CN106317227A - Affinity ligand, construction method, affinity chromatography medium, preparation method and application - Google Patents
Affinity ligand, construction method, affinity chromatography medium, preparation method and application Download PDFInfo
- Publication number
- CN106317227A CN106317227A CN201610749025.0A CN201610749025A CN106317227A CN 106317227 A CN106317227 A CN 106317227A CN 201610749025 A CN201610749025 A CN 201610749025A CN 106317227 A CN106317227 A CN 106317227A
- Authority
- CN
- China
- Prior art keywords
- affinity
- fragment
- affinity ligand
- natural
- ligand
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D15/00—Separating processes involving the treatment of liquids with solid sorbents; Apparatus therefor
- B01D15/08—Selective adsorption, e.g. chromatography
- B01D15/26—Selective adsorption, e.g. chromatography characterised by the separation mechanism
- B01D15/38—Selective adsorption, e.g. chromatography characterised by the separation mechanism involving specific interaction not covered by one or more of groups B01D15/265 - B01D15/36
- B01D15/3804—Affinity chromatography
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
- B01J20/00—Solid sorbent compositions or filter aid compositions; Sorbents for chromatography; Processes for preparing, regenerating or reactivating thereof
- B01J20/22—Solid sorbent compositions or filter aid compositions; Sorbents for chromatography; Processes for preparing, regenerating or reactivating thereof comprising organic material
- B01J20/24—Naturally occurring macromolecular compounds, e.g. humic acids or their derivatives
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
- B01J20/00—Solid sorbent compositions or filter aid compositions; Sorbents for chromatography; Processes for preparing, regenerating or reactivating thereof
- B01J20/30—Processes for preparing, regenerating, or reactivating
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/14—Extraction; Separation; Purification
- C07K1/16—Extraction; Separation; Purification by chromatography
- C07K1/22—Affinity chromatography or related techniques based upon selective absorption processes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Analytical Chemistry (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention provides an affinity ligand, a construction method, an affinity chromatography medium, a preparation method and application. The affinity ligand is constructed on the basis that the structure of NpuDnaE-N, namely, IN is transformed, wherein cysteine is additionally arranged at the C terminal of IN to be used for being covalently bonded with chromatography microspheres, mutated Cys1Ala is introduced into a first amino acid located at the N terminal of natural IN so as to avoid a fracture reaction of the N terminal, and His-tag is arranged at the N terminal of an IN segment to be used for purifying a ligand segment. Accordingly, construction is completed by depending on the fracture reaction of intein, and therefore not only is the cost reduced, but also contamination to target protein can be prevented; the fracture rate of 3h is still high in the presence of a reducing agent, and the constructed affinity purification medium has the good purification effect and the high repeated utilization rate.
Description
Technical field
The invention belongs to protein purification art, relate to a kind of engineered NpuDnaE-N end montage domain (IN) formed
Affinity ligand, and by its C end with chromatography microsphere covalent cross-linking construct a kind of novel protein affinity purification chromatography be situated between
Matter.Target protein only need to be implemented in I on a molecular scaleCC end and and ICAmalgamation and expression, by I in vitroCWith INAffine
In conjunction with and control condition inductive cleavage, the purification of destination protein can be realized.
Background technology
The application of purification tag greatly simplify the process of recombinant protein purification, and having for modern biotechnology can not
The using value estimated.But, the affinity purification label introduced in target protein has to pass through protease hydrolysis or chemical cracking
The process of reagent could remove.Therefore, in large-scale production, remove purification tag problem and govern extensively should of purification tag
With.For solving this problem, people have invented the spontaneous disruption purification tag without using the intein of protease to mediate.
Intein (also known as protein intron, intein) is one section of polypeptide chain in precursor immature albumen, and it passes through
The course of reaction of oneself's catalysis such as a series of rearrangements, transesterification, cyclisation, can excise and by many for the albumen at two ends from precursor protein
Peptide chain (extein, extein) is bonded by a native peptides.Fracture intein is structurally N end regions (IN)
With C end regions (IC) a kind of intein of being separated from each other.Work as INAnd ICTwo fragments can include according to standard after connecting recovery structure
Peptide montage approach completes the splicing of two ends extein.The montage activity of fracture intein is to pass through INAnd ICAffine combination and produce
Raw, both have and extremely strong are mutually distinguishable ability, and this is the basis that intein is applied to affinity purification system.
In general, intein spontaneous under conditions of reducing agent exists can carry out N-/C-end cleavage reaction, by one end
Target protein cuts down.Due to this series of reaction can in vitro, need not that the effect of enzyme is spontaneous to be carried out, therefore, profit
Carry out protein expression by fracture intein approach to purify, while purification can be removed while effective purification, remove purification mark
Sign.
