CN106282240B - Method for constructing rat bone marrow mesenchymal stem cell strain for stably and efficiently expressing c-met protein - Google Patents

Method for constructing rat bone marrow mesenchymal stem cell strain for stably and efficiently expressing c-met protein Download PDF

Info

Publication number
CN106282240B
CN106282240B CN201610662140.4A CN201610662140A CN106282240B CN 106282240 B CN106282240 B CN 106282240B CN 201610662140 A CN201610662140 A CN 201610662140A CN 106282240 B CN106282240 B CN 106282240B
Authority
CN
China
Prior art keywords
cell
met
culture medium
bmscs
serum
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610662140.4A
Other languages
Chinese (zh)
Other versions
CN106282240A (en
Inventor
朱传龙
王坤
李毓雯
李军
岳明
朱甜甜
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangsu Nahua Biotechnology Co ltd
Original Assignee
Jiangsu Province Hospital First Affiliated Hospital Of Nanjing Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangsu Province Hospital First Affiliated Hospital Of Nanjing Medical University filed Critical Jiangsu Province Hospital First Affiliated Hospital Of Nanjing Medical University
Priority to CN201610662140.4A priority Critical patent/CN106282240B/en
Publication of CN106282240A publication Critical patent/CN106282240A/en
Application granted granted Critical
Publication of CN106282240B publication Critical patent/CN106282240B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0663—Bone marrow mesenchymal stem cells (BM-MSC)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/10—Protein-tyrosine kinases (2.7.10)
    • C12Y207/10001—Receptor protein-tyrosine kinase (2.7.10.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Rheumatology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a construction method of rat bone marrow mesenchymal stem cell (BMSCs) cell strain for stably and efficiently expressing c-met protein, which comprises the steps of constructing c-met gene lentivirus expression vector, and transfecting BMSCs to obtain the BMSCs cell strain for stably and efficiently expressing c-met protein; the BMSCs cell strain obtained by the invention can stably secrete and express c-met protein, has higher protein expression level, can stably passage and the like, and has important significance for the research of diseases such as liver failure, tumor and the like.

Description

Construct the rat bone marrow mesenchymal stem cells cell of stability and high efficiency expression c-met albumen The method of strain
Technical field
The present invention relates to technical field of cell biology, spy is not a kind of rat bone for constructing stability and high efficiency expression-met albumen The method of bone marrow-drived mesenchymal stem cell strain.
Background technique
The heterodimer that c-met gene is made of α chain and β chain, coding protein be transmembrane tyrosine kinase by One of body (RTKS) superfamily member, the activity with autonomous phosphorylation.Hepatocyte growth factor (HGF) is the ligand of c-met, It is with after c-met's expression specific bond, and inducible c-met conformation changes, and then protein kinase domain in active cell In PTK occur phosphorylation, further activate downstream signal transduction access and play effect.
Hepatic failure is to seriously threaten one of the disease of human health at present, and the disease state of an illness is dangerous, and progress is rapid, case fatality rate It is high.Currently, liver transfer operation is the most effective treatment method of the disease, but it is restricted because of the shortage of various aspects condition.Therefore, it finds It is most important that a kind of new mode treats hepatic failure.Mesenchymal stem cell (BMSCs) is that a kind of self-replacation and can have The non-hematopoietic stem cell of multi-lineage potential, and be easily isolated, proliferative capacity is strong, can be to difference under suitable signal stimulus Organization type cell differentiation is easy to carry out the transfection of allogenic gene and the expression of its albumen.Yijing Cai etc. the study found that Bone marrow mescenchymal stem cell can significantly improve hepatic failure patients liver function, but the hepatic failure patients through transplanting BMSCs treatment Liver function only can be obviously improved in a short time, but its long term survival rate and be not improved.
