CN106317227B - Affinity ligand, construction method, affinity chromatography medium, preparation method and application - Google Patents
Affinity ligand, construction method, affinity chromatography medium, preparation method and application Download PDFInfo
- Publication number
- CN106317227B CN106317227B CN201610749025.0A CN201610749025A CN106317227B CN 106317227 B CN106317227 B CN 106317227B CN 201610749025 A CN201610749025 A CN 201610749025A CN 106317227 B CN106317227 B CN 106317227B
- Authority
- CN
- China
- Prior art keywords
- affinity
- terminal
- segment
- affinity ligand
- natural
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D15/00—Separating processes involving the treatment of liquids with solid sorbents; Apparatus therefor
- B01D15/08—Selective adsorption, e.g. chromatography
- B01D15/26—Selective adsorption, e.g. chromatography characterised by the separation mechanism
- B01D15/38—Selective adsorption, e.g. chromatography characterised by the separation mechanism involving specific interaction not covered by one or more of groups B01D15/265 - B01D15/36
- B01D15/3804—Affinity chromatography
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
- B01J20/00—Solid sorbent compositions or filter aid compositions; Sorbents for chromatography; Processes for preparing, regenerating or reactivating thereof
- B01J20/22—Solid sorbent compositions or filter aid compositions; Sorbents for chromatography; Processes for preparing, regenerating or reactivating thereof comprising organic material
- B01J20/24—Naturally occurring macromolecular compounds, e.g. humic acids or their derivatives
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
- B01J20/00—Solid sorbent compositions or filter aid compositions; Sorbents for chromatography; Processes for preparing, regenerating or reactivating thereof
- B01J20/30—Processes for preparing, regenerating, or reactivating
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/14—Extraction; Separation; Purification
- C07K1/16—Extraction; Separation; Purification by chromatography
- C07K1/22—Affinity chromatography or related techniques based upon selective absorption processes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
Abstract
The present invention provides affinity ligand, construction method, affinity chromatography medium, preparation method and application, wherein the building of affinity ligand is to NpuDnaE-N, i.e. INStructure be transformed on the basis of carry out；Wherein, INC-terminal add a cysteine, for chromatography microballoon covalent bond；Natural INN-terminal first place amino acid introduce mutation Cys1Ala, avoid the generation of N-terminal cleavage reaction；His-tag is placed in INThe N-terminal of segment, for purifying ligand fragment.The present invention is completed by the cleavage reaction of intein itself, had not only been reduced cost but also can have been prevented the pollution to target protein；The fracture rate of 3h is still very high under the conditions of the present invention is existing for the reducing agent, also, the affinity purification medium that the present invention constructs has preferable purification effect and higher recycling rate of waterused.
Description
Technical field
The invention belongs to protein purification arts, are related to a kind of modified end NpuDnaE-N montage structural domain (IN) formed
Affinity ligand, and be situated between by the chromatography that its C-terminal and chromatography microballoon covalent cross-linking construct a kind of novel protein affinity purification
Matter.Target protein need to only be implemented in I on a molecular scaleCC-terminal and and ICAmalgamation and expression passes through I in vitroCWith INIt is affine
In conjunction with and control condition inductive cleavage, the purifying of destination protein can be realized.
Background technique
The application of purification tag greatly simplifies the process of recombinant protein purification, and having for modern biotechnology can not
The application value of appraisal.But the affinity purification label introduced in target protein has to pass through protease hydrolytic or chemical cracking
The processing of reagent could remove.Therefore, in large-scale production, removing purification tag problem restricts answering extensively for purification tag
With.This to solve the problems, such as, people, which have invented, includes peptide-mediated spontaneous disruption purification tag without using protease.
Intein (also known as protein intron, intein) is the segment polypeptide chain in precursor immature albumen, it passes through
A series of reaction process of self catalysis such as rearrangements, transesterification, cyclisation, can cut off and the albumen at both ends is more from precursor protein
Peptide chain (extein, extein) passes through a native peptides key connection.Being broken intein is the N-terminal region (I in structureN)
With C-terminal region (IC) a kind of intein for being separated from each other.Work as INAnd ICTwo segment connections can include after restoring structure according to standard
The splicing of peptide montage approach completion both ends extein.The montage activity for being broken intein is to pass through INAnd ICAffine combination and produce
Raw, the two has the extremely strong ability of being mutually distinguishable, this is the basis that intein is applied to affinity purification system.
In general, the spontaneous end carry out N-/C- cleavage reaction under the conditions of intein can be existing for the reducing agent, by one end
Target protein is cut down.Due to this series of reaction can in vitro, do not need the spontaneous progress of effect of enzyme, benefit
Protein expression is carried out with fracture intein approach to purify, and removes purifying mark while capable of removing purifying while effective purifying
Label.