Although fracture intein is to be worth certainly in terms of protein purification, but there is also some in its application process not
Foot.First, INBeing to be fixed to by the affine absorption between purification tag and medium chromatograph on microsphere, once solution condition changes
Becoming (pH, temperature or reducing agent), affinity tag very likely comes off from medium, causes the secondary pollution of destination protein；Separately
Outward, the cleavage reaction speed of intein and the control to cleavage reaction speed have problems.The cleavage reaction speed of some intein
Rate is relatively slow (more than 12h), and this can extend the time of purge process, reduces purification efficiency.But the intein of fast fracture, as
NpuDnaE, to its cleavage reaction effectively suppress existing problems, this can cause target protein clean the foreign protein stage stream
Lose, reduce purification efficiency.
Zhilei Chen et al. is by research INWith ICBetween Interactions Mode find, between target protein and medium
Sterically hindered may affect fracture intein shear active.According to sterically hindered action principle, the experiment of the present invention
Research finds, for purification affinity ligand fragment INAnd ICWith the position of the His-tag of the amalgamation and expression fragment of target protein also
The speed of cleavage reaction can be affected.For the affinity purification system of fracture intein mediation, improve the key of system purification efficiency
It is not only in that the speed improving cleavage reaction, lies also in loading and the cleaning foreign protein stage can suppress cleavage reaction.Research is sent out
Existing, in the case of only the first aminoacid at NpuDnaE is Cys, Zn2+Can tie with the specific site in intein NpuDnaE
Close thus suppress the carrying out of cleavage reaction.Therefore, the present invention is in the premise do not suddenlyd change the first aminoacid of NpuDnaE
Under, add Zn in loading and cleaning foreign protein stage2+Effectively inhibit and rupture in advance, thus improve the purification efficiency of system.
Summary of the invention
The purpose of this part is to summarize some aspects of embodiments of the invention and briefly introduce some preferably to implement
Example.Make a summary in this part and the description of the present application and denomination of invention may be done a little simplification or omit to avoid making our department
Point, the purpose of specification digest and denomination of invention obscure, and this simplification or omission cannot be used for limiting the scope of the present invention.
In view of problem present in above-mentioned and/or existing pin affinity ligand and purposes, it is proposed that the present invention.
Therefore, one of them purpose of the present invention is to provide a kind of engineered NpuDnaE N end montage domain (IN) shape
The affinity ligand become.
For solving above-mentioned technical problem, according to an aspect of the present invention, the technical scheme is that one
Affinity ligand restructuring IN *Albumen, the structure of described affinity ligand is to NpuDnaE-N, the most natural INStructure carry out transforming
On the basis of carry out；Wherein, natural INC end add a cysteine, for and chromatography microsphere covalent bond；Natural IN
N end first place aminoacid introduce sudden change Cys1Ala, it is to avoid the generation of N end cleavage reaction；His-tag is placed in natural INThe N of fragment
End, for purification ligand fragment.
As a kind of preferred version of affinity ligand of the present invention, wherein: described natural NpuDnaE gene order template
As shown in sequence table SEQ ID No.3.
As a kind of preferred version of affinity ligand of the present invention, wherein: described His-tag is placed in natural INFragment
N end, suddenly change Cys1Ala, natural INC end add a cysteine, its gene order such as sequence table SEQ ID No.4 institute
Showing, its protein sequence is as shown in sequence table SEQ ID No.6.
Other in which purpose of the present invention is to provide the construction method of a kind of affinity ligand.
For solving above-mentioned technical problem, according to another aspect of the present invention, it is right to the technical scheme is that
The N end montage domain of natural breaking type intein NpuDnaE carries out molecular modification, improved INThe named I of fragmentN *, bag
Include, at natural INC end add a Cys；At INThe N end of fragment adds His-tag sequence；In primer add Nde I,
Two restriction enzyme sites of Hind III also utilize it by IN *Fragment inserting expressioning carrier pET28a, it is thus achieved that albumen be affinity ligand
Fragment.
As a kind of preferred version of the construction method of affinity ligand of the present invention, wherein: described primer, wherein, IN *
The upstream and downstream primer gene order of sequence alterations is respectively as shown in sequence table SEQ ID No.1 and SEQ ID No.2.
As a kind of preferred version of the construction method of affinity ligand of the present invention, wherein: also include, the structure of recombinant bacterium
Build, carry out PCR with pRSFDuet-1-NpuDnaE plasmid for template, it is thus achieved that improved fragment IN *, utilize carrier pMD19-T structure
Build recombiant plasmid pMD19-T-IN *, transformed competence colibacillus E.coli JM109, then utilize Nde I and two enzyme action positions of Hind III
The I that point will buildN *Sequence carries out enzyme action with expression plasmid pET-21b and is connected, and obtains recombinant expression plasmid pET-21b-IN *,
Last transformed competence colibacillus E.coli BL21 (DE3), obtains improved restructuring IN *Expression strain E.coli BL21 (DE3)/
pET-21b-IN *；NpuDnaEIN *Expression and purification, to recombinant bacterium E.coli BL21 (DE3)/pET-21b-IN *Carry out induction table
Reach, it is thus achieved that improved restructuring IN *Albumen.
