CN106282370B - Primer special for identifying mating type determinant gene of morchella and fruiting capacity prediction method - Google Patents
Primer special for identifying mating type determinant gene of morchella and fruiting capacity prediction method Download PDFInfo
- Publication number
- CN106282370B CN106282370B CN201610834380.8A CN201610834380A CN106282370B CN 106282370 B CN106282370 B CN 106282370B CN 201610834380 A CN201610834380 A CN 201610834380A CN 106282370 B CN106282370 B CN 106282370B
- Authority
- CN
- China
- Prior art keywords
- morchella
- mat1
- seq
- fruiting
- type
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of molecular identification, and particularly relates to a primer special for identifying mating type determining genes of morchella and a fruiting capacity prediction method. The technical problem to be solved by the invention is that whether the morchella strain has fruiting capacity is difficult to judge before planting. The technical scheme for solving the technical problems is to invent a special primer for identifying two mating type genes of the morchella for the first time. The method can ensure that the fruiting capacity of the morchella is confirmed before cultivation, and avoid unnecessary loss caused by incapability of fruiting.
Description
Technical Field
The invention belongs to the technical field of molecular identification, and particularly relates to a morchella mating type decision gene, a mating type identification special primer and a fruiting capacity prediction method of morchella.
Background
The morchella is a delicious edible fungus in ascomycetes, the sporocarp of the morchella contains 7 amino acids necessary for human bodies, and the morchella is sweet, cold and non-toxic, and has the drug effects of benefiting intestines and stomach, reducing phlegm and regulating qi. The toadstool is quite rich in nutrition, and according to determination, the toadstool contains 20% of crude protein, 26% of crude fat, 38.1% of carbohydrate and various amino acids, particularly the content of glutamic acid is as high as 1.76%. Therefore, it is considered to be a "very good protein source" and is also known as "meat in vegetable". Since the morchella is popular with consumers and is in short supply, the demands of morchella consumer markets can not be met by collecting wild morchella. Therefore, in recent years, a lot of techniques for artificially cultivating morchella have appeared, for example, the cultivation methods described in patent and application publication nos. CN103583232B, CN103202177B, and CN101628834B and CN 35 103782802A, CN103583240A, and CN 101053302. However, in the production practice, the fruiting of artificially cultivated morchella is unstable. Currently, a plurality of morchella strains are produced in an artificial cultivation mode, and a large number of newly bred strains are put into morchella production every year to replace degenerated old strains. In quite a few cases, the planted morchella strains eventually fail to produce mushrooms, resulting in almost no grain harvest by growers. The mating type loss of the morchella strains also plays an important role in removing the improper field management, which causes the improper lighting, temperature, moisture, ventilation and other factors.
Most fungi, including morchella, have hyphae of two mating types, which play a role in sexual reproduction as a female and a male, respectively. In Morchella, the two mating types are MAT1-1-1 and MAT1-2-1, respectively. The morchella can complete the sexual reproduction process similar to male and female mating and successfully grow fruiting bodies (fruiting) only when MAT1-1-1 and MAT1-2-1 hyphae exist at the same time. Therefore, the morchella strains which can successfully produce the mushrooms need to have two types of hyphae, namely MAT1-1-1 and MAT 1-2-1. When the morchella strains are stored for a long time and repeatedly passaged, the strains are easy to degenerate, and two possible results are caused: (1) the degeneration and disappearance of any one of two hyphae of MAT1-1-1 and MAT1-2-1 types, (2) the gene mutation causes the transformation of MAT1-1-1 type to MAT1-2-1 type or the transformation of MAT1-2-1 type to MAT1-1-1 type. Both changes can cause that the morchella strains originally having hyphae with two mating types of MAT1-1-1 and MAT1-2-1 only have one mating type and cannot complete the sexual reproduction process, thereby causing the failure of fruiting. The invention urgently needs to develop a technology for judging whether the morchella strains have fruiting capacity before planting.
Disclosure of Invention
The technical problem to be solved by the invention is that whether the morchella strain has fruiting capacity is difficult to judge before planting. The technical scheme for solving the technical problems is to provide a primer pair for amplifying the mating type genes of the morchella on the basis of first finding and separating two mating type genes of the morchella.
Furthermore, the nucleotide sequences of the primer pair are shown as SEQ ID No.7 and SEQ ID No.8, and SEQ ID No.9 and SEQ ID No. 10.