Causing above-mentioned reason may be to be gone back to the nest after BMSCs is fed back in liver cell number is very few and its cell for going back to the nest point It is poor to change power of regeneration.The study found that HGF/c-met receptor pathway go back to the nest with mesenchymal stem cell it is closely related, and influence BMSCs breaks up to quasi-liver cell and adjusts the regeneration function of liver cell；Also some researches show that hepatic failure patients liver cell regenerations to hinder Hinder and decline with liver cell c-met gene expression dose, HGF/c-met access is damaged related.Therefore, stability and high efficiency expression c- is established The BMSCs cell strain of met, for study later BMSCs treatment hepatic failure when, c-met to BMSCs go back to the nest in liver and to liver it is thin The influence of born of the same parents' differentiation, and corresponding mechanism and whether after can be used as treatment hepatic failure patients one kind it is new, more effectively control Treatment scheme is all highly important.And compared to previous common transient transfection techniques, it is low that stable transfection solves its transfection efficiency, The disadvantages of foreign gene of transfection cannot be integrated into cellular genome, and the gene expression time of transfection is short.It has not yet to see to pass Stablize research and the report of the BMSCs cell strain of expression c-met in building.
Summary of the invention
In view of the above-mentioned problems, the present invention provides a kind of construction method of BMSCs cell strain that can stablize expression c-met, Related mechanism for kinds of tumors is studied, what the present invention was obtained by:
A method of the rat bone marrow mesenchymal stem cells cell strain of building stability and high efficiency expression c-met albumen, tool Steps are as follows for body:
A SPF grades of SD male rats of 4 week old) are chosen, extracts and cultivates BMSCs；
B) respectively using SEQ ID NO.1 and SEQ ID NO.2 as upstream and downstream primer, using c-met gene as template (according to C-met (rat) mRNA sequence NM-031517 that NCBI is provided, the synthesis of commission Shanghai Xu Guan biotechnology Development Co., Ltd), Gently piping and druming mixes, and is placed in amplifying target genes c-met in PCR instrument and identification is sequenced；
PCR reaction system: the 4 μ l of dNTP Mix of 5 × PS Buffer, 10 μ l, 2.5mM each, 10 μM of upstream primer 1 μ l, PrimeSTAR HS DNA polymerase of template, the 0.5 μ l of 1 μ l, 10 μM of 1 μ l, 10ng/ μ L of downstream primer, ddH2O complements to 50 μ l；
PCR reaction condition: 98 DEG C of preheating 5min；98 DEG C of 10s, 55 DEG C of 10s, 72 DEG C of 90s, totally 30 recycle；4 DEG C of extensions；
C restriction enzyme A geI digestion slow virus carrier GV35) is utilized, digestion system is configured, is gently blown with pipettor It beats and mixes, in 37 DEG C of reaction 3h, that is, obtain the digestion products linearized vector DNA of slow virus carrier GV358；
Digestion system: the Plasmid DNA of 10 × CutSmart Buffer, 5 μ l, the purifying of 1 μ g/ μ L (are purchased from Shanghai Ji Kaiji Because of chemical technology Co., Ltd) restriction enzyme A geI enzyme 1 the μ l, ddH of 2 μ l, 10U/ μ l2O complements to 50 μ l；
D linearized vector DNA and target gene recombining reaction system) are prepared in ice-water bath, when preparation is light with pipettor Mixing is played in featheriness, keeps away a gram generation bubble；Reaction system is placed in 37 DEG C of reaction 30min after preparation, obtains Lentiviral GV358-c-met；
Recombining reaction system: 5 × CE II Buffer 2 μ l, step C) obtain linearized vector DNA (concentration 800ng/ μ L) 2.5 μ l, step B) obtain target gene c-met (concentration 700ng/ μ L) 1 μ l, Exnase II 1 μ l, ddH2O is complemented to 10μl；
E 20 μ g of GV358-c-met, pHelper1.015 μ g, pHelper2.010 μ g) are added into centrifuge tube, with 2000 transfection reagent of Invitrogen Lipofectamine complements to 1ml, forms transfection cocktail, is incubated at room temperature 15min；Then transfection cocktail is slowly dropped into the 293T cell that cell density is 70%~80%, mixes, in 37 DEG C, contains 5%CO2It is cultivated in the cell incubator of (volume fraction)；
After cultivating 6h, the culture medium containing transfection mixture is discarded, is slowly added to the cell culture medium containing 10% serum 10ml, in 37 DEG C, containing 5%CO2Cell culture medium in continue cultivate 48-72h；
F the 293T cell supernatant for) collecting 48h (as 0h is counted when transfection) after transfecting, in 4 DEG C, 4000g is centrifuged 10min removes cell fragment；Supernatant is taken to filter with 0.45 μm of filter and in the ultracentrifugation pipe of 40ml, it will be with virus The ultracentrifugation pipe of supernatant is put into one by one to Beckman ultracentrifuge, and setting parameter of noncentricity is 25000rpm, in 4 DEG C It is centrifuged 2h；It after centrifugation, discards supernatant, removal as far as possible remains in the liquid on tube wall, and virus is added and saves liquid (purchased from Shanghai Ji Kai chemical gene Technology Co., Ltd.), obtain c-met gene slow virus；
G) c-met gene slow-virus transfection BMSCs, specific steps are as follows:
BMSCs in logarithmic growth phase is inoculated in 96 orifice plates by the day before transfection, and every hole is added 4~5 × 104It is a Cell (inoculum density is to cover with for cell 3~4 days to be advisable) and 100 μ l contain the cell culture medium of 10% serum, are put into cell culture It is cultivated in case；When cell fusion degree reaches 25%-35%, former culture medium is discarded, is turned with infection multiplicity (MOI=100) Dye, i.e., 10 μ l step F are added into each hole) obtain c-met gene slow virus (virus titer be 2 × 108TU/ml)、10μl The ploybrene enhancement solution of final concentration of 5 μ g/ml and the cell culture medium containing 10% serum of 80 μ l, in 37 DEG C, containing 5%CO2 It is cultivated in incubator；After infecting 12h, culture medium is discarded, the cell culture medium that 100 μ l contain 10% serum is added in every hole；It is transfecting After 48h, i.e., available fluorescence microscope transfected condition；After infecting 72h, changed again with the cell culture medium containing 10% serum Liquid, and the puro of final concentration of 9 μ g/ml is added to every hole, the drug screening period is one week, and is seen under fluorescence microscope Effect is examined, after microscopically observation cell fluorescence positive rate up to after 100%, drug screening concentration is maintained into 1.8 μ g/ml, i.e., Obtain the rat bone marrow mesenchymal stem cells cell strain of stability and high efficiency expression c-met albumen；
Wherein, the cell culture medium preparation method for containing 10% serum are as follows: the DMEM in the culture medium containing 89% is cultivated Base (being purchased from Hyclone company), 10% fetal calf serum (being purchased from Corning company) and 1% Pen .- Strep solution (being purchased from green skies company).
Preferably, thin in the rat bone marrow mesenchymal stem cells of building stability and high efficiency expression c-met albumen of the present invention In the method for born of the same parents' strain, step E) cell density be 70%~80% 293T cell be obtained by: before transfection for 24 hours, It is about 5 with the cell culture medium adjustment cell density containing 10% serum with the 293T cell of trypsin digestion logarithmic growth phase ×106Cell/15ml is inoculated in the Tissue Culture Dish that diameter is 10cm, in 37 DEG C, containing 5%CO2Incubator in culture, to It can be used to transfect when cell density is up to 70%~80%；And 2h replaces medium to serum free medium before transfecting.
Cell used in the present invention is rat bone marrow mesenchymal stem cells, from SPF grades of SD male rat shins of 4 week old Bone and humerus, which extract, to be obtained.
The present invention provides the BMSCs cell strain of stable expression c-met a kind of, existing dry about medulla mesenchyma to break through The research direction of cell therapy hepatic failure.C-met is expressed by BMSCs stability and high efficiency, when realizing that BMSCs treats hepatic failure more Good goes back to the nest in liver and to hepatocyte differentiation, and studies its respective action mechanism, research and hair for hepatic failure treatment Exhibition is of great significance.The cell strain can also be used in the related mechanism research of kinds of tumors.
Detailed description of the invention
Fig. 1 is rat bone marrow mesenchymal stem cells spectroscopy (× 100) photo；
Wherein, A: primary cell；B: the five generation cell.
Fig. 2 is target gene c-met electrophoretogram；
Its size is 4190bp.
Fig. 3 is slow virus carrier GV358 Vector map.
Fig. 4 is recombinant vector GV358-c-met positive colony PCR identification electrophoresis result schematic diagram；
In figure, 1: negative control (ddH2O), 2: negative control (unloaded to connect control group certainly), 3: positive control (GAPDH), 4:Marker, 5-12:c-met 1-8 transformant.
Fig. 5 is to observe GFP fluorogram after slow-virus transfection 293T cell 72h under fluorescence microscope (× 100)；
Wherein, A: the white light visual field；B: the fluorescence visual field.
Fig. 6 is that rat bone marrow mesenchymal stem cells result microscopy (× 100) is illustrated after various concentration puromycin screens 4 days Figure；
Wherein, A-F is followed successively by 0 μ g/ml, 6 μ g/ml, 7 μ g/ml, 8 μ g/ml, 9 μ g/ml and 10 μ g/ml.
Fig. 7 is to observe GFP fluorogram after slow-virus transfection BMSCs 48h under fluorescence microscope (× 100)；
In figure, A: the white light visual field；B: the fluorescence visual field.
Fig. 8 is that slow-virus transfection BMSCs sieve medicine observes GFP fluorogram under fluorescence microscope (× 100) after a week；
In figure, A: the white light visual field；B: the fluorescence visual field.
Fig. 9 is c-met protein expression situation schematic diagram in Western-blot detection BMSCs；
Wherein, albumen size is 154KD.
Figure 10 is that the BMSCs group for stablizing expression c-met, the BMSCs group of stable expression GFP and physiological saline group are treated respectively Three groups of hepatic pathology figures after hepatic failure SD rat 72h (A: stablize expression c-met BMSCs treatment group hepatic pathology figure (× 100), B: stablize the BMSCs treatment group hepatic pathology figure (× 100) of expression GFP, C: saline therapy group hepatic pathology figure (×100))。
Figure 11 is that the BMSCs group for stablizing expression c-met, the BMSCs group for stablizing expression GFP and three groups of SD of physiological saline group are big Mouse survival rate figure.
Specific embodiment
With reference to the accompanying drawing, the present invention is specifically described.
Embodiment is related to experimental material and instrument:
4 SPF grades of week old SD male rats are purchased from Nanjing Medical University's pharmaceutical experiment animal center；
Fetal calf serum is purchased from Corning company；
Low DMEM is purchased from Hyclone company；
Rat lymphocyte separating liquid is purchased from the Tianjin ocean Hao biological products science and technology limited Company；
Slow virus carrier GV358, virus packaging helper plasmid (Helper1.0, Helper2.0) are purchased from triumphant purchased from Shanghai Ji Chemical gene Technology Co., Ltd.；
1kp DNA ladder Marker is purchased from Fermentas company；
250bp DNA ladder Marker is purchased from JaRa company；
In-FusionTMPCR Cloning Kit is purchased from clontech company；
Taq polymerase is purchased from SinoBio company；
DNTP is purchased from Takara；
The Plasmid DNA of purifying is purchased from Shanghai JiKai Gene Chemical Technology Co., Ltd；
Restriction enzyme is purchased from NEB company；
Plasmid extracts Kit and is purchased from promega；
Puromycin is purchased from amresco company；
Ago-Gel DNA QIAquick Gel Extraction Kit is purchased from Tiangeng biochemical corp；
Serum free medium is purchased from Hyclone company；
Virus saves liquid and is purchased from Ji Kai company；
Bacterium shaking table is purchased from Hua Lida experimental facilities company；
PCR instrument is purchased from Applied Biosystems company；
Positive clone sequencing is completed by U.S. season biotechnology；
Pressure stabilizing DNA electrophoresis apparatus is purchased from BioRad company；
Gel imager is purchased from Tian Neng company.