As a kind of preferred version of the construction method of affinity ligand of the present invention, wherein: with restructuring IN *Albumen matches
To ICThe gene order of-GFP fragment and protein sequence are as shown in sequence table SEQ ID No.5 and SEQ ID No.7.
Further object of the present invention is to provide more than one and states affinity ligand coupling and obtain affinity chromatography medium.
For solving above-mentioned technical problem, according to a further aspect of the invention, the technical scheme is that one
Planting the affinity chromatography medium utilizing affinity ligand coupling to obtain, it is with IN *Fragment is affinity ligand, by activation intermediate arm covalency
It is coupled to agarose microbeads, is formed ICFusion protein has the affinity chromatography medium of affinity interaction, and its structure is that agarose is micro-
Ball-activation intermediate arm-IN *Affinity ligand:
The 4th purpose of the present invention is to provide more than one and states the method that affinity ligand coupling obtains affinity chromatography medium.
For solving above-mentioned technical problem, according to the fourth aspect of the present invention, the technical scheme is that one
Plant the coupling process for preparing utilizing affinity ligand, with IN *Fragment is affinity ligand, by covalent coupling to agarose microbeads, is formed
To ICFusion protein has the affinity chromatography medium of affinity interaction, including, use diepoxides BDO two to shrink
Agarose containing hydroxyl is activated by glycerin ether, obtains the activation Epoxy Sepharose containing a long hydrophilic chain；Described activation ring
Ethylene oxide group on oxygen agarose and IN *The sulfydryl reaction of fragment C end Cys, by affinity ligand fragment IN *After activation
Agarose medium carries out coupling and obtains affinity chromatography medium.
The present invention a further object is the application providing a kind of above-mentioned affinity chromatography medium, and it is to be filled by affinity chromatography medium
Post；With containing 1mmol/L Zn2+PBS be balanced；By the I containing destination proteinCOn fusion protein study is carried out
Sample；With without Zn2+PBS be carried out；Chromatography media, room is rinsed with the breaking buffer containing 50mmol/L DTT
3h is stood under temperature；With the post-rift target protein of elution buffer eluting and be collected；IN *Affinity column regenerates.
The had the advantages that present invention of the present invention relies on the cleavage reaction of intein self to complete, and has both reduced cost
The pollution to target protein can be prevented again；Present invention fracture rate of 3h under conditions of reducing agent exists is the highest, and, this
The affinity purification medium that invention builds has preferable purification effect and higher recycling rate of waterused.
Accompanying drawing explanation
In order to be illustrated more clearly that the technical scheme of the embodiment of the present invention, required use in embodiment being described below
Accompanying drawing be briefly described, it should be apparent that, below describe in accompanying drawing be only some embodiments of the present invention, for this
From the point of view of the those of ordinary skill of field, on the premise of not paying creative work, it is also possible to obtain other according to these accompanying drawings
Accompanying drawing.Wherein:
Fig. 1 is that the present invention ruptures the affinity purification system explanatory diagram of intein NpuDnaE-N end affinity ligand and composition thereof；
Fig. 2 is I of the present inventionN *The affinity purification flow chart of affinity chromatography medium, wherein, 1. represents the system of affinity chromatography medium
Standby, 2. represent loading, 3. represent and clean foreign protein, 4. represent inductive cleavage and eluting, 5. represent the regeneration of affinity chromatography medium；
Fig. 3 is I of the present inventionN *Affinity column is to target protein purge process figure, and wherein 1 represents that loading, 2 expressions do not contain
Zn2+Buffer A clean, 3 represent that adding breaking buffer also maintains 5h, and 4 represent and use elution buffer eluting；
Fig. 4 is I of the present inventionN *The affinity column SDS-PAGE proof diagram to target protein purification efficiency, wherein, 1 represents
Albumen Marker, 2 represent IC-GFP fragment crude samples, 3 represent the sample penetration liquid in A stage in Fig. 3, and 4 represent B-stage in Fig. 3
Sample, 5 represent the elution samples of C-stage in Fig. 3, and 6 represent Buffer D elution samples；
Fig. 5 is I of the present inventionN *The recycling efficiency broken line graph of affinity column.
Detailed description of the invention
Understandable, below in conjunction with Figure of description pair for enabling the above-mentioned purpose of the present invention, feature and advantage to become apparent from
The detailed description of the invention of the present invention is described in detail.
Elaborate a lot of detail in the following description so that fully understanding the present invention, but the present invention is all right
Employing is different from alternate manner described here and implements, and those skilled in the art can be in the situation without prejudice to intension of the present invention
Under do similar popularization, therefore the present invention is not limited by following public specific embodiment.
Secondly, " embodiment " or " embodiment " referred to herein refers to may be included at least one realization side of the present invention
Special characteristic, structure or characteristic in formula.Different in this manual local " in one embodiment " occurred not refer both to
Same embodiment, is not single or the most mutually exclusive with other embodiments embodiment.
The present invention devises the N end montage domain (I of a kind of engineered NpuDnaEN *) affinity ligand that formed, pass through
Its C end constructs the chromatography media of a kind of novel protein affinity purification with chromatography microsphere covalent cross-linking.Target protein only need to divide
It is implemented in I in sub-levelCC end (being equivalent to the effect of affinity tag) and and ICAmalgamation and expression, by I in vitroCWith INParent
With the purification that the montage reaction under combination and control condition induction can realize destination protein.
The structure of affinity ligand fragment is to NpuDnaE-N (IN) structure transform on the basis of carry out.At IN
C end add a cysteine, for and chromatography microsphere covalent bond；At natural INN end first place aminoacid introduce prominent
Become Cys1Ala, it is to avoid the generation of N end cleavage reaction；The His-tag being used for purification ligand fragment is placed in INThe N end of fragment.
The step of the construction method of described engineered NpuDnaE N end montage domain affinity ligand is:
Step one: design of primers
The present invention carries out molecular modification to the N end montage domain of natural breaking type intein NpuDnaE.Improved IN
The named I of fragmentN *, the content of transformation is at natural INC end add a Cys, and at INThe N end of fragment adds His-tag
Sequence.Owing to the site of transformation is positioned at the two ends of target fragment, therefore can directly be completed I by design primerNFragment
Transformation.In primer, add Nde I, two restriction enzyme sites of Hind III and utilize it by IN *Fragment inserting expressioning carrier
PET21b, the albumen expressing acquisition through this mode is required affinity ligand fragment.
Step 2: the structure of recombinant bacterium
The present invention, according to the primer designed by step one, carries out PCR with pRSFDuet-1-NpuDnaE plasmid for template, obtains
Obtain improved INFragment IN *, utilize carrier pMD19-T construction recombination plasmid pMD19-T-IN *, transformed competence colibacillus E.coli
JM109 carries out glycerol frozen pipe preservation.Then the I that Nde I and two restriction enzyme sites of Hind III will build is utilizedN *Sequence and table
Reach plasmid pET-21b and carry out enzyme action connection, obtain recombinant expression plasmid pET-21b-IN *, last transformed competence colibacillus E.coli
BL21 (DE3), obtains improved restructuring IN *Expression strain E.coli BL21 (DE3)/pET-21b-IN *, prepare glycerol frozen pipe
Preservation is standby；
Step 3: NpuDnaEIN *Expression and purification
The present invention uses IPTG to recombinant bacterium E.coli BL21 (the DE3)/pET-21b-I constructed by step (2)N *Carry out
Abduction delivering, it is thus achieved that improved restructuring IN *Albumen.Ni affinity column is utilized to obtain the I of purificationN *, it is used for and chromatography microsphere
Crosslinking.
Step 4: IN *Preparation as the affinity chromatography medium of aglucon
Use diepoxides BDDE (BDCE) that the agarose containing hydroxyl is lived
Change, the activation Epoxy Sepharose containing a long hydrophilic chain can be obtained.Ethylene oxide group on activated agarose and IN *Fragment C end
Sulfydryl (-SH) the reaction of Cys, by affinity ligand fragment IN *Carry out coupling with the agarose medium after activation to obtain ICMerge egg
There is the affinity chromatography medium of affinity interaction in vain.
(1) design of primers
Embodiment 1
Use round pcr that the N end montage domain of natural breaking type intein NpuDnaE carries out molecular modification, and will
Improved INThe named I of fragmentN *.The gene order provided according to GeneBank, utilizes molecular biology software Primer
Premier 5 designs IN *Forward primer S '-N and reverse primer A '-N:
S '-N:GGAATTCCATATGCATCATCATCATCATCACGCATTAAGCTATGAAACGGAAA
A '-N:CCCAAGCTTTTAACAATTCGGCAAATTATCAAC
Forward primer and reverse primer introduce Nde I and Hind III digestion site respectively, and wherein italicized item is enzyme action
Site, S '-N underscore part is the His tag label and I addedNThe sudden change of the first aminoacid Cys1Ala, A '-N underscore
Part is the cysteine added and a termination codon.Designed primer is transferred to raw work biological engineering (Shanghai)
Limited company synthesizes.
(2) recombinant vector pMD19-T-IN *Structure
Embodiment 2
Extracting plasmid pRSFDuet-1-NpuDnaE, the S '-N, the A '-N that utilize embodiment 1 to design are primer, plasmid
PRSFDuet-1-NpuDnaE is template, utilizes ExTaq archaeal dna polymerase to IN *Sequence carries out PCR.It is polymerized according to ExTaq DNA
Enzyme description, selects 50 μ L systems to carry out.
PCR reaction condition: denaturation 94 DEG C reaction 5min；Degeneration 94 DEG C reaction 30s, annealing temperature 46 DEG C reaction 30s, prolong
Stretch temperature 72 DEG C and extend 30s, carry out 30 circulations；Last 72 DEG C keep 10min.
Utilize agarose gel to reclaim test kit and reclaim IN *Fragment, obtains two ends respectively with the I of an adenineN *Sequence,
Utilize base pair complementarity principle by IN *Sequence is connected in carrier T pMD19-T, obtains recombiant plasmid pMD19-T-IN *.Will weight
Group Plastid transformation competent cell E.coli JM109, obtains recombinant bacterium E.coli JM109/pMD19-T-IN *Carry out glycerol to freeze
Pipe preservation is standby.
(3) recombinant vector pET-21b-IN *Structure
Embodiment 3
Incubated overnight Laboratories Accession bacterial strain E.coli JM109/pMD19-T-IN *, extract plasmid, then utilize restricted
Restriction endonuclease Nde I and Hind III is to plasmid pMD19-T-IN *Carry out enzyme action, be attached after digestion products glue is reclaimed, obtain
Recombinant expression plasmid pET-21b-IN *, last transformed competence colibacillus E.coli BL21 (DE3), obtain improved restructuring IN *Express
Bacterial strain E.coli BL21 (DE3)/pET-21b-IN *, prepare glycerol frozen pipe preservation standby.
(4)NpuDnaEIN *Expression and purification and IN *The preparation of affinity column
Embodiment 4
Recombinant bacterium E.coli BL21 (DE3)/pET-21b-I that embodiment 3 is obtainedN *Incubated overnight, transfer 50mL LB
Culture medium, cultivates to OD600When=0.6, add IPTG to final concentration 0.1M, 16 DEG C of 180rpm abduction deliverings.Centrifugal collection is cultivated
After thalline, sonicated cells, centrifugal collect supernatant.Supernatant loading is in advance with level pad (20mM imidazoles；0.5M
NaCl；10mM Tris-HCl；PH 8.0) the Ni affinity column that balances, 7-8 column volume of level pad eluting to balance,
Then with elution buffer (250mM imidazoles；0.5M NaCl；10mM Tris-HCl；PH 8.0) eluting.Collect the I of elutingN *,
Its concentration is detected with SDS-PAGE.Utilize affinity ligand fragment I expressed by Ni affinity chromatograph filler purificationN *, by purified product
Carry out lyophilization standby.
Embodiment 5
Use BDO and the agarose 6FF containing hydroxyl is activated by glycidyl ether (BDEC), can obtain
To the activation Epoxy Sepharose containing a hydrophilic chain.By equivalent agarose microbeads and BDO and glycidyl ether mixes,
Addition equivalent 0.6mol/L NaOH, 30 DEG C, 200r/min, 10h.Reaction terminate after, the agarose microbeads of activation with 20% second
Alcohol and substantial amounts of deionized water are cleaned standby.
Embodiment 6
With coupling buffer (0.1mol/L Na2CO3/NaHCO3, pH 10.0) and dissolve affinity ligand fragment IN *, with epoxy
The agarose of activation carries out coupling and prepares IN *Affinity chromatography medium.Coupling condition is: 40 DEG C, 150r/min, 16h.After coupling
Affinity media deionized water and 20% ethanol clean and drain with buchner funnel, in 20% ethanol under the conditions of 4 DEG C preserve.
With IN *Fragment is affinity ligand, by activation intermediate arm covalent coupling to agarose microbeads, is formed ICMerge egg
Having the affinity chromatography medium of affinity interaction in vain, its structure is agarose microbeads-activation intermediate arm-IN *Affinity ligand:
(5)ICThe expression and purification of-genes of interest fusion protein
Embodiment 7
By target protein to be purified, utilize fusion DNA vaccine technology, be connected to the C end of the C end montage domain of NpuDnaE
End.The method utilizing above-described embodiment 2,3, connects pET28a carrier, and transformed competence colibacillus E.coli by fusion dna fragment
BL21 (DE3), it is thus achieved that ICAmalgamation and expression bacterial strain with target protein GFP.Utilize the abduction delivering condition described in embodiment 4, right
Genes of interest merges fragment IC-GFP expresses.
Embodiment 8
I by embodiment 5CExpress according to the method for embodiment 4 with the expression product of genes of interest fusion protein.With
The buffer exchange of the crude protein sample containing expressing fusion protein fragment is level pad Buffer A by the method for ultrafiltration
(1mmol/L Zn2+；20mmol/L imidazoles；0.5mol/L NaCl；20mmol/L Na2HPO4；pH 6.5).
Based on AKTA purifier tomographic system, utilize the affinity chromatograph system built in the present invention that target protein is entered
The detailed process of row purification is as follows:
1) balance.With level pad Buffer A (the 1mmol/L Zn of 3 times of column volumes2+；20mmol/L imidazoles；
0.5mol/L NaCl；20mmol/LNa2HPO4；PH 6.5) medium is balanced.
2) loading.Unpurified crude protein liquid loading, the buffered environment of albumen is Buffer A herein.
3) foreign protein is cleaned.Fully rinse with the Buffer A of 4 times of column volumes, remove unconjugated albumen.With 2 times of volumes
Without Zn2+Buffer A rinse.
4) inductive cleavage.The breaking buffer Buffer B of 3 times of volumes (50mmol/L DTT, 20mmol/L EDTA,
0.5mol/L NaCl, 10mmolLTris-HCl, pH 8.0) rinse chromatography media, by the buffer exchange in chromatography media be
Breaking buffer.Left at room temperature 3h.
5) eluting.Wash with elution buffer Buffer C (0.5mol/L NaCl, 10mmol/L Tris-HCl, pH 8.0)
Under post-rift target protein being collected.
(6)IN *The regeneration of affinity column
Embodiment 9
After target protein eluting, with regeneration buffer Buffer D (0.5M NaCl, 50mmol/L Na2HPO4/
NaOH, pH 11.4) I that will be combined with affinity mediaCFragment eluting, preserves with 20% alcohol flushing and under the conditions of 4 DEG C.
According to procedure above, repeat protein of interest repeatedly, check IN *The recycling number of times of affinity column is 40
Secondary above purification efficiency is not decreased obviously.
Affinity chromatography medium is filled post；With containing 1mmol/L Zn2+PBS be balanced；Will be containing purpose egg
White ICFusion protein study carries out loading；With without Zn2+PBS be carried out；With containing 50mmol/L DTT's
Breaking buffer rinses chromatography media, left at room temperature 3h；With the post-rift target protein of elution buffer eluting and receive
Collection；IN *Affinity column regenerates.
As can be seen here, this utilizes the I that the present invention expressesN *Prepare affinity chromatograph filler as affinity ligand and have following excellent
Point:
(1) compared with traditional affinity chromatograph, the present invention to the cutting of target protein need not the participation of any protease, depend on
Cleavage reaction by intein itself completes, and not only reduces cost but also can prevent the pollution to target protein.
(2) compared with some the fracture intein purification systems currently existed, the present invention is by affinity ligand fragment INC
End is connected with medium, the position of His-tag is moved to I simultaneouslyNN end.By reducing INAnd ICIt is mutually distinguishable the process of combination
In sterically hindered raising cleavage activity, under conditions of reducing agent exists, the fracture rate of 3h reaches 95%.
(3) Zn that the present invention realizes2+Effective control to cleavage reaction, improves the purification efficiency of system.But not to first place
Aminoacid carries out sudden change and N end cleavage reaction can be caused not to be prevented from, and then makes cleavage reaction become montage reaction.Intein
Montage reaction can make N end extein sequences be connected with C end extein, i.e. the N end at target protein GFP with the addition of and is positioned at INFragment
The Additional amino acid sequences of N end.I in the actual application building intein affinity purification systemNFragment as affinity ligand with
Medium is covalently bound and carries out Reusability, and therefore the extra amino acid phenomenon major part of target protein N end is at purification first
Middle appearance.Owing to Asp118 sudden change makes C end cleavage reaction not rely on N end, therefore, in theory at INThe all aminoacid of N end turns
The target protein GFP without additional amino acid can be produced after moving to target protein N end.Fault complexe is at actual affinity purification body
When system applies as commodity, a purification can be carried out in advance and remove INThe additional amino acid of N end, the most just can be as just
Normal purification media uses.
(4) additionally, the present invention changes and traditional fixes I by the affine combination between Tag and mediumNFragment, will
Tag replaces with a Cys and uses Cys to fix affinity ligand I with the mode of chromatography microsphere covalent cross-linkingN *.It is demonstrated experimentally that it is this
The purification system purification result of novel affinity purification medium mediation is analyzed through SDS-PAGE and is obtained single target protein band,
Through determination of protein concentration and to calculate purification efficiency be 50.9%.After the repeated use of affinity purification medium 40 times, purification efficiency does not has
It is decreased obviously, illustrates that the affinity purification medium that the present invention builds has preferable purification effect and higher recycling rate of waterused.
It should be noted that above example is only in order to illustrate technical scheme and unrestricted, although with reference to preferably
The present invention has been described in detail by embodiment, it will be understood by those within the art that, can be to the technology of the present invention
Scheme is modified or equivalent, and without deviating from the spirit and scope of technical solution of the present invention, it all should be contained at this
In the middle of bright right.
Claims (10)
1. an affinity ligand, it is characterised in that: the structure of affinity ligand is to NpuDnaE-N, i.e. INStructure transform
On the basis of carry out, improved INThe named I of fragmentN *；Wherein,
Natural INC end add a cysteine, for and chromatography microsphere covalent bond；
Natural INN end first place aminoacid introduce sudden change Cys1Ala, it is to avoid the generation of N end cleavage reaction；
His-tag is placed in natural INThe N end of fragment, for purification ligand fragment.
Affinity ligand the most according to claim 1, it is characterised in that: described natural NpuDnaE gene order template such as sequence
Shown in list SEQ ID No.3.
Affinity ligand the most according to claim 2, it is characterised in that: described His-tag is placed in natural INThe N end of fragment, prominent
Become Cys1Ala, natural INC end add a cysteine, its gene order as shown in sequence table SEQ ID No.4, its egg
White matter sequence is as shown in sequence table SEQ ID No.6.
4. the construction method of the affinity ligand as described in claims 1 to 3 is arbitrary, it is characterised in that: to natural breaking type
The N end montage domain of intein NpuDnaE carries out molecular modification, improved INThe named I of fragmentN *, including,
At natural INC end add a Cys；
At INThe N end of fragment adds His-tag sequence；
Primer addsNdeTwo restriction enzyme sites of I, Hind III also utilize it by IN *Fragment inserting expressioning carrier pET28a,
The albumen obtained is affinity ligand fragment.
The construction method of affinity ligand the most according to claim 4, it is characterised in that: described primer, wherein, IN *Sequence changes
The upstream and downstream primer gene order made is respectively as shown in sequence table SEQ ID No.1 and SEQ ID No.2.
6. according to the construction method of the affinity ligand described in claim 4 or 5, it is characterised in that: also include,
The structure of recombinant bacterium, carries out PCR with pRSFDuet-1-NpuDnaE plasmid for template, it is thus achieved that improved fragment IN *, profit
With carrier pMD19-T construction recombination plasmid pMD19-T-IN *, transformed competence colibacillus E.coli JM109, then utilize Nde I and
The I that two restriction enzyme sites of Hind III will buildN *Sequence carries out enzyme action with expression plasmid pET-21b and is connected, and obtains restructuring table
Reach plasmid pET-21b-IN *, last transformed competence colibacillus E.coli BL21 (DE3), obtain improved restructuring IN *Expression strain
E.coli BL21(DE3)/pET-21b-IN *；
NpuDnaEIN *Expression and purification, to recombinant bacterium E.coli BL21 (DE3)/pET-21b-IN *Carry out abduction delivering, it is thus achieved that
Improved restructuring IN *Albumen.
The construction method of affinity ligand the most according to claim 6, it is characterised in that: with restructuring IN *Albumen matches
ICThe gene order of-GFP fragment and protein sequence are as shown in sequence table SEQ ID No.5 and SEQ ID No.7.
8. utilizing the affinity chromatography medium that the affinity ligand coupling as described in claims 1 to 3 is arbitrary obtains, its feature exists
In: with IN *Fragment is affinity ligand, by activation intermediate arm covalent coupling to agarose microbeads, is formed ICFusion protein has
The affinity chromatography medium of affinity interaction, its structure is agarose microbeads-activation intermediate arm-IN *Affinity ligand:
9. the coupling process for preparing of an affinity chromatography medium as claimed in claim 8, it is characterised in that: its method includes,
Use diepoxides BDDE that the agarose containing hydroxyl is activated, obtain containing one
The activation Epoxy Sepharose of long hydrophilic chain；
Ethylene oxide group on described activation Epoxy Sepharose and IN *The sulfydryl reaction of fragment C end Cys, by affinity ligand fragment
IN *Carry out coupling with the agarose medium after activation and obtain affinity chromatography medium.
10. the application utilizing affinity chromatography medium as claimed in claim 8, it is characterised in that: include,
Affinity chromatography medium is filled post；
With containing 1mmol/L Zn2+PBS be balanced；
By the I containing destination proteinCFusion protein study carries out loading；
With without Zn2+PBS be carried out；
Chromatography media, left at room temperature 3h is rinsed with the breaking buffer containing 50mmol/L DTT；
With the post-rift target protein of elution buffer eluting and be collected；
IN *Affinity column regenerates.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610749025.0A CN106317227B (en) | 2016-08-29 | 2016-08-29 | Affinity ligand, construction method, affinity chromatography medium, preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610749025.0A CN106317227B (en) | 2016-08-29 | 2016-08-29 | Affinity ligand, construction method, affinity chromatography medium, preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106317227A true CN106317227A (en) | 2017-01-11 |
| CN106317227B CN106317227B (en) | 2019-04-12 |
Family
ID=57788197
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610749025.0A Active CN106317227B (en) | 2016-08-29 | 2016-08-29 | Affinity ligand, construction method, affinity chromatography medium, preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106317227B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108410898A (en) * | 2018-03-09 | 2018-08-17 | 江南大学 | A kind of artificial reconstructed DNA molecular, plasmid vector and preparation method thereof |
| TWI671314B (en) * | 2018-06-29 | 2019-09-11 | 國立清華大學 | Control self-cleavage protein activity and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103214563A (en) * | 2013-03-26 | 2013-07-24 | 江南大学 | Performance improved recombination staphylococcus aureus protein A affinity ligand and construction method thereof |
| CN103586008A (en) * | 2013-10-24 | 2014-02-19 | 中国科学院过程工程研究所 | Affinity chromatography medium and preparation method and application thereof |
-
2016
- 2016-08-29 CN CN201610749025.0A patent/CN106317227B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103214563A (en) * | 2013-03-26 | 2013-07-24 | 江南大学 | Performance improved recombination staphylococcus aureus protein A affinity ligand and construction method thereof |
| CN103586008A (en) * | 2013-10-24 | 2014-02-19 | 中国科学院过程工程研究所 | Affinity chromatography medium and preparation method and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| MIGUEL RAMIREZ等: "Engineering split intein DnaE from Nostoc punctiforme for rapid protein purification", 《PROTEIN ENGINEERING, DESIGN & SELECTION》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108410898A (en) * | 2018-03-09 | 2018-08-17 | 江南大学 | A kind of artificial reconstructed DNA molecular, plasmid vector and preparation method thereof |
| TWI671314B (en) * | 2018-06-29 | 2019-09-11 | 國立清華大學 | Control self-cleavage protein activity and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106317227B (en) | 2019-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Blum et al. | Feruloyl esterase activity of the Clostridium thermocellum cellulosome can be attributed to previously unknown domains of XynY and XynZ | |
| Girfoglio et al. | Cellulose degradation by Sulfolobus solfataricus requires a cell-anchored endo-β-1-4-glucanase | |
| CN103214563B (en) | A kind of recombination staphylococcus aureus albumin A affinity ligand of improvement in performance and construction process thereof | |
| CN111423486A (en) | Renaturation method of new type coronavirus recombinant protein inclusion body | |
| CN109266633A (en) | Carbohydrate binding module and its application in immobilised enzymes preparation and fusion protein purification | |
| CN103952473A (en) | UDP-glucuronic acid decarboxylase gene function detection | |
| CN102994601B (en) | Method for preparing collagen small peptide by utilizing marine collagenase MCP-01 | |
| CN106317227A (en) | Affinity ligand, construction method, affinity chromatography medium, preparation method and application | |
| CN102174532A (en) | Application of family 3 cellulose binding domain serving as affinity tag for expression and purification of recombinant protein in eukaryote | |
| CN105296506A (en) | Target protein expression with laetiporus sulphureus mushroom lectin N-acetyllactosamine binding domain as fusion tag and purification method thereof | |
| CN108059684A (en) | A kind of bovine viral diarrhoea recombinant protein, its preparation method and application | |
| US6407208B1 (en) | Chimeric proteins with a cellulose binding domain | |
| CN105255931A (en) | Virus receptor capture system based on bacterial surface display system | |
| CN103045565A (en) | High glucose resistance beta-glucosidase-CBD fusion enzyme, and expression gene and application thereof | |
| US11884954B2 (en) | Protein complex based on DNA enzymes of E family of Escherichia coli and application thereof in artificial protein scaffolds | |
| Han et al. | The increased efficiency of porphyran hydrolysis by constructing a multifunctional enzyme complex from marine microorganisms | |
| Stern et al. | Insights into enhanced thermostability of a cellulosomal enzyme | |
| CN105132400A (en) | Enzyme with function of catalyzing formaldehyde for synthesis of 1,3-dihydroxyacetone and preparation method of enzyme | |
| CN108424441A (en) | A kind of refolding method of ribonuclease inhibitor inclusion body | |
| CN107603965A (en) | Acid starch enzyme mutant that heat endurance improves and its preparation method and application | |
| CN103060359A (en) | Method for purifying recombinant protein with shortened L2 protein tag adopted | |
| CN105950593A (en) | Prokaryotic recombinant expression and preparation method of lysyl endopeptidase | |
| CN106148317A (en) | The multi-layer oriented process for fixation of a kind of protein based on grappling mechanism of attachment | |
| CN105368856A (en) | Improved specific activity mutant thermophilic thermophilic alkaline pectate lyase gene, engineering bacterium, enzyme and their application | |
| TWI712691B (en) | Dextran affinity tag and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |