CN106282363A - The detection primer group of a kind of KRAS gene, its reaction system constituted and application - Google Patents

The detection primer group of a kind of KRAS gene, its reaction system constituted and application Download PDF

Info

Publication number
CN106282363A
CN106282363A CN201610799259.6A CN201610799259A CN106282363A CN 106282363 A CN106282363 A CN 106282363A CN 201610799259 A CN201610799259 A CN 201610799259A CN 106282363 A CN106282363 A CN 106282363A
Authority
CN
China
Prior art keywords
reaction system
seq
primer
concentration
kras
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610799259.6A
Other languages
Chinese (zh)
Inventor
汪大为
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Jinqi Biotechnology Co Ltd
Original Assignee
Beijing Jinqi Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Jinqi Biotechnology Co Ltd filed Critical Beijing Jinqi Biotechnology Co Ltd
Priority to CN201610799259.6A priority Critical patent/CN106282363A/en
Publication of CN106282363A publication Critical patent/CN106282363A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to technical field of biological, be specifically related to detection primer group and the reaction system of composition thereof of a kind of KRAS gene, described detection primer group is as follows: forward Outside primer F3:SEQ ID NO:1；Reversely Outside primer B3:SEQ ID NO:2；Forward inner primer FIP:SEQ ID NO:3；Reversely inner primer BIP:SEQ ID NO:4；Peptide nucleic acid(PNA) PNA:SEQ ID NO:5.Step of the present invention is simple, amplified reaction quick, efficient, specificity is high, identify simplicity, makes this technology have broader practice prospect.