The invention also provides the application of the primer pair in identifying the mating type of the morchella strain on the basis of the scheme.
Meanwhile, the invention provides a method for identifying the mating type of the morchella strains. The method comprises the following steps:
a. extracting total DNA of morchella mycelium;
b. performing PCR amplification by using the primer pair;
c. according to the amplification product, the morchella mycelium is judged to be MAT1-1-1 type mycelium, MAT1-2-1 type mycelium or both MAT1-1-1 and MAT1-2-1 type mycelium.
Wherein, the breaking mode in the step c of the method is as follows: if a fragment of about 1.2-1.5kb in size is amplified by using the primer pairs with the nucleotide sequences shown as SEQ ID No.7 and SEQ ID No.8, the sample has MAT1-1-1 mating type, otherwise, the sample is not; if a fragment of about 0.4-0.6kb in size is amplified using the primer pair whose nucleotide sequences are shown in SEQ ID No.9 and SEQ ID No.10, the sample has MAT1-2-1 mating type, otherwise it is not.
Furthermore, the invention also provides a method for predicting the fruiting of morel, which is characterized by comprising the following steps:
a. extracting total DNA of morchella mycelium;
b. performing PCR amplification by using the primer pair;
c. judging whether Morchella esculenta mycelium is MAT1-1-1 type mycelium, MAT1-2-1 type mycelium or both MAT1-1-1 and MAT1-2-1 type mycelium according to the amplification product;
d. if the morchella mycelium is both MAT1-1-1 and MAT1-2-1 type mycelium, the fruiting can be judged, otherwise, the fruiting can not be judged.
Wherein, the judging method in the step c of the method is as follows: if a fragment of about 1.2-1.5kb in size is amplified by using the primer pairs with the nucleotide sequences shown as SEQ ID No.7 and SEQ ID No.8, the sample has MAT1-1-1 mating type, otherwise, the sample is not; if a fragment of about 0.4-0.6kb in size is amplified using the primer pair whose nucleotide sequences are shown in SEQ ID No.9 and SEQ ID No.10, the sample has MAT1-2-1 mating type, otherwise it is not.
The invention has the beneficial effects that: the invention provides a method for detecting the mating type of morchella esculenta for the first time and a method for predicting whether the morchella esculenta can produce mushroom before cultivation, experiments prove that the method can be used for predicting whether the morchella esculenta can produce mushroom accurately, is beneficial to eliminating the strains with defects in mating types as early as possible in agricultural production, avoids loss caused by blind production, and has good application prospect in production.
The noun explains:
the invention discloses a morchella esculenta: refers to all edible fungi belonging to Morchella (Morchella genus) in fungi, including but not limited to Morchella ladder (Morchella importuna), Morchella hexameina (Morchella sexta), Morchella heptamerina (Morchella septimelata), Morchella conica (Morchella conica), Morchella yellow (Morchella esculenta), Morchella alpina (Morchella elata), Morchella crassa (Morchella elata), and Morchella crassa (Morchella crassipes). The most common species are morchella ladder, morchella hexameiica and morchella esculenta.
The fruiting in the invention refers to the fruiting body of morchella esculenta.
Detailed Description
As the toadstool, the two mating types are MAT1-1-1 and MAT1-2-1 respectively. The morchella can complete the sexual reproduction process similar to male and female mating and successfully grow fruiting bodies (fruiting) only when MAT1-1-1 and MAT1-2-1 hyphae exist at the same time. Therefore, the morchella strains which can successfully produce the mushrooms need to have two types of hyphae, namely MAT1-1-1 and MAT 1-2-1. When the morchella strains are stored for a long time and repeatedly passaged, the strains are easy to degenerate, and two possible results are caused: (1) the degeneration and disappearance of any one of two hyphae of MAT1-1-1 and MAT1-2-1 types, (2) the gene mutation causes the transformation of MAT1-1-1 type to MAT1-2-1 type or the transformation of MAT1-2-1 type to MAT1-1-1 type. Both changes can cause that the morchella strains originally having hyphae with two mating types of MAT1-1-1 and MAT1-2-1 only have one mating type and cannot complete the sexual reproduction process, thereby causing the failure of fruiting.
In Morchella, mating types of hyphae MAT1-1-1 and MAT1-2-1 are controlled by genes mrlmaMAT 1-1-1 and mrlmaMAT 1-2-1, respectively. The hyphae with mrlmamat 1-1-1 gene is MAT1-1-1 mating type, and the hyphae with mrlmamat 1-2-1 gene is mrlmamat 1-2-1 mating type.
The invention discovers the sequences of morchella mrlbat 1-1-1 and mrlbat 1-2-1 genes for the first time. The complete DNA sequence of mrlMAT1-1-1, mrlMAT1-2-1 genes contains upstream and downstream non-expressed sequences and introns, see SEQ ID No.1 and SEQ ID No. 2. In the sequences listed below, upstream and downstream non-expressed sequences are underlined, and introns are boxed (unless otherwise specified, all nucleic acid sequences of the present invention are in 5 'to 3' order).
The complete DNA sequence of mrlmaT1-1-1 gene (SEQ ID No. 1):
ATCACCGACGAGAGCACGCTGCTCACTGGGTTTTCCCTTACTTTACATGCATTTCCTGACACATACAA CCTTTTATCAACGGTACACTTCAATAAAGTAGAGTCTACTAAGGCTCTCTTGTGCCCCTTTTGACTATTATTTCTA TCCTTCTATTTTATCTTCATGTCACTCCGTCCGGTTTACCTTACTGGACTGGTTCGTGAGAACCCGCCTTCTGAGTCCGTTATGCTCATGGACGCTATAAAGCGGACTCTTTGTCTTCGTAACGCCACTTTGGGTTGCGCTCTCTATCTCTCGAAAACCCATCAATACCTTTTAATGCAAGACCGAGGCGGTGGAATCTGGGTTCAACACAAAGACTGTCGATATATTGTGCCCCCACCAGGAGGGTCGGTATTTCAGGTGCAGGGCAGGCCCCTCCCGTTCCAGAGATGGCTCACTCTTATGCATCGACTTGTACGTCAGGATGGAAGGGTTGGGCTAGACCCTAAGATCCCATACAAGTGCGCAGTCCAAAGGCTTTATGGTGAACACTACAAGAGTAATAGGCCGATTGTTGATGAACCGTTGACTAAACGGTCTGTTTTGAAAGCCCTAAACCCTTATATAGCACATAGAA
CTTGGATATCAAAATTCCTAGGAGGGCTAGGATTTACCCAGATGCTGATTTCAGCACTCACCAAAGGTGTATGGCAACGTGAGAAGAGGAAAGCTATGTGGTCCAATATAGCAAGGTTGTACACCTACCACCGGGATCAAGGGACGCTCACATCTACTCTCGAAGATTTTATCAAAGCGCAACTTATCGAGAATAAACAAGATCCTTCCCCTAGCTCATTCCTACACAACTGCGGTATAAATCTCGACGATGTGAGAAAACGAATGACACCCACTTGCATTCCACCTGATGCTCAAATCTTTGCTATTGGGACTGTGGCACCCATCGAGGAGACTTATTCTGGGATTCAAGATATTCCAAATGTTCACTTTCAAGCGCCTACAGTTCCTGACTCTACCGCCATGGAATCTGCCAAAACGGAGCCCATTATAATGTCGCCCATATCAACTATATGTACGGTATCGAAGGATTATATTTCGTCTCGAGCTCGGCAGAGAAGCAGGAAAACAATTGCACGCTCGGAATTAACAGGAATTACCCCTCAAGACGCATGTCAAAACGCTCTATCGCCACCAGCTCTCCCAACTTCTCAACAATCCATCTCCAATCAAATGCTTGTAGATCCTCCTCAGGACTGGAATTCTATGACCCCAGTCGCTTACAATACGAATCAGCTCGATCCAAGATTGAACTTTTTACCCATTAAACCGCTTCCTGGGAGGCTGCCCGCTTTTGATAAGACCCTCCGAGAGCCAGGGACATACCCAGAGCCAGAGATATACCCAGAACCAGATACATATTCAGAATCACGACATTTCCAGGAGTCACAGTTTTATCCACAACAAATTTTTTCTAGCGGGTTAAAATTCTGTATAAGCCCAAAGTCTGATGTAGAACCACGGACATATACAGCTCCCAACATTTATCCAGAACCTTATACTCTTAGACCTGAAAACGCAACTTCGCAGGTATTTCATGGGATATATAATCCCCAAAATATGGAAATTGAAGAGCCTTTCGATTTTACAAAAG
AAAATACATATTTCGTTTCGGAAACCTACACCTCCAAAGACTTTCCACAGCCTCAATCACAGACATTCCAGGAGTTCGTAAACTAG
GACCACACTACAGTACAAGG ACATTAAATTGAAGTAAACGTATCTCATGTTTTATAATTACTTTGTTTTGCTTGTTTCACATGGCTGGTAGATATAT CGTCATTTTAAAACGTTTGAGCGGCCATTACGCTCAATCTGATTTGTCAAACCAGCTACTTATATATATGTGCTATA TAACTA
the complete DNA sequence of mrlmaT1-2-1 gene (SEQ ID No. 2):