The culture medium that embodiment is related to:
LB liquid medium: tryptone (Tryptone) 10g/L, yeast extract (Yeast extract) 5g/L, chlorine Change sodium (NaCl) 10g/L, concentration is 10 μ L of 10mmol/l NaOH；
LB plate containing ampicillin antibiotic: agar powder 15g/100ml, high pressure are added into LB liquid medium It makes it completely dissolved, then when the liquid is cooled to 60 degree or so, the ampicillin of final concentration 100ng/ml is added, then will The liquid pours into Bacteria Culture plate, is cooled into plate；
Cell culture media formulations containing 10% serum: by quality very in terms of, 89% DMEM culture medium (is purchased from Hyclone company), the Pen .- Strep solution of 10% fetal calf serum and (being purchased from Corning company) 1% (be purchased from green cloud Its company, 100 × it is dual anti-) mixing after obtain.
The DNA sequence dna that embodiment is related to:
SEQ ID NO.1:5’
-GAGGATCCCCGGGTACCGGTCGCCACCATGAAGGCTCCCACCGCGCTGGCACCTGG-3'；
SEQ ID NO.2:
5'-TCCTTGTAGTCCATACCTGTGTTCGCTTCGCCGTCAATGTTGTCTTG-3'；
SEQ ID NO.3:CCAGTTTCCCAACTCCTCTCAG；
SEQ ID NO.4:CCTTATAGTCCTTATCATCGTC；
Embodiment 1
(1) extraction and culture of rat bone marrow mesenchymal stem cells
SPF grades of SD male rats of 4 week old are chosen, cervical dislocation is put to death, and shin bone and femur are taken out, and removes the dry epiphysis in both ends Normal saline flushing ossis is drawn in 50 milliliters of centrifuge tubes with 5 milliliters of syringes, 1000rpm centrifugal elutriation liquid 10min in end Afterwards, hanging heart bottom of the tube precipitating is rushed containing 10% serum low sugar culture medium using 3ml, it is thin that liquid is added to the lymph of rat containing 3ml In 15 milliliters of centrifuge tubes of born of the same parents' separating liquid, after 2000rpm is centrifuged 20min, third layer tunica albuginea layer in centrifuge tube is drawn, and be added to In centrifuge tube containing its 4 times of mL normal salines, 1000rpm is centrifuged 10min, rushes outstanding bottom containing 10% serum low sugar culture medium Precipitating is inoculated into culture dish, and cell is put into 37 DEG C, containing 5%CO2Culture in incubator, is cultivated alternative in experiment to the 5th；
Fig. 1 is rat bone marrow mesenchymal stem cells microscope (× 100) enlarged photograph, and wherein Figure 1A is primary cell, figure 1B is the 5th generation cell；Can be adherent behind cell 1 day of extraction, the 3rd day starts deformation occur, the 7th day formation MSC cluster, and by It is gradually proliferated and expands to periphery, it is in shuttle shape, spindle that the BMSCs form of growth and shaping is uniform, and cell arrangement is close, is in swirl shape Or broom shape arrangement.
(2) building of rat c-met gene overexpression slow virus carrier and identification
A) according to the sequence of rat c-met gene, upstream primer is designed and synthesized as shown in SEQ ID NO.1,
Downstream primer is as shown in SEQ ID NO.2, using SEQ ID NO.1 and SEQ ID NO.2 as upstream and downstream primer, with base Because c-met is that (according to c-met (rat) mRNA sequence NM-031517 that NCBI is provided, the commission Shanghai rising sun is preced with biotechnology to template Development Co., Ltd's synthesis)；Following reaction system is configured, gently piping and druming mixes,
It is placed in amplifying target genes c-met in PCR instrument；
PCR reaction system such as following table (table 1):
Reagent Volume (μ l)
ddH2O 32.5
5×PSBuffer 10
dNTPMix(2.5mMeach) 4
Upstream amplification primer (10 μM) 1
Downstream amplification primer (10 μM) 1
Template (10ng/ μ L) 1
PrimeSTARHSDNApolymerase 0.5
Total 50
PCR reaction condition such as following table (table 2):
To obtain target gene fragment (c-met gene)；2.5% agarose gel electrophoresis figure of target gene fragment is such as (M swimming lane is molecular weight marker) shown in Fig. 2, from Figure 2 it can be seen that product shows that amplified fragments are through agarose gel electrophoresis 4190bp is consistent with target gene size.
B) according to table 3,50 μ l digestion systems is prepared, various reagents is sequentially added by 3 sequence of table, is gently blown