Description

The detection primer group of a kind of KRAS gene, its reaction system constituted and application
Technical field
The invention belongs to technical field of biological, be specifically related to a kind of KRAS gene detection primer group, its constitute Reaction system and application.
Background technology
Mammalian genes group generally exists three kinds of RAS Oncogene family members: H-RAS, K-RAS, N-RAS.Wherein, KRAS encodes P21 albumen, plays an important role in growth of tumour cell and angiogenesis signal conduct.It is that EGFR is intracellular The G-protein with GTP enzymatic activity of the catchment of signal transduction path, normal KRAS gene can suppress the life of tumor cell Long, and once occur activity to suddenly change, by the activation of the Mitogen activated protein kinase (MAPK) that causes EGFR to rely on, and And this activation is not by the signals-modulating of upstream EGFR, its consequence is exactly to continue stimulating cellular growth, upsets growth rhythm, finally Lead oncogenic generation.The sudden change of KRAS gene occurs tumor early stage, and the KRAS gene of primary tumor and metastasis is high Degree keeps consistent.It is generally believed that the mutation status of KRAS gene will not change because for the treatment of, therefore detection KRAS gene Sudden change with or without the foundation that can suffer from cancer risk as assessment.The following form in site of KRAS:
The KRAS gene mutation of 90% is positioned at the 12nd and 13 codon sites of 2 exons, Cetuximab (Cetuximab) and Victibix (panitumumab) by suppression EGFR thus play antitumor effectiveness, be remarkably improved knot The survival rate of Patients With Rectal Carcinoma and quality of life, EGFR often has high expressed in colorectal cancer, but finds in actual therapeutic, Either the copy number of EGFR increases or gene mutation, does not all find that the antibody with anti-EGFR is (such as Cetuximab and Pa Ni Monoclonal antibody) curative effect has obvious dependency.But have dependency with KRAS.If there is above several activities sudden change in KRAS, then Can be the drug ineffective of this anti-EGFR, the patient's tumor that there are about 40% has KRAS, and these patients use Cetuximab Or Victibix is invalid.Therefore, it was accomplished by its KRAS being detected, to avoid before patient accepts associated medication therapies Improper medication.
At present, the method for detection KRAS mainly has at PCR-Sanger sequencing, fluorescence quantitative PCR method, and chip is miscellaneous Friendship method and high-flux sequence method etc..Although these methods can detect the sudden change of KRAS to a certain extent, but has Very important limitation, Sanger sequencing sensitivity is low, false-negative result, not only complex operation easily occurs, also needs Want expensive equipment and reagent, be not suitable for promoting；Fluorescence quantitative PCR method has higher sensitivity, but owing to sudden change is to be detected Mutational site is various, needs to design different probes, not only expends reagent, also adds additional operating procedure, and be also relied on In expensive instrument and equipment, so being not clinically for detecting the best means of KRAS；Chip hybridization methods flux is high, But complex operation, its detection also relies on the equipment and instrument of costliness, causes relatively costly；Though high-flux sequence method can be by increasing Adding the order-checking degree of depth to obtain minimal amount of mutant gene, but required instrument and equipment and reagent price are sufficiently expensive, and detect Excessive cycle, the DNA sample quality adding paraffin-embedded tissue extraction is the most poor, can not meet the demand of clinic.
Isothermal duplication (LAMP) technology of ring mediation is a kind of isothermal amplification technique that Japanese Scientists proposed in 2000, It is mainly characterized by 4 special primers of 6 region designs for target gene, at strand displacement archaeal dna polymerase (Bst DNA Polymerase) constant-temperature amplification is carried out under effect, it is only necessary within 15-90 minute, 10 can be produced9-1010The product of the order of magnitude.LAMP Reacting the PCR reaction that is far from the prescription of template DNA strict, therefore the crude extract of DNA just can be directly as detecting mould Plate, has bigger advantage compared with the detection method based on PCR, can remove the cost of DNA extraction and the step of troublesome operation from Suddenly, especially in the detection of great amount of samples, this advantage just becomes apparent from.As reacting with PCR, the reaction of LAMP is also required to The strict pairing of primer 3 end and template, has that sensitivity is high, specificity is good, easy and simple to handle, with low cost and result is prone to judge Advantage.
Summary of the invention
The present invention is in order to overcome the defect of said method, it is provided that the detection primer group of a kind of KRAS, its reactant constituted System and application, described detection system has the advantages such as sensitivity is high, specificity is good and easy and simple to handle.
For reach this invention purpose, the present invention by the following technical solutions:
First aspect, the present invention provides the detection primer group of a kind of drug induced deafness, it is characterised in that described detection primer Organize as follows:
Forward Outside primer F3:SEQ ID NO:1:TGGTGGAGTATTTGATAGTGTA；
Reversely Outside primer B3:SEQ ID NO:2:TCCTGCACCAGTAATATGC；
Forward inner primer FIP:SEQ ID NO:3:AGTCATTTTCAGCAGGCCTTATAATAACCTTATGTGTGACA TGTTCT；
Reversely inner primer BIP:SEQ ID NO:4:GTAGGCAAGAGTGCCTTGACTCTATTGTTGGATCATATTCG TC；
Peptide nucleic acid(PNA) PNA:SEQ ID NO:5:TTGGAGCTGGTGGCGT.
Peptide nucleic acid(PNA) (PNA) is a kind of novel DNA analog, and its molecule feature is with the peptide chain amide sweet ammonia of 2-amino-ethyl Acid instead of the pentose phosphate two fat key skeleton in DNA molecular, and remaining is all identical with DNA.Due to peptide nucleic acid(PNA) skeleton without Negative charge, therefore can more firm must be combined with the DNA of base sequence complementary, owing to this combination is very firm, so that The DNA fragmentation of identical sequence can directly be replaced from former double-stranded DNA by peptide nucleic acid(PNA).But, peptide nucleic acid(PNA) is firm with DNA's In conjunction with the complementarity being highly dependent on therebetween, according to calculating, when there being a unpaired base in PNA, its PNA-DNA The annealing temperature of hybrid can reduce by 20 DEG C, can not match the most completely when there being two mispairing.The present invention is according to this spy of PNA Property, wild type KRAS gene in sample " is embedded " by the PNA primer special by design wild type, so that in system only The KRAS of saltant type is expanded, and then reaches to detect the purpose that in sample, whether the corresponding site of KRAS undergos mutation.The present invention The abundant advantage that must combine LAMP and PNA, develops Kras sudden change a kind of with low cost, highly sensitive and easy and simple to handle Detection kit, may be used for the medicine such as Cetuximab (Cetuximab) and Victibix (panitumumab) clinically Personalized medicine detects.
