outwells supernatant gently；

(5) fresh for 5ml liquid LB is resuspended；

(6) 200 μ l often pipe subpackages, if using the most immediately, liquid nitrogen flash freezer 1min ,-70 DEG C of Refrigerator stores.

2: Plastid transformation Agrobacterium

(1) take competence agrobatcerium cell 200 μ l, add plasmid 2-5 μ l；

(2) 10min on ice；

(3) liquid nitrogen 10min；

(4) 37 DEG C, 10min, 300rpm (prepare) in advance；

(5) 800 μ l LB fluid mediums are added, 28 DEG C, 3h, 350rpm；

(6) 6000rpm is centrifuged, and sucks supernatant 800 μ l, coated plate；

(7) 28 DEG C, cultivate 48h；

(8) picking transformant, extracts plasmid, carries out PCR qualification by homology GUS-F2/R2, homology GFP-F2/R2, identifies For the positive conversion that can be directly used for Semen Tritici aestivi.

Five, Wheat Transformation by Agrobacterium tumefaciens callus and GUS and GFP identify:

The value cultivated by Agrobacterium containing plasmid 3T-v+GUS+GFP to OD600, in the concentration of 0.5, and is cultivated 10 days The callus raising wheat 14 mature embryo co-cultures 30min.

GUS dyes: WHEAT CALLUS 300, negative control callus 300 and X-Gluc staining reaction after conversion Liquid (0.5mM K4 [Fe (CN) 6；50mM NaH2PO4, PH7.0], 20% methanol, 0.1%Triton X-100,0.5mg/ml X-Gluc [X-glucuronide]) after 37 DEG C of incubated overnight, observe (Fig. 5) with 75% ethanol decolorization；GFP: use fluorescence to show Callus to be identified, the negative callus of all conversions are observed by micro mirror.(Fig. 6).

Claims (4)

1. Wheat Transformation 3T surpasses a poisonous carrier, and its sequence is as shown in SEQ ID NO.2.

2. the Wheat Transformation 3T described in claim 1 surpasses poisonous carrier, it is characterised in that be with p1011-V as skeleton, at SacII Inserting new T district at restriction enzyme site and obtain, the sequence in described new T district is as shown in SEQ ID NO.1.

3. Wheat Transformation 3T described in a claim 1 surpasses the construction method of poisonous carrier, it is characterised in that be to be with p1011-V Skeleton, inserts new T district at SacII restriction enzyme site and obtains, and the sequence in described new T district is as shown in SEQ ID NO.1.

4. the Wheat Transformation 3T described in claim 1 surpasses poisonous carrier application in Wheat Transformation, it is characterized in that obtaining and expresses GUS WHEAT CALLUS with GFP reporter gene.