Although fracture intein be in terms of protein purification be worth affirmative, in its application process there is also it is some not
Foot.Firstly, INBe by the affine absorption between purification tag and medium be fixed to chromatography microballoon on, once solution condition changes
Become (pH, temperature or reducing agent), affinity tag very likely falls off from medium, causes the secondary pollution of destination protein；Separately
Outside, there are problems for the cleavage reaction rate of intein and the control to cleavage reaction rate.The cleavage reaction speed of some inteins
Rate is relatively slow (12h or more), this can extend the time of purification process, reduces purification efficiency.But the intein of fast fracture, such as
NpuDnaE inhibits there are problem the effective of its cleavage reaction, this will lead to target protein in the stream in cleaning foreign protein stage
It loses, reduces purification efficiency.
Zhilei Chen et al. passes through research INWith ICBetween Interactions Mode discovery, between target protein and medium
Steric hindrance may will affect fracture intein shear active.According to the action principle of steric hindrance, experiment of the invention
It is found in research, for purifying affinity ligand segment INAnd ICWith the position of the His-tag of the amalgamation and expression segment of target protein
It will affect the rate of cleavage reaction.Peptide-mediated affinity purification system is included for fracture, improves the key of system purification efficiency
It is not only in that the rate for improving cleavage reaction, lies also in loading and the cleaning foreign protein stage is able to suppress cleavage reaction.Research hair
It is existing, only in the case where the first amino acid of NpuDnaE is Cys, Zn2+It can be with the specific site knot in intein NpuDnaE
It closes to inhibit the progress of cleavage reaction.Therefore, the present invention is in the premise not being mutated to the first amino acid of NpuDnaE
Under, Zn is added in loading and cleaning foreign protein stage2+It effectively inhibits and is broken in advance, to improve the purification efficiency of system.
Summary of the invention
The purpose of this section is to summarize some aspects of the embodiment of the present invention and briefly introduce some preferable implementations
Example.It may do a little simplified or be omitted to avoid our department is made in this section and the description of the application and the title of the invention
Point, the purpose of abstract of description and denomination of invention it is fuzzy, and this simplification or omit and cannot be used for limiting the scope of the invention.
The problem of in view of above-mentioned and/or existing needle affinity ligand and purposes, propose the present invention.
Therefore, the one of purpose of the present invention is to provide a kind of modified NpuDnaE N-terminal montage structural domain (IN) shape
At affinity ligand.
In order to solve the above technical problems, according to an aspect of the present invention, the present invention provides the following technical scheme that a kind of
Affinity ligand recombinates IN *Albumen, the building of the affinity ligand are to NpuDnaE-N, i.e., natural INStructure be transformed
On the basis of carry out；Wherein, natural INC-terminal add a cysteine, for chromatography microballoon covalent bond；Natural IN
N-terminal first place amino acid introduce mutation Cys1Ala, avoid the generation of N-terminal cleavage reaction；His-tag is placed in natural INThe N of segment
End, for purifying ligand fragment.
A kind of preferred embodiment as affinity ligand of the present invention, in which: the natural NpuDnaE gene order template
As shown in sequence table SEQ ID No.3.
A kind of preferred embodiment as affinity ligand of the present invention, in which: the His-tag is placed in natural INSegment
N-terminal is mutated Cys1Ala, natural INC-terminal add a cysteine, gene order such as sequence table SEQ ID No.4 institute
Show, protein sequence is as shown in sequence table SEQ ID No.6.
Another one purpose of the present invention is to provide a kind of construction method of affinity ligand.
In order to solve the above technical problems, according to another aspect of the present invention, the present invention provides the following technical scheme that right
The N-terminal montage structural domain of natural breaking type intein NpuDnaE carries out molecular modification, improved INSegment is named as IN *, packet
It includes, in natural INC-terminal add a Cys；In INThe N-terminal of segment adds His-tag sequence；In primer add Nde I,
Two restriction enzyme sites of Hind III simultaneously utilize it by IN *Fragment inserting expressioning carrier pET28a, the albumen of acquisition are affinity ligand
Segment.
A kind of preferred embodiment of construction method as affinity ligand of the present invention, in which: the primer, wherein IN *
The upstream and downstream primer gene order of sequence alterations is respectively as shown in sequence table SEQ ID No.1 and SEQ ID No.2.