Preferably, the sequence shown in described SEQ ID NO:1-4 is the 12nd He of the exon for detecting KRAS gene 13 codon sites.
Second aspect, the present invention provides a kind of reaction system detecting drug induced deafness, and described reaction system includes first Primer sets described in aspect, reaction buffer, dNTPs, hydroxynaphthol blue, glycine betaine, Bst archaeal dna polymerase, measuring samples base Because of group DNA and deionized water.
Preferably, described reaction buffer includes Tris-HCl, KCl, (NH4)2SO4, MgSO4And Tween-20.
Preferably, the concentration of described Tris-HCl is 10-30mM, can be such as 10mM, 11mM, 12mM, 13mM, 15mM, 16mM, 18mM, 20mM, 22mM, 23mM, 25mM, 26mM, 28mM or 30mM, preferably 15-25mM, more preferably 20mM。
Preferably, the concentration of described KCl is 10-60mM, can be such as 10mM, 11mM, 12mM, 15mM, 18mM, 20mM, 23mM, 25mM, 30mM, 35mM, 40mM, 45mM, 50mM, 51mM, 52mM, 53mM, 54mM, 55mM or 60mM, be preferably 50-55mM, more preferably 50mM.
Preferably, described (NH4)2SO4Concentration be 5-13mM, can be such as 5mM, 6mM, 7mM, 8mM, 9mM, 10mM, 11mM, 12mM or 13mM, preferably 8-12mM, more preferably 10mM.
Preferably, described MgSO4Concentration be 2-8mM, can be such as 2mM, 3mM, 4mM, 5mM, 6mM, 7mM or 8mM, It is preferably 2-6mM, more preferably 4mM.
Preferably, the volume fraction of described Tween-20 is 0.1-1%, can be such as 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9% or 1%, preferably 0.1%.
Preferably, the concentration of described dNTPs is 1-2mM, can be such as 1mM, 1.1mM, 1.2mM, 1.3mM, 1.4mM, 1.5mM, 1.6mM, 1.7mM, 1.8mM, 1.9mM or 2mM, preferably 1.2-1.8mM, more preferably 1.4mM.
Preferably, the concentration of described hydroxynaphthol blue is 108-130 μM, can be such as 108 μMs, 109 μMs, 110 μMs, 111 μMs, 112 μMs, 115 μMs, 116 μMs, 118 μMs, 120 μMs, 122 μMs, 125 μMs, 126 μMs, 128 μMs or 130 μMs, preferably 115- 123 μMs, more preferably 120 μMs.
Preferably, the concentration of described glycine betaine is 0.1-1M, can be such as 0.1M, 0.2M, 0.4M, 0.6M, 0.8M or 1M, preferably 0.5-0.8M, more preferably 0.8M.
As optimal technical scheme, described reaction system is 25 μ L, includes following components:
Buffer:
The third aspect, the present invention provides the using method of a kind of reaction system as described in second aspect, described method bag Include following steps:
By complete for each component mixing required in reaction system, be positioned over thermostat water bath and react, heat up after reaction into Row inactivation treatment, changes result of determination further according to system color.
Preferably, the temperature of described thermostat water bath is 50-70 DEG C, can be such as 50 DEG C, 51 DEG C, 52 DEG C, 53 DEG C, 54 DEG C, 55 DEG C, 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C, 60 DEG C, 61 DEG C, 62 DEG C, 63 DEG C, 64 DEG C, 65 DEG C, 68 DEG C, 69 DEG C or 70 DEG C, excellent Elect 55-65 DEG C as, more preferably 60 DEG C.
Preferably, the described response time is 15-90min, can be such as 15min, 20min, 25min, 30min, 35min, 40min, 45min, 50min, 55min, 60min, 65min, 70min, 75min, 80min, 85min or 90min, preferably For 45-90min, more preferably 60min.
Preferably, the temperature after described intensification is 78-90 DEG C, can be such as 78 DEG C, 79 DEG C, 80 DEG C, 81 DEG C, 82 DEG C, 83 DEG C, 84 DEG C, 85 DEG C, 86 DEG C, 87 DEG C, 88 DEG C, 89 DEG C or 90 DEG C, preferably 80-85 DEG C, more preferably 80 DEG C.
Preferably, the response time after described intensification is 15-30min, can be such as 15min, 16min, 17min, 18min, 19min, 20min, 22min, 25min, 26min, 28min or 30min, preferably 18-26min, more preferably 20min。
Preferably, described according to system color change result of determination be:
Reaction system is pansy, then sample to be tested does not carry KRAS；
Reaction system is sky blue, then sample to be tested carries KRAS.
Fourth aspect, the present invention provides the detection kit of a kind of KRAS gene, and described test kit comprises such as second aspect Described reaction system.
Compared with prior art, there is advantages that
(1) step is simple: DNA amplification is placed in thermostat water bath after only needing reaction system configuration and carries out reaction expansion Increase, it is not necessary to carry out in advance double-stranded DNA degeneration and be similar to the degeneration repeatedly in PCR cycle reaction, anneal, extension etc. Alternating temperature process；
(2) high specific: the specificity of amplification is the highest, can according to whether amplification just can judge target gene existence and No；
(3) amplified reaction is quickly, efficiently: can complete in whole amplification 2h, and productivity is high；
(4) without extracting DNA, blood sample only needs can detect through simple process, removes the loaded down with trivial details of DNA extraction from Operation and reagent expense, also can avoid cross-contamination；
(5) simplicity is identified: observing by the naked eye color change after having reacted and get final product result of determination, the observation of result is permissible The operation requirement and the instrument that depart from gel imaging limit, and add that amplification is that isothermal is carried out, need not rely on the circulation warm that PCR instrument is complicated Degree change completes, and just can carry out, make this technology have broader practice prospect in water-bath.
Accompanying drawing explanation
Fig. 1 is the electrophoresis of the product of M1, M2, M3, M4, M5, M6, M1 in the embodiment of the present invention 1 ', M2 ' and M3 ' Figure；
Wherein, M-DNAmarker, be followed successively by under upper cause 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 900bp, 800bp, 700bp, 600bp, 500bp, 400bp, 300bp, 200bp and 100bp；
Fig. 2 is the Sequencing chromatogram of M1 group in the embodiment of the present invention 1；
Fig. 3 is the Sequencing chromatogram of M2 group in the embodiment of the present invention 1；
Fig. 4 is the Sequencing chromatogram of M3 group in the embodiment of the present invention 1；
Fig. 5 is the Sequencing chromatogram of M4 group in the embodiment of the present invention 1；
Fig. 6 is the Sequencing chromatogram of M5 group in the embodiment of the present invention 1；
Fig. 7 is the Sequencing chromatogram of M6 group in the embodiment of the present invention 1.
Detailed description of the invention
By further illustrating the technological means and effect, being preferable to carry out below in conjunction with the present invention that the present invention taked Example further illustrates technical scheme, but the present invention is not limited in scope of embodiments.
Unreceipted concrete technology or condition person in embodiment, according to the technology described by the document in this area or condition, Or carry out according to product description.Agents useful for same or instrument unreceipted production firm person, be and can be purchased by regular channel The conventional products obtained.
Embodiment 1
Take the paraffin embedding sample of 5 parts of rectal cancer, after HE dyeing excludes cancer beside organism, with sky root or other companies Paraffin-embedded tissue DNA extraction kit extracts DNA, and number consecutively is M1, M2 and M3.Separately have three known KRAS's The plasmid of codon12 and codon13 sudden change, as positive control, is designated as M4, M5 and M6, in practical operation, M4, M5 and M6 is dilute Do template (all taking 0.002ng) after releasing 20,000 times, react by the corresponding primer sets in the present invention, the checking present invention's Implementation result.
Template M is used Allele-Specific LAMP technology, makes nucleic acid to be detected carry out LAMP reaction, for proving Wild type gene can be played the effect of well " embedding " by PNA employed in the present invention really, and we additionally set up three Reaction system, template takes M1, M2 and M3 respectively, replaced by ultra-pure water by PNA in system, and remaining component is with above-mentioned reactant System, is designated as M1 ', M2 ' and M3 ' respectively.
First, select the primer sets as described in the application first aspect that the sequence of sample is reacted, described primer sets As follows:
Forward Outside primer F3:SEQ ID NO:1:TGGTGGAGTATTTGATAGTGTA；
Reversely Outside primer B3:SEQ ID NO:2:TCCTGCACCAGTAATATGC；
Forward inner primer FIP:SEQ ID NO:3:AGTCATTTTCAGCAGGCCTTATAATAACCTTATGTGTGACA TGTTCT；
Reversely inner primer BIP:SEQ ID NO:4:GTAGGCAAGAGTGCCTTGACTCTATTGTTGGATCATATTCG TC；
Peptide nucleic acid(PNA) PNA:SEQ ID NO:5:TTGGAGCTGGTGGCGT.
Responded and be respectively provided with same reaction system, formed as follows:
Reaction system:
During reaction system reaction, at 60 DEG C, react 60min, be warming up to 80 DEG C afterwards and keep 20min to carry out inactivation treatment, Lower the temperature afterwards, observe system color and change.
Reaction is carried out according to above-mentioned detection method, and before reaction, system color is pansy, after reaction, and each group The color of reaction system and genotype judge as shown in table 1:
Table 1
As can be seen from Table 1, the sample reaction system of numbered M1-M3 does not has variable color, remains pansy, it was demonstrated that body Not carrying KRAS in system, the sample reaction system of numbered M4-M6 becomes sky blue, it was demonstrated that carries KRAS in system and dashes forward Become.
For the accuracy of further confirmatory reaction, the LAMP product of above-mentioned group being carried out electrophoresis, the agarose with 2% coagulates Gel electrophoresis is identified, electrophoresis 30min under 6v/cm voltage.The electrophoretogram obtained is as shown in Figure 1.After adding PNA, M1, M2 and M3 The reaction system of group does not all have band, does not react generation in prompting system, and the KRAS of prompting these three sample does not the most occur Sudden change；M4, M5 and M6 group reaction system then presents typical scalariform band, responds generation in explanation system.M1 ', M2 ' and M3 ' group also has scalariform band, it was demonstrated that PNA can actually consolidate to be incorporated into the template of wild type and suppress LAMP to react.
For verifying further the accuracy of the present invention, then the M1-M6 template PCR-sequencing of above-mentioned group is carried out point Type, the Sequencing chromatogram obtained as illustrated in figs. 2-7, tie by the detection of the detection primer group that contrast gene sequencing collection of illustrative plates and the present invention provide Fruit understands, and the detection of the two coincide rate 100%, it may be verified that the result of the present invention is accurate.
In sum, reaction system of the present invention can judge to react the genotype of sample, and step of the present invention letter accurately Single: DNA amplification is placed in thermostat water bath after only needing reaction system configuration and carries out reaction and expand, it is not necessary in advance Carry out double-stranded DNA degeneration and be similar to the degeneration repeatedly in PCR cycle reaction, anneal, the alternating temperature process such as extension；Amplified reaction Quickly, efficiently, specificity is high: can complete in whole amplification 2h, and productivity is high；Identify simplicity: after having reacted, pass through naked eyes Observing color change and get final product result of determination, the visible observation of result can depart from operation requirement and the instrument restriction of gel imaging, Being that isothermal is carried out plus amplification, the circulating temperature that need not rely on PCR instrument complicated has changed, and just can carry out in water-bath, This technology is made to have broader practice prospect.
Applicant states, the present invention illustrates the method detailed of the present invention by above-described embodiment, but the present invention not office It is limited to above-mentioned method detailed, does not i.e. mean that the present invention has to rely on above-mentioned method detailed and could implement.Art Technical staff is it will be clearly understood that any improvement in the present invention, and the equivalence of raw material each to product of the present invention is replaced and auxiliary element Interpolation, concrete way choice etc., within the scope of all falling within protection scope of the present invention and disclosure.