ATTTTCTGCCATTTATAACATATATATATAAATCAAACCTATTTCGACGTATATCAACCACGCCCGTA ATTTCTTCGATCTTTACTATTCCGGTCACCTCTTTGAAACATCTTATTCTGTTAGCCGCCCATCTCTGAGCTTTTT CTACTCTTACCACCCTATCAGTTCATCGATAAAGAGGTTCCATGTTTCCAGGCCTCCAAAAGCCTGGGTTGCGTCCGAAGAATAGCTCTACTCTTCGGCCAGAACAGATGCTCGAAGAAGCTATGGGTCATATCAATCAGAGCTTTGCCAATTCAAATGAAAAGACCGCTTTAGATAGATTGGCAGGACTTAAACCTCGCCGTGACCCTCCTTCTTTCGATTTCACTGGATCAGACGGCCATATCCTGAGAGTTAAGGTTTTATCTCTGGACCAACGAGGGCCAGGGAAAGAAAGTGATGACCATGGGCCCCAAACATTTACTGTTTTAGAAAAAACCAACCATATAAACGGTTATCCTTGTGTTAAGACCAATGAGGGTGATCTGGTCTTCGTTTATGACTCTACTGTCACTTCTGCAGAAACAATTTACCAAGGCCATGGAAATTTTGTGGATCCACAGCTGTCAGCGCAAGGCGTGAGTCGAGTTACCAAGAAGAATTTATTAGAGCATGTTCCTCGTCCTATGAATGC
TTTTATAATCTATCGCAACACAGAGATGAAGGCTGTTCGCCAGAAATACCCGGGGATTGGGAACAACGATGTTTGTAGGTTTTTTGTTGCTCATTTATCCTTCAGAATCTGA
TAATATGTGTTCGTTTTGGGCCT TTTGATTATTTTATTGACAATTTACGTTGTAGCGCGGATTGTCGGGCAACGGTGGCGAGAGCTTGACCCTAAGATTA GAGAGCATTACAAGGTGAATTAAAACAATCACTTCTTCAAGTAAATATGCTCATATTGCTAATCTAGAAAAGGATTT GGCCGCAAAATCTGCACGAGAGCACCACGTAA
meanwhile, CDS sequences exist in the mrlmaMAT 1-1-1 gene and the mrlmaMAT 1-2-1 gene of the morchella esculenta. The CDS sequence of mrlmaT1-1-1 gene is shown in SEQ ID No. 3. The CDS sequence of mrlmamat 1-2-1 gene is shown in SEQ ID No. 4.
Polypeptide sequences of mating type determinants coded by mrlmamat 1-1-1 gene and mrlmamat 1-2-1 gene of morchella are also found. The amino acid sequence of the protein product coded by mrlmamat 1-1-1 gene is shown in SEQ ID No. 5.
The amino acid sequence of the protein product coded by mrlMAT1-2-1 gene is shown in SEQ ID No. 6.
On the basis of the above inventive work, the applicant further obtained and examined mrlMAT1-1-1 and mrlMAT1-2-1 genes of a plurality of edible species of morchella, and found that the genes share a conserved sequence. Wherein, mrlmamat 1-1-1 shown in SEQ ID No.1 and mrlmamat 1-2-1 gene sequences shown in SEQ ID No.2 belong to morchella ladder and morchella hexameina, and the two gene sequences are the same. It is also found that the morchella strains have mrlMAT1-1-1 and 1-2-1 gene sequences which are highly conserved, the similarity between different strains, mrlMAT1-1-1, is 98.1-100%, and the similarity between different strains, mrlMAT1-2-1, is 99.4-100%. On the basis, a set of primer pairs is obtained through research, and the primer pairs are used for amplifying the full-length primer pairs of genes as far as possible on the premise that multiple sections of conserved sequences can be selected as primer design sites. The primer pair obtained by the invention can detect whether a target gene exists or not and whether the length of the target gene is normal or not, so that the condition that partial fragments of the gene are deleted possibly due to mutation, and the mrlMAT1-1-1 or mrlMAT1-2-1 gene products lose normal functions is conveniently detected. The set of primer pairs comprises a primer pair MrlMAT1-1-1F, MrlMAT1-1-1-R for specifically amplifying mrlt MAT1-1-1 gene and a primer pair MrlMAT1-2-1-F, MrlMAT1-2-1-R for specifically amplifying mrlt MAT1-2-1 gene.
MrlMAT1-1-1F(SEQ ID No.7)：ATGGCTCACTCTTATGCATCGACTTGTAC
MrlMAT1-1-1-R(SEQ ID No.8)：GGCTGTGGAAAGTCTTTGGAGGTGTAG
MrlMAT1-2-1-F(SEQ ID No.9)：AAGACCGCTTTAGATAGATTGGCAGGAC
MrlMAT1-2-1-R(SEQ ID No.10)：AACAGCCTTCATCTCTGTGTTGCGATAG
The primers can be used for identifying the mating type of the morchella mycelium by a PCR method: is MAT1-1-1 type hyphae, MAT1-2-1 type hyphae, or both MAT1-1-1 and MAT1-2-1 type hyphae.
However, when the mating type of morchella is identified by using the PCR method, the specific steps and details of PCR, such as extraction of DNA template, setting of PCR procedure, selection of primer annealing temperature, etc., vary according to the reagent products of different manufacturers, but are all basic works that can be easily completed by those skilled in the art under the guidance of the prior art, for example, refer to various textbooks, instructions of kits, molecular biology manuals, etc., and details thereof are not repeated in the present invention.
The inventor identifies the mating types of the toadstool strains, checks whether the toadstool strains have two mating types at the same time, predicts whether the toadstool strains can successfully grow mushroom, and thereby identifies the quality of the home-made or commercially-made toadstool strains.
When the primer pair MrlMAT1-1-1F, MrlMAT1-1-1-R is used for amplifying the morchella sample, a fragment with the size of about 1.2-1.5kb is amplified, and the sample has MAT1-1-1 mating type. If there is no band, the sample does not have MAT1-1-1 mating type.
When the morchella sample is amplified by using a primer pair MrlMAT1-2-1-F, MrlMAT1-2-1-R, a fragment with the size of about 0.4-0.6kb is amplified, and the sample has MAT1-2-1 mating type. If there is no band, the sample does not have MAT1-2-1 mating type.
And when the toadstool strain has two mating types of MAT1-1-1 and MAT1-2-1, judging that the strain can successfully produce mushroom, namely the strain is qualified. When the strain only has one mating type of MAT1-1-1 or MAT1-2-1, the strain is judged to be incapable of fruiting successfully, namely the strain is unqualified.
The present invention will be described in further detail below by using examples of the present invention for fruiting ability prediction and result verification in morchella cultivation practice.
Example I, the method of the invention is used for predicting whether the morchella strains can produce mushroom
The purpose is as follows: and (3) identifying the mating types of the 5 strains of the morchella, and predicting whether morchella strain products respectively prepared from the 5 strains can be fruiting or not.
Time: the time for prediction according to the PCR result is 9 months in 2014, and the actual fruiting time is 3 months in 2015.
A place: new city district of Sichuan province
Wherein A, B, C is the Morchella strain owned by the inventor unit itself, D, E is the strains from two commercially available Morchella species. A. B is Morchella ladder (Morchella importuna), C, D is Morchella hexameicola (Morchella sextetata), and E is Morchella heptacola (Morchella septimelata).
In the results table, the PCR amplification product was filled with "√" in some cases and "X" in none cases. See table 1 for results.
Sampling: taking a proper amount of hypha of the morchella strain to be detected in an aseptic operation, inoculating the hypha into a 250 ml triangular flask containing 25ml of potato juice glucose culture solution (the preparation method of every 1000 ml of culture solution comprises the steps of weighing 200g of potatoes, cleaning, peeling, cutting into small pieces, adding water, boiling for 20-30 minutes, and being capable of being punctured by a glass rod), filtering by using eight layers of gauze, heating, adding 20g of glucose, stirring uniformly, slightly cooling, and then supplementing water to 1000 ml), and standing and culturing for 7 days at 20 ℃ to obtain a hypha sample.
The extraction process comprises the following steps: total DNA was extracted using a fungal genome DNA rapid extraction kit (product No. SK8229) from Shanghai, and used as a PCR template.
PCR procedure to identify MAT 1-1-1:
q5 from NEB was used
TMHot Start High-Fidelity 2X Master Mix was amplified. Each 20 microliter reaction system contains 1 microliter of total DNA of Morchella esculenta, 1 microliter of primer shown in Seq NO.7, 1 microliter of primer shown in Seq NO.8, 7 microliter of distilled water and 10 microliter of Q5
TMHot Start High-Fidelity 2X Master Mix。
PCR procedure:
the reaction time is 2 minutes at the temperature of 98 ℃,
98 degrees for 30 seconds, 60 degrees for 20 seconds, 72 degrees for 45 seconds (cycle 30 times),
the temperature of the mixture is 72 ℃ for 2 minutes,
PCR procedure to identify MAT 1-2-1:
q5 from NEB was used
TMHot Start High-Fidelity 2X Master Mix was amplified. Each 20 microliter reaction system contains 1 microliter of total DNA of Morchella esculenta, 1 microliter of primer shown in Seq NO.9, 1 microliter of primer shown in Seq NO.10, 7 microliter of distilled water and 10 microliter of Q5
TMHot Start High-Fidelity 2X Master Mix。
PCR procedure:
the reaction time is 2 minutes at the temperature of 98 ℃,
98 deg. 30 sec, 64 deg. 20 sec, 72 deg. 20 sec (cycle 30 times)
72 degrees 2 minutes.
The PCR products were detected electrophoretically on a gel containing 1% agarose. Positive for the appearance of the corresponding band.
TABLE I.5 mating type identification results of Morchella esculenta
The strains are cultivated according to the published high-efficiency cultivation mode and technology of Morchella esculenta in Sichuan (edible and medicinal fungi, volume 24, No.3, page 151-154) and fruiting bodies are fruiting when harvested and not fruiting when 0 fruiting body is produced. The results of the experiment are shown in Table 2.
And the second table shows the prediction of the fruiting of 5 morchella species products and the actual fruiting condition.
| Strain number | Identification as mating type | Predicting if mushroom can be grown | Whether the mushroom actually appears |
| A | MAT1-1 only | Predicted failure to produce mushroom | Not fruiting |
| B | MAT1-1-1 and MAT1-2-1 | Predicted fruiting ability | Fruiting body |
| C | MAT1-1-1 and MAT1-2-1 | Predicted fruiting ability | Fruiting body |
| D | MAT1-2-1 only | Predicted failure to produce mushroom | Not fruiting |
| E | MAT1-1-1 and MAT1-2-1 | Predicted fruiting ability | Fruiting body |
Therefore, the accuracy rate of predicting whether the morchella strains can be fruiting or not by identifying the mating types reaches 100%. If the method is put into production blindly without identifying mating types according to the traditional mode, 2 strains in 5 strains can not produce mushrooms, the risk probability is 40%, and great economic loss can be brought to growers.
Example II, predicting whether Morchella strains can produce mushrooms by using the method of the invention
The purpose is as follows: and (3) identifying the mating types of the 12 strains of the morchella esculenta, and predicting whether the morchella esculenta strain products prepared from the 12 strains can be fruiting or not.
Time: the time for prediction according to the PCR result is 2015 for 10 months, and the actual fruiting time is 2016 for 4 months.
A place: asarum, Sichuan province
Wherein M1-M8 are the strains owned by the unit itself, and S1-S4 are strains from four commercially available Morchella species. M1-M4 are Morchella esculenta, M5-M8 are Morchella ladder, S1 are seven sisters of Morchella esculenta, S2 are Morchella ladder, S3 is Morchella crassipes, S4 is six sisters of Morchella crassipes
See example one for a specific test method.
PCR amplification products were filled with a "√" pattern in the case of the product and a "×" in the case of the product. In the results table, the PCR amplification product was filled with "√" in some cases and "X" in none cases. See table 2 for results.
TABLE III.12 mating type identification results of Morchella esculenta
The strains are cultivated according to the published high-efficiency cultivation mode and technology of Morchella esculenta in Sichuan (edible and medicinal fungi, volume 24, No.3, page 151-154) and fruiting bodies are fruiting when harvested and not fruiting when 0 fruiting body is produced. The results are shown in Table 4.
Fourth table prediction of fruiting of 12 Morchella species products, and actual fruiting status
Therefore, the accuracy rate of predicting whether the morchella strains can be fruiting or not by identifying the mating types reaches 100%. If the method is put into production blindly according to the traditional mode without identifying mating types, 5 strains in 12 strains can not produce mushrooms, the risk probability is 42%, and great loss can be brought to growers.
Claims (6)
1. The primer group for amplifying the mating type gene of the morchella esculenta is characterized in that:
the primer group consists of a primer pair with nucleotide sequences shown as SEQ ID No.7 and SEQ ID No.8 and a primer pair shown as SEQ ID No.9 and SEQ ID No. 10.
2. Use of the primer set of claim 1 for identifying the mating type of a morchella strain.
3. A method for identifying the mating type of a morchella strain is characterized by comprising the following steps:
a. extracting total DNA of morchella mycelium;
b. performing PCR amplification using the primer set of claim 1;
c. according to the amplification product, the morchella mycelium is judged to be MAT1-1-1 type mycelium, MAT1-2-1 type mycelium or both MAT1-1-1 and MAT1-2-1 type mycelium.
4. The method of claim 3, wherein: the judging mode is as follows: amplifying a fragment with the size of 1.2-1.5kb by using a primer pair with nucleotide sequences shown as SEQ ID No.7 and SEQ ID No.8, indicating that the sample has MAT1-1-1 mating type, and if not, carrying out negative amplification; a0.4-0.6 kb fragment was amplified using the primer set having the nucleotide sequences shown in SEQ ID No.9 and SEQ ID No.10, indicating that the sample had MAT1-2-1 mating type, and vice versa.
5. The method for predicting the fruiting of the morchella is characterized by comprising the following steps of:
a. extracting total DNA of morchella mycelium;
b. performing PCR amplification using the primer set of claim 1;
c. judging whether Morchella esculenta mycelium is MAT1-1-1 type mycelium, MAT1-2-1 type mycelium or both MAT1-1-1 and MAT1-2-1 type mycelium according to the amplification product;
d. the morchella mycelium is both MAT1-1-1 and MAT1-2-1 type mycelium, and is judged as fruiting-capable, otherwise, is judged as non-capability.
6. The method of claim 5, wherein: the judging mode is as follows: amplifying a fragment with the size of 1.2-1.5kb by using a primer pair with nucleotide sequences shown as SEQ ID No.7 and SEQ ID No.8, indicating that the sample has MAT1-1-1 mating type, and if not, carrying out negative amplification; a0.4-0.6 kb fragment was amplified using the primer set having the nucleotide sequences shown in SEQ ID No.9 and SEQ ID No.10, indicating that the sample had MAT1-2-1 mating type, and vice versa.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610834380.8A CN106282370B (en) | 2016-09-20 | 2016-09-20 | Primer special for identifying mating type determinant gene of morchella and fruiting capacity prediction method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610834380.8A CN106282370B (en) | 2016-09-20 | 2016-09-20 | Primer special for identifying mating type determinant gene of morchella and fruiting capacity prediction method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106282370A CN106282370A (en) | 2017-01-04 |
| CN106282370B true CN106282370B (en) | 2020-02-11 |
Family
ID=57713170
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610834380.8A Active CN106282370B (en) | 2016-09-20 | 2016-09-20 | Primer special for identifying mating type determinant gene of morchella and fruiting capacity prediction method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106282370B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107151698B (en) * | 2017-04-01 | 2020-10-02 | 中国科学院昆明植物研究所 | Method for identifying mating types of eleven black morchella flora |
| CN109628625B (en) * | 2018-12-07 | 2022-08-12 | 东莞东阳光保健品研发有限公司 | Specific primer, kit and method for identifying morchella esculenta and application of specific primer, kit and method |
| CN109628626B (en) * | 2018-12-07 | 2022-07-26 | 东莞东阳光保健品研发有限公司 | Specific primer, kit and method for identifying morchella ladder and application of specific primer, kit and method |
| CN111500759A (en) * | 2020-05-07 | 2020-08-07 | 云南菌视界生物科技有限公司 | Method and primer pair for identifying mating type genes of commercially-cultured morchella species |
| CN113317124A (en) * | 2021-05-17 | 2021-08-31 | 中国科学院昆明植物研究所 | Rapid identification method for fruiting rate of morchella esculenta |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101649350A (en) * | 2009-06-01 | 2010-02-17 | 中国农业大学 | Molecular detection method for rapidly distinguishing mating types of Chinese caterpillar fungus |
| CN102242183A (en) * | 2011-06-16 | 2011-11-16 | 河南科技大学 | Morel strain identifying method |
-
2016
- 2016-09-20 CN CN201610834380.8A patent/CN106282370B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101649350A (en) * | 2009-06-01 | 2010-02-17 | 中国农业大学 | Molecular detection method for rapidly distinguishing mating types of Chinese caterpillar fungus |
| CN102242183A (en) * | 2011-06-16 | 2011-11-16 | 河南科技大学 | Morel strain identifying method |
Non-Patent Citations (2)
| Title |
|---|
| 四川羊肚菌人工栽培的现状分析;彭卫红等;《食药用菌》;20160519;第24卷(第3期);第145-150页 * |
| 黑色羊肚菌复合群的繁殖方式和交配型的差异分布;杜习慧等;《中国菌物学会2016年学术年会论文摘要集》;20160819;第167页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106282370A (en) | 2017-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106282370B (en) | Primer special for identifying mating type determinant gene of morchella and fruiting capacity prediction method | |
| Raper et al. | Schizophyllum commune | |
| CN109097387A (en) | A kind of methods and applications with CRISPR/Cas9 gene editing system initiative purple fruit Tomato mutants | |
| CN110241249B (en) | Primer and method for rapidly detecting pathogen of agaricus bisporus wart spongiform in covering soil | |
| CN106636433B (en) | Mulberry pathogenic bacterium high-throughput identification and species classification method and application thereof | |
| CN103430855A (en) | Low temperature resistance straw mushroom bacterial and breeding method thereof | |
| Dung et al. | Morphological and genetic characteristics of Oyster mushrooms and conditions effecting on its spawn growing. | |
| CN104830698A (en) | Pokkah boeng disease pathogen separating and identifying method | |
| CN102220320B (en) | Specific molecular marker of volvariella volvacea V23 strain as well as obtaining method and application thereof | |
| CN110885758A (en) | New Flammulina finna strain and molecular marker primer and molecular marker method thereof | |
| CN106399529B (en) | A kind of Phyllosticta musarum molecular detection primer and detection method | |
| CN115786384A (en) | Integration site of fusarium venenatum TB01 and application thereof | |
| CN106434381B (en) | Pure white true pleurotus cornucopiae bacterial strain and its molecular labeling, specific primer to and application | |
| CN106834270A (en) | A kind of ion beam mutation splits that lid saddle fungus is full genome mutated and method of orthogenesis | |
| CN108531641B (en) | Method and primer for identifying same-nucleus sterile single spore strain of agaricus bisporus and mating type of agaricus bisporus based on SNP locus difference | |
| CN106244720B (en) | A kind of anthracnose of peach bacterium molecule detection primer and detection method | |
| Kashangura | Optimisation of the growth conditions and genetic characterisation of Pleurotus species | |
| CN103503779A (en) | New pure white hypsizigus marmoreus strain | |
| CN110295245B (en) | SCAR molecular marker identification method of cordyceps sobolifera strain | |
| CN110295221B (en) | RAPD molecular marker identification method for cordyceps sobolifera strain | |
| CN105886647A (en) | Characteristic nucleotide sequence, primer, kit and method for authenticating Flammulina fennae | |
| KR102260717B1 (en) | Composition for identification of a mutant of a Pleurotus ostreatus cap color and identification method using the same | |
| CN106702014A (en) | Peanut focal spot bacterial molecular detection primer and rapid detection method thereof | |
| CN116949085B (en) | Application of straw mushroom Vvpks gene in regulation and control of umbrella opening character | |
| CN113331350B (en) | Aspergillus flavus without producing toxicity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address | ||
| CP03 | Change of name, title or address |
Address after: 610000 zone 2, Shizishan Road, waidong, Chengdu, Sichuan Province Patentee after: Institute of agricultural resources and environment, Sichuan Academy of Agricultural Sciences Address before: No.4 Shizishan Road, Jinjiang District, Chengdu, Sichuan 610066 Patentee before: SOIL AND FERTILIZER Research Institute SAAS |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220602 Address after: No.4 Shizishan Road, Jinjiang District, Chengdu, Sichuan 610066 Patentee after: Sichuan Edible Fungi Research Institute Address before: 610000 zone 2, Shizishan Road, waidong, Chengdu, Sichuan Province Patentee before: Institute of agricultural resources and environment, Sichuan Academy of Agricultural Sciences |