A kind of preferred embodiment of construction method as affinity ligand of the present invention, in which: further include the structure of recombinant bacterium
It builds, carries out PCR by template of pRSFDuet-1-NpuDnaE plasmid, obtain improved segment IN *, utilize carrier pMD19-T structure
Build recombinant plasmid pMD19-T-IN *, transformed competence colibacillus E.coli JM109, then utilize the two digestion positions Nde I and Hind III
The I that point will be builtN *Sequence and expression plasmid pET-21b carry out digestion connection, obtain recombinant expression plasmid pET-21b-IN *,
Last transformed competence colibacillus E.coli BL21 (DE3), obtains improved recombination IN *Expression bacterial strain E.coli BL21 (DE3)/
pET-21b-IN *；NpuDnaEIN *Expression and purification, to recombinant bacterium E.coli BL21 (DE3)/pET-21b-IN *Carry out induction table
It reaches, obtains improved recombination IN *Albumen.
A kind of preferred embodiment of construction method as affinity ligand of the present invention, in which: with recombination IN *Albumen matches
Pair ICThe gene order and protein sequence of-GFP segment are as shown in sequence table SEQ ID No.5 and SEQ ID No.7.
Further object of the present invention, which is to provide more than one, to be stated affinity ligand and is coupled to obtain affinity chromatography medium.
In order to solve the above technical problems, according to a further aspect of the invention, the present invention provides the following technical scheme that one
The affinity chromatography medium that kind is coupled using affinity ligand, with IN *Segment is affinity ligand, covalent by activation intermediate arm
Agarose microbeads are coupled to, are formed to ICFusion protein has the affinity chromatography medium of affinity interaction, and structure is that agarose is micro-
Ball-activation intermediate arm-IN *Affinity ligand:
4th purpose of the invention, which is to provide more than one, to be stated affinity ligand and is coupled to obtain the method for affinity chromatography medium.
In order to solve the above technical problems, according to the fourth aspect of the present invention, the present invention provides the following technical scheme that one
Kind utilizes the coupling process for preparing of affinity ligand, with IN *Segment is affinity ligand, by covalent coupling to agarose microbeads, is formed
To ICFusion protein has the affinity chromatography medium of affinity interaction, including, it is shunk using diepoxides 1,4-butanediol two
Glycerin ether activates the agarose containing hydroxyl, obtains the activation Epoxy Sepharose containing a long hydrophilic chain；The activation ring
Ethylene oxide group and I on oxygen agaroseN *The sulfydryl of segment C-terminal Cys reacts, by affinity ligand segment IN *After activation
Agarose medium is coupled to obtain affinity chromatography medium.
The present invention, which a further object is, provides a kind of application of above-mentioned affinity chromatography medium, is to fill affinity chromatography medium
Column；With contain 1mmol/L Zn2+PBS buffer solution be balanced；By the I containing destination proteinCFusion protein study carries out
Sample；With without Zn2+PBS buffer solution cleaned；Chromatography media, room are rinsed with the breaking buffer containing 50mmol/L DTT
Temperature is lower to stand 3h；Post-rift target protein is eluted with elution buffer and is collected；IN *Affinity column is regenerated.
The utility model has the advantages that the present invention is completed by the cleavage reaction of intein itself possessed by of the invention, cost is both reduced
The pollution to target protein can be prevented again；The fracture rate of 3h is still very high under the conditions of the present invention is existing for the reducing agent, also, this
The affinity purification medium of invention building has preferable purification effect and higher recycling rate of waterused.
Detailed description of the invention
In order to illustrate the technical solution of the embodiments of the present invention more clearly, required use in being described below to embodiment
Attached drawing be briefly described, it should be apparent that, drawings in the following description are only some embodiments of the invention, for this
For the those of ordinary skill of field, without any creative labor, it can also be obtained according to these attached drawings other
Attached drawing.Wherein:
Fig. 1 is the affinity purification system explanatory diagram of present invention fracture intein NpuDnaE-N end affinity ligand and its composition；
Fig. 2 is I of the present inventionN *The affinity purification flow chart of affinity chromatography medium, wherein 1. indicate the system of affinity chromatography medium
It is standby, it 2. indicates loading, 3. indicates cleaning foreign protein, 4. indicate inductive cleavage and elution, 5. indicate the regeneration of affinity chromatography medium；
Fig. 3 is I of the present inventionN *Affinity column is to target protein purification process figure, wherein 1 indicates loading, 2 indicate to be free of
Zn2+Buffer A cleaning, 3 indicate be added breaking buffers simultaneously maintain 5h, 4 expressions are eluted with elution buffer；
Fig. 4 is I of the present inventionN *SDS-PAGE proof diagram of the affinity column to target protein purification efficiency, wherein 1 indicates
Albumen Marker, 2 indicate IC- GFP segment crude samples, 3 indicate the sample penetration liquid in A stage in Fig. 3, and 4 indicate B-stage in Fig. 3
Sample, 5 indicate Fig. 3 in C-stage elution samples, 6 indicate Buffer D elution samples；
Fig. 5 is I of the present inventionN *The recycling efficiency line chart of affinity column.
Specific embodiment
In order to make the foregoing objectives, features and advantages of the present invention clearer and more comprehensible, right with reference to the accompanying drawings of the specification
A specific embodiment of the invention is described in detail.
In the following description, numerous specific details are set forth in order to facilitate a full understanding of the present invention, but the present invention can be with
Implemented using other way described herein is different from, those skilled in the art can be without prejudice to intension of the present invention the case where
Under do similar popularization, therefore the present invention is not limited by the specific embodiments disclosed below.
Secondly, " one embodiment " or " embodiment " referred to herein, which refers to, may be included at least one realization side of the invention
A particular feature, structure, or characteristic in formula." in one embodiment " that different places occur in the present specification not refers both to
The same embodiment, nor the individual or selective embodiment mutually exclusive with other embodiments.
The present invention devises the N-terminal montage structural domain (I of modified NpuDnaE a kind ofN *) formed affinity ligand, pass through
Its C-terminal and chromatography microballoon covalent cross-linking construct a kind of chromatography media of novel protein affinity purification.Target protein need to only divide
I is implemented in sub- levelCC-terminal (effect for being equivalent to affinity tag) and and ICAmalgamation and expression passes through I in vitroCWith INParent
The purifying of destination protein can be realized with the montage reaction under combination and control condition induction.
The building of affinity ligand segment is to NpuDnaE-N (IN) structure be transformed on the basis of carry out.In IN
C-terminal add a cysteine, for chromatography microballoon covalent bond；In natural INN-terminal first place amino acid introduce it is prominent
Become Cys1Ala, avoids the generation of N-terminal cleavage reaction；The His-tag for being used to purify ligand fragment is placed in INThe N-terminal of segment.
The step of construction method of the modified NpuDnaE N-terminal montage structural domain affinity ligand are as follows:
Step 1: design of primers
The present invention carries out molecular modification to the N-terminal montage structural domain of natural breaking type intein NpuDnaE.Improved IN
Segment is named as IN *, the content of transformation is in natural INC-terminal add a Cys, and in INThe N-terminal of segment adds His-tag
Sequence.Since the site of transformation is located at the both ends of target fragment, can directly be completed by design primer to INSegment
Transformation.Two Nde I, Hind III restriction enzyme sites are added in primer and utilize it by IN *Fragment inserting expressioning carrier
PET21b, the albumen for expressing acquisition through this mode are required affinity ligand segment.
Step 2: the building of recombinant bacterium
Present invention primer according to designed by step 1 carries out PCR by template of pRSFDuet-1-NpuDnaE plasmid, obtains
Obtain improved INSegment IN *, utilize carrier pMD19-T construction recombination plasmid pMD19-T-IN *, transformed competence colibacillus E.coli
JM109 carries out the preservation of glycerol frozen pipe.Then the I that will be built using two restriction enzyme sites of Nde I and Hind IIIN *Sequence and table
Digestion connection is carried out up to plasmid pET-21b, obtains recombinant expression plasmid pET-21b-IN *, last transformed competence colibacillus E.coli
BL21 (DE3) obtains improved recombination IN *Express bacterial strain E.coli BL21 (DE3)/pET-21b-IN *, prepare glycerol frozen pipe
Preservation is spare；
Step 3: NpuDnaEIN *Expression and purification
The present invention is using IPTG to recombinant bacterium E.coli BL21 (DE3)/pET-21b-I constructed by step (2)N *It carries out
Inducing expression obtains improved recombination IN *Albumen.The I of purifying is obtained using Ni affinity columnN *, it is used for and chromatography microballoon
Crosslinking.
Step 4: IN *The preparation of affinity chromatography medium as aglucon
It is lived using diepoxides 1,4-butanediol diglycidyl ether (BDCE) to the agarose containing hydroxyl
Change, the available activation Epoxy Sepharose for containing a long hydrophilic chain.Ethylene oxide group and I on activated agaroseN *Segment C-terminal
The sulfydryl (- SH) of Cys reacts, by affinity ligand segment IN *It is coupled to obtain to I with the agarose medium after activationCMerge egg
The white affinity chromatography medium with affinity interaction.
(1) design of primers
Embodiment 1
Molecular modification is carried out using N-terminal montage structural domain of the round pcr to natural breaking type intein NpuDnaE, and will
Improved INSegment is named as IN *.According to the gene order that GeneBank is provided, molecular biology software Primer is utilized
Premier 5 designs IN *Forward primer S '-N and reverse primer A '-N:
S '-N:GGAATTCCATATGCATCATCATCATCATCACGCATTAAGCTATGAAACGGAAA
A '-N:CCCAAGCTTTTAACAATTCGGCAAATTATCAAC
Forward primer and reverse primer introduce Nde I and Hind III digestion site respectively, and wherein italicized item is digestion
Site, S '-N underscore part are the His tag label and I of additionNThe mutation of the first amino acid Cys1Ala, A '-N underscore
Part is the cysteine added and a terminator codon.Designed primer is transferred into raw work bioengineering (Shanghai)
Limited liability company's synthesis.
(2) recombinant vector pMD19-T-IN *Building
Embodiment 2
Plasmid pRSFDuet-1-NpuDnaE is extracted, is primer, plasmid using S '-N, the A '-N that embodiment 1 designs
PRSFDuet-1-NpuDnaE is template, using ExTaq archaeal dna polymerase to IN *Sequence carries out PCR.It polymerize according to ExTaq DNA
Enzyme specification selects 50 μ L systems to carry out.
PCR reaction condition: 94 DEG C of reaction 5min of initial denaturation；94 DEG C of reaction 30s are denaturalized, 46 DEG C of reaction 30s of annealing temperature prolong
72 DEG C of extension 30s of temperature are stretched, 30 circulations are carried out；Last 72 DEG C of holdings 10min.
I is recycled using Ago-Gel QIAquick Gel Extraction KitN *Segment obtains the I that both ends respectively have an adenineN *Sequence,
Using base pair complementarity principle by IN *Sequence is connected on carrier T pMD19-T, obtains recombinant plasmid pMD19-T-IN *.It will weigh
Group plasmid transformed competence colibacillus cell E.coli JM109, obtains recombinant bacterium E.coli JM109/pMD19-T-IN *Carry out glycerol jelly
Pipe preservation is spare.
(3) recombinant vector pET-21b-IN *Building
Embodiment 3
It is incubated overnight laboratory preservation strain E.coli JM109/pMD19-T-IN *, plasmid is extracted, then using restricted
Restriction endonuclease Nde I and Hind III is to plasmid pMD19-T-IN *Digestion is carried out, will be attached, obtain after the recycling of digestion products glue
Recombinant expression plasmid pET-21b-IN *, last transformed competence colibacillus E.coli BL21 (DE3) obtains improved recombination IN *Expression
Bacterial strain E.coli BL21 (DE3)/pET-21b-IN *, it is spare to prepare glycerol frozen pipe preservation.
(4)NpuDnaEIN *Expression and purification and IN *The preparation of affinity column
Embodiment 4
Recombinant bacterium E.coli BL21 (DE3)/pET-21b-I that embodiment 3 is obtainedN *It is incubated overnight, transfer 50mL LB
Culture medium, culture to OD600When=0.6, IPTG to final concentration 0.1M, 16 DEG C of 180rpm inducing expressions are added.Culture is collected by centrifugation
Supernatant is collected by centrifugation in thallus afterwards, sonicated cells.Supernatant loading is in advance with equilibration buffer (20mM imidazoles；0.5M
NaCl；10mM Tris-HCl；PH 8.0) balance Ni affinity column, equilibration buffer elutes 7-8 column volume to balance,
Then elution buffer (250mM imidazoles is used；0.5M NaCl；10mM Tris-HCl；PH 8.0) elution.Collect the I of elutionN *,
Its concentration is detected with SDS-PAGE.Expressed affinity ligand segment I is purified using Ni affinity chromatography fillerN *, by purified product
Be freeze-dried spare.
Embodiment 5
Using 1,4-butanediol, glycidol ether (BDEC) activates the agarose 6FF containing hydroxyl, can obtain
To the activation Epoxy Sepharose for containing a hydrophilic chain.By equivalent agarose microbeads are with 1,4-butanediol and glycidol ether mixes,
Be added equivalent 0.6mol/L NaOH, 30 DEG C, 200r/min, 10h.After reaction, the agarose microbeads of activation with 20% second
Pure and mild a large amount of deionized water is cleaned spare.
Embodiment 6
With coupling buffer (0.1mol/L Na2CO3/NaHCO3, pH 10.0) and dissolution affinity ligand segment IN *, with epoxy
The agarose of activation carries out coupling preparation IN *Affinity chromatography medium.Coupling condition are as follows: 40 DEG C, 150r/min, 16h.After coupling
Affinity media deionized water and 20% ethyl alcohol clean and drained with Buchner funnel, saved under the conditions of 4 DEG C in 20% ethyl alcohol.
With IN *Segment is affinity ligand, by activation intermediate arm covalent coupling to agarose microbeads, is formed to ICMerge egg
The white affinity chromatography medium with affinity interaction, structure are agarose microbeads-activation intermediate arm-IN *Affinity ligand:
(5)ICThe expression and purification of target gene fusion protein
Embodiment 7
Target protein to be purified is connected to the end C of the C-terminal montage structural domain of NpuDnaE using fusion DNA vaccine technology
End.Using the method for above-described embodiment 2,3, fusion dna segment is connected into pET28a carrier, and transformed competence colibacillus E.coli
BL21 (DE3) obtains ICWith the amalgamation and expression bacterial strain of target protein GFP.It is right using inducing expression condition as described in example 4
Target gene merges segment IC- GFP is expressed.