Claims (10)

1. the detection primer group of a KRAS gene, it is characterised in that described detection primer group is as follows:
Forward Outside primer F3:SEQ ID NO:1；
Reversely Outside primer B3:SEQ ID NO:2；
Forward inner primer FIP:SEQ ID NO:3；
Reversely inner primer BIP:SEQ ID NO:4；
Peptide nucleic acid(PNA) PNA:SEQ ID NO:5.
Detection primer group the most according to claim 1, it is characterised in that the sequence shown in described SEQ ID NO:1-4 is For detecting the 12nd and 13 codon sites of the exon of KRAS gene.
3. the detection reaction system of a KRAS gene, it is characterised in that described reaction system includes described in claim 1 or 2 Primer sets, reaction buffer, dNTPs, hydroxynaphthol blue, glycine betaine, Bst archaeal dna polymerase, measuring samples genomic DNA and Deionized water.
Reaction system the most according to claim 3, it is characterised in that described reaction buffer includes Tris-HCl, KCl, (NH4)2SO4, MgSO4And Tween-20；
Preferably, the concentration of described Tris-HCl is 10-30mM, preferably 15-25mM, more preferably 20mM；
Preferably, the concentration of described KCl is 10-60mM, preferably 50-55mM, more preferably 50mM；
Preferably, described (NH4)2SO4Concentration be 5-13mM, preferably 8-12mM, more preferably 10mM；
Preferably, described MgSO4Concentration be 2-8mM, preferably 2-6mM, more preferably 4mM；
Preferably, the volume fraction of described Tween-20 is 0.1-1%, preferably 0.1%.
5., according to the reaction system described in claim 3 or 4, it is characterised in that the concentration of described dNTPs is 1-2mM, it is preferably 1.2-1.8mM, more preferably 1.4mM；
Preferably, the concentration of described hydroxynaphthol blue is 108-130 μM, preferably 115-123 μM, more preferably 120 μMs；
Preferably, the concentration of described glycine betaine is 0.1-1M, preferably 0.5-0.8M, more preferably 0.8M.
6. according to the reaction system according to any one of claim 3-5, it is characterised in that described reaction system is 25 μ L, bag Containing following components:
Buffer:
7. one kind such as the using method according to the reaction system according to any one of claim 3-6, it is characterised in that described side Method comprises the steps:
By complete for each component mixing needed in reaction system, being positioned over thermostat water bath and react, heating up after reaction is carried out Inactivation treatment, changes result of determination further according to system color.
Using method the most according to claim 7, it is characterised in that the temperature of described thermostat water bath is 50-70 DEG C, excellent Elect 55-65 DEG C as, more preferably 60 DEG C；
Preferably, the described response time is 15-90min, preferably 45-90min, more preferably 60min；
Preferably, the temperature after described intensification is 78-90 DEG C, preferably 80-85 DEG C, more preferably 80 DEG C；
Preferably, the response time after described intensification is 15-30min, preferably 18-26min, more preferably 20min.
9. according to the using method described in claim 7 or 8, it is characterised in that described according to system color change result of determination For:
Reaction system is pansy, and KRAS is not carried in site the most to be measured；
Reaction system is sky blue, and KRAS is carried in site the most to be measured.
10. the detection kit of a KRAS gene, it is characterised in that described test kit comprises as claimed in claim 3 anti- Answer system.
CN201610799259.6A 2016-08-31 2016-08-31 The detection primer group of a kind of KRAS gene, its reaction system constituted and application Pending CN106282363A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610799259.6A CN106282363A (en) 2016-08-31 2016-08-31 The detection primer group of a kind of KRAS gene, its reaction system constituted and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610799259.6A CN106282363A (en) 2016-08-31 2016-08-31 The detection primer group of a kind of KRAS gene, its reaction system constituted and application

Publications (1)

Publication Number Publication Date
CN106282363A true CN106282363A (en) 2017-01-04

Family

ID=57711157

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610799259.6A Pending CN106282363A (en) 2016-08-31 2016-08-31 The detection primer group of a kind of KRAS gene, its reaction system constituted and application

Country Status (1)

Country Link
CN (1) CN106282363A (en)

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102010894A (en) * 2010-03-09 2011-04-13 上海源奇生物医药科技有限公司 Nucleotide sequence, method and kit for detecting exons 12, 13 mutation of human K-ras gene
CN102869790A (en) * 2010-04-12 2013-01-09 反应遗传有限公司 KRAS primers and probes
CN104762410A (en) * 2015-04-29 2015-07-08 上海允英医疗科技有限公司 Primer, probes and detection kit used for full RAS mutation detection
CN104805208A (en) * 2015-04-30 2015-07-29 山东维真生物科技有限公司 Primer-probe composition, kit and detection method for detecting seven kinds of hot-spot mutation of KRAS gene of humans
CN105349620A (en) * 2014-08-20 2016-02-24 北京百诺奇生物科技有限公司 Kit for detection of K-ras gene mutation and application thereof
CN105567854A (en) * 2016-03-01 2016-05-11 济南银丰医学检验有限公司 Primer combination for detecting human EGFR, KRAS and BRAF gene mutation and kit thereof
CN105624309A (en) * 2016-02-23 2016-06-01 深圳华大基因研究院 Primer, probe and kit for detecting EGFR and/or K-ras genetic mutation

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102010894A (en) * 2010-03-09 2011-04-13 上海源奇生物医药科技有限公司 Nucleotide sequence, method and kit for detecting exons 12, 13 mutation of human K-ras gene
CN102869790A (en) * 2010-04-12 2013-01-09 反应遗传有限公司 KRAS primers and probes
CN105349620A (en) * 2014-08-20 2016-02-24 北京百诺奇生物科技有限公司 Kit for detection of K-ras gene mutation and application thereof
CN104762410A (en) * 2015-04-29 2015-07-08 上海允英医疗科技有限公司 Primer, probes and detection kit used for full RAS mutation detection
CN104805208A (en) * 2015-04-30 2015-07-29 山东维真生物科技有限公司 Primer-probe composition, kit and detection method for detecting seven kinds of hot-spot mutation of KRAS gene of humans
CN105624309A (en) * 2016-02-23 2016-06-01 深圳华大基因研究院 Primer, probe and kit for detecting EGFR and/or K-ras genetic mutation
CN105567854A (en) * 2016-03-01 2016-05-11 济南银丰医学检验有限公司 Primer combination for detecting human EGFR, KRAS and BRAF gene mutation and kit thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MASAHIRO ITONAGA等: "Novel Methodology for Rapid Detection of KRAS Mutation Using PNA-LNA Mediated Loop-Mediated Isothermal Amplification", 《PLOS ONE》 *

Similar Documents

Publication Publication Date Title
CN107419018B (en) Method and kit for detecting gene mutation based on Blocker primer and ARMS primer
CN102747158A (en) Human K-ras (K-rat sarcoma) gene mutation parting type fluorescent quantitation PCR (polymerase chain reaction) detecting reagent kit and detecting method
CN102399872B (en) Method and kit for detecting mutation of K-ras gene
CN106148497A (en) BRAF gene mutation detection kit and application thereof
CN104774963A (en) Kit for detecting PIK3CA gene mutation and detecting method thereof
CN102367479A (en) Method and kit used for detecting EGFR gene mutation
CN106282363A (en) The detection primer group of a kind of KRAS gene, its reaction system constituted and application
CN105602947B (en) The detection primer group of CYP3A5 gene, its reaction system and application for constituting
CN102181536A (en) Primer composition, kit and method for detecting mutation of exon 19 of human EGFR gene
CN105331692A (en) Primer combination, detecting reagent kit and detecting method used for detecting rs1800497
CN113122629B (en) Primer and probe for hairpin amplification blocking method for gene mutation detection and application thereof
CN105441436B (en) A kind of personalized medicine detection kit of beta blocker
CN103074437B (en) Multi-gene detection kit for guiding administration of platinum drugs and detection method of multi-gene detection kit
CN107058467A (en) It is a kind of that gene mutation or SNP method are detected based on isothermal duplication method
CN107083429B (en) A kind of SNP parting kit and its application for the detection of atrial fibrillation tumor susceptibility gene
CN102399858A (en) Detection method for DNA point mutation based on fluorescent quenching release
CN105603059A (en) CYP4F2 gene detection primer group, reaction system composed thereof and application
CN105648057B (en) A kind of primer sets, kit and its detection method for screening human EGFR gene polymorphism
CN105506140B (en) ROS1 fusion ARMS fluorescence quantitive PCR typing detection kit
CN110117669B (en) Anti-tuberculosis drug resistance detection method based on overlap extension PCR
CN108504721A (en) A kind of novel individualized treatment gene tester
CN105586402A (en) Detection primer set for drug-induced epicophosis, reaction system constituted by detection primer set and application of detection primer set
CN105861691A (en) Primer combination, reaction kit and method for detecting BRAF gene mutation
CN113981099B (en) Detection method and application of methylation sites of human AURKB and TM4SF20 genes
CN105400871A (en) Detection primer group for ALDH2 genes, reaction system comprising same and application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20170104