Embodiment 8
By the I of embodiment 5CIt is expressed with the expression product of target gene fusion protein according to the method for embodiment 4.With
The buffer of crude protein sample containing expressing fusion protein segment is changed to equilibration buffer Buffer A by the method for ultrafiltration
(1mmol/L Zn2+；20mmol/L imidazoles；0.5mol/L NaCl；20mmol/L Na2HPO4；pH 6.5).
Based on AKTA purifier tomographic system, using the affinity chromatography system constructed in the present invention to target protein into
Detailed process is as follows for row purifying:
1) it balances.With equilibration buffer Buffer A (the 1mmol/L Zn of 3 times of column volumes2+；20mmol/L imidazoles；
0.5mol/L NaCl；20mmol/LNa2HPO4；PH 6.5) medium is balanced.
2) loading.Unpurified crude protein liquid loading, the buffered environment of albumen is Buffer A herein.
3) foreign protein is cleaned.It is sufficiently rinsed with the Buffer A of 4 times of column volumes, removes unbonded albumen.With 2 times of volumes
Without Zn2+Buffer A rinse.
4) inductive cleavage.3 times of volumes breaking buffer Buffer B (50mmol/L DTT, 20mmol/L EDTA,
0.5mol/L NaCl, 10mmolLTris-HCl, pH 8.0) chromatography media is rinsed, be by the buffer exchange in chromatography media
Breaking buffer.3h is stood at room temperature.
5) it elutes.It is washed with elution buffer Buffer C (0.5mol/L NaCl, 10mmol/L Tris-HCl, pH 8.0)
Under post-rift target protein and be collected.
(6)IN *The regeneration of affinity column
Embodiment 9
After target protein is eluted, with regeneration buffer Buffer D (0.5M NaCl, 50mmol/L Na2HPO4/
NaOH, pH 11.4) by the I in conjunction with affinity mediaCSegment elution, is rinsed with 20% ethyl alcohol and is saved under the conditions of 4 DEG C.
According to procedure above, repetition protein of interest is multiple, examines IN *The recycling number of affinity column is 40
The secondary above purification efficiency is not decreased obviously.
Affinity chromatography medium is filled into column；With contain 1mmol/L Zn2+PBS buffer solution be balanced；To contain has purpose egg
White ICFusion protein study carries out loading；With without Zn2+PBS buffer solution cleaned；With containing 50mmol/L DTT's
Breaking buffer rinses chromatography media, stands 3h at room temperature；Post-rift target protein is eluted with elution buffer and is received
Collection；IN *Affinity column is regenerated.
It can be seen that this utilizes the I of the invention expressedN *Have as affinity ligand preparation affinity chromatography filler following excellent
Point:
(1) compared with traditional affinity chromatography, the participation cut without any protease of the present invention to target protein, according to
Cleavage reaction by intein itself is completed, and had not only been reduced cost but also can have been prevented the pollution to target protein.
(2) compared with some fracture intein purification systems currently existed, the present invention is by affinity ligand segment INC
End is connect with medium, while the position of His-tag is moved to INN-terminal.By reducing INAnd ICIt is mutually distinguishable the process of combination
In steric hindrance improve cleavage activity, the fracture rate of 3h reaches 95% under the conditions of existing for the reducing agent.
(3) Zn that the present invention realizes2+Effective control to cleavage reaction, improves the purification efficiency of system.But not to first place
Amino acid, which carries out mutation, will lead to N-terminal cleavage reaction and cannot be prevented from, and cleavage reaction is then made to become montage reaction.Intein
Montage reaction can make N-terminal extein sequences be connected with C-terminal extein, i.e., be added in the N-terminal of target protein GFP positioned at INSegment
The Additional amino acid sequences of N-terminal.The I in the practical application of building intein affinity purification systemNSegment as affinity ligand with
Medium is covalently attached and carries out Reusability, therefore the extra amino acid phenomenon of target protein N-terminal is largely purified for the first time
Middle appearance.Since Asp118 mutation makes C-terminal cleavage reaction independent of N-terminal, theoretically in INAll amino acid of N-terminal turn
It moves to after target protein N-terminal and can produce the target protein GFP without additional amino acid.Fault complexe is in practical affinity purification body
Commodity, which are used as, in system removes I in application, can carry out once purifying in advanceNThe additional amino acid of N-terminal, later can be as just
Normal purification media uses.
(4) in addition, the present invention changes traditional affine combination by between Tag and medium to fix INSegment, will
Tag replaces with a Cys and the fixed affinity ligand I by the way of Cys and chromatography microballoon covalent cross-linkingN *.It is demonstrated experimentally that this
The purification system purification result that novel affinity purification medium mediates is analyzed to obtain single target protein band through SDS-PAGE,
Through determination of protein concentration and calculate purification efficiency be 50.9%.Affinity purification medium is repeated not to be had using purification efficiency after 40 times
It decreased significantly, illustrate that the affinity purification medium that the present invention constructs has preferable purification effect and higher recycling rate of waterused.
It should be noted that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although referring to preferable
Embodiment describes the invention in detail, those skilled in the art should understand that, it can be to technology of the invention
Scheme is modified or replaced equivalently, and without departing from the spirit and scope of the technical solution of the present invention, should all be covered in this hair
In bright scope of the claims.
Claims (8)
1. a kind of affinity ligand, it is characterised in that: the building of affinity ligand is to NpuDnaE-N, i.e. the structure of IN is changed
It is carried out on the basis of making, improved IN segment is named as IN*；Wherein,
The C-terminal of natural IN adds a cysteine, for the covalent bond with chromatography microballoon；
The N-terminal first place amino acid of natural IN introduces mutation Cys1Ala, avoids the generation of N-terminal cleavage reaction；
His-tag is placed in the N-terminal of natural IN segment, for purifying ligand fragment；
The His-tag is placed in the N-terminal of natural IN segment, is mutated Cys1Ala, and the C-terminal of natural IN adds a cysteine,
Its gene order is as shown in sequence table SEQ ID No.4, and protein sequence is as shown in sequence table SEQ ID No.6.
2. a kind of construction method of affinity ligand as described in claim 1, it is characterised in that: to natural breaking type intein
The N-terminal montage structural domain of NpuDnaE carries out molecular modification, and improved IN segment is named as IN*, including,
A Cys is added in the C-terminal of natural IN；
His-tag sequence is added in the N-terminal of IN segment；
Two Nde I, Hind III restriction enzyme sites are added in primer and utilize it by IN* fragment inserting expressioning carrier
PET28a, the albumen of acquisition are affinity ligand segment.
3. the construction method of affinity ligand according to claim 2, it is characterised in that: the primer, wherein IN* sequence
The upstream and downstream primer gene order of transformation is respectively as shown in sequence table SEQ ID No.1 and SEQ ID No.2.
4. the construction method of affinity ligand according to claim 2 or 3, it is characterised in that: further include,
The building of recombinant bacterium carries out PCR by template of pRSFDuet-1-NpuDnaE plasmid, obtains improved segment IN*, benefit
With carrier pMD19-T construction recombination plasmid pMD19-T-IN*, transformed competence colibacillus E.coli JM109, then using Nde I and
The IN* sequence built and expression plasmid pET-21b are carried out digestion connection by two restriction enzyme sites of Hind III, obtain recombination table
Up to plasmid pET-21b-IN*, last transformed competence colibacillus E.coli BL21 (DE3) obtains improved recombination IN* expression bacterial strain
E.coli BL21(DE3)/pET-21b-IN*；
The expression and purification of NpuDnaEIN* carries out inducing expression to recombinant bacterium E.coli BL21 (DE3)/pET-21b-IN*, obtains
Obtain improved recombination IN* albumen.
5. the construction method of affinity ligand according to claim 4, it is characterised in that: match with recombination IN* albumen
The gene order and protein sequence of IC-GFP segment are as shown in sequence table SEQ ID No.5 and SEQ ID No.7.
6. a kind of affinity chromatography medium being coupled using affinity ligand as described in claim 1, it is characterised in that: with
IN* segment is affinity ligand, and by activation intermediate arm covalent coupling to agarose microbeads, being formed has parent to IC fusion protein
With the affinity chromatography medium of effect, structure is agarose microbeads-activation intermediate arm-IN* affinity ligand:
。
7. a kind of coupling process for preparing of affinity chromatography medium as claimed in claim 6, it is characterised in that: its method includes,
The agarose containing hydroxyl is activated using diepoxides 1,4-butanediol diglycidyl ether, is obtained containing one
The activation Epoxy Sepharose of long hydrophilic chain；
Ethylene oxide group on the activation Epoxy Sepharose is reacted with the sulfydryl of IN* segment C-terminal Cys, by affinity ligand piece
Section IN* is coupled to obtain affinity chromatography medium with the agarose medium after activation.
8. a kind of application using affinity chromatography medium as claimed in claim 6, it is characterised in that: including,
Affinity chromatography medium is filled into column；
It is balanced with the PBS buffer solution containing 1mmol/L Zn2+；
IC fusion protein study containing destination protein is subjected to loading；
It is cleaned with the PBS buffer solution without Zn2+；
Chromatography media is rinsed with the breaking buffer containing 50mmol/L DTT, stands 3h at room temperature；
Post-rift target protein is eluted with elution buffer and is collected；
IN* affinity column is regenerated.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610749025.0A CN106317227B (en) | 2016-08-29 | 2016-08-29 | Affinity ligand, construction method, affinity chromatography medium, preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610749025.0A CN106317227B (en) | 2016-08-29 | 2016-08-29 | Affinity ligand, construction method, affinity chromatography medium, preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106317227A CN106317227A (en) | 2017-01-11 |
| CN106317227B true CN106317227B (en) | 2019-04-12 |
Family
ID=57788197
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610749025.0A Active CN106317227B (en) | 2016-08-29 | 2016-08-29 | Affinity ligand, construction method, affinity chromatography medium, preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106317227B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108410898A (en) * | 2018-03-09 | 2018-08-17 | 江南大学 | A kind of artificial reconstructed DNA molecular, plasmid vector and preparation method thereof |
| TWI671314B (en) * | 2018-06-29 | 2019-09-11 | 國立清華大學 | Control self-cleavage protein activity and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103214563A (en) * | 2013-03-26 | 2013-07-24 | 江南大学 | Performance improved recombination staphylococcus aureus protein A affinity ligand and construction method thereof |
| CN103586008A (en) * | 2013-10-24 | 2014-02-19 | 中国科学院过程工程研究所 | Affinity chromatography medium and preparation method and application thereof |
-
2016
- 2016-08-29 CN CN201610749025.0A patent/CN106317227B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103214563A (en) * | 2013-03-26 | 2013-07-24 | 江南大学 | Performance improved recombination staphylococcus aureus protein A affinity ligand and construction method thereof |
| CN103586008A (en) * | 2013-10-24 | 2014-02-19 | 中国科学院过程工程研究所 | Affinity chromatography medium and preparation method and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| Engineering split intein DnaE from Nostoc punctiforme for rapid protein purification;Miguel Ramirez等;《Protein Engineering, Design & Selection》;20131231;第26卷(第3期);第215-223页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106317227A (en) | 2017-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Blaak et al. | Binding and substrate specificities of a Streptomyces olivaceoviridis chitinase in comparison with its proteolytically processed form | |
| CN103214563B (en) | A kind of recombination staphylococcus aureus albumin A affinity ligand of improvement in performance and construction process thereof | |
| CN104524564B (en) | A kind of crucian Simplex Virus combination vaccine preparation and preparation method and application | |
| CN104725517B (en) | A kind of method for improving yeast cell surface destination protein displaying amount | |
| CN109266633A (en) | Carbohydrate binding module and its application in immobilised enzymes preparation and fusion protein purification | |
| CN106317227B (en) | Affinity ligand, construction method, affinity chromatography medium, preparation method and application | |
| Schuphan et al. | Analysis of engineered tobacco mosaic virus and potato virus X nanoparticles as carriers for biocatalysts | |
| CN101845425B (en) | Alpha-galactosidase and expression and purification method thereof | |
| CN103805581A (en) | Beta-glycosidase mutant and coding gene thereof, and application thereof in producing ginsenoside CK | |
| CN101659948B (en) | Heat resistant xylanase as well as coding gene and application thereof | |
| CN107164353A (en) | A kind of low-temperature alkali pectin lyase and its encoding gene and application | |
| CN104805104A (en) | Trehalose synthase and coding gene and application thereof | |
| CN104673713B (en) | A kind of basophilic streptomycete and its neutral endoglucanase of generation and application | |
| CN104630184B (en) | A kind of alkalescent xylanase and its encoding gene and application | |
| CN1312183C (en) | Heparinase I fusion protein and genes encoding same and expression method thereof | |
| CN104673771B (en) | A kind of neutral endoglucanase and its encoding gene and application | |
| CN104877979B (en) | A kind of its encoding gene of the β mannonases of first genomic source and its expression | |
| CN108192903A (en) | A kind of alkalescent xylanase and its encoding gene and application | |
| CN102358896A (en) | Heat-resistant cutinase-CBD (cellulose-binding domain) fusion enzyme, its mutants and application | |
| CN108531470A (en) | A kind of sulfuric acid fucoidin lyases TFLFM and its preparation method and application | |
| CN104560833B (en) | A kind of basophilic micrococcus luteus and its alkalescent xylanase and the application of generation | |
| CN107603965A (en) | Acid starch enzyme mutant that heat endurance improves and its preparation method and application | |
| CN113046378B (en) | Incision alginate lyase, coding gene and application thereof | |
| CN105647888A (en) | Endochitinase and coding gene and application thereof in production of chitobiose | |
| Zhao et al. | Different binding specificities of S-layer homology modules from Clostridium thermocellum AncA, Slp1, and Slp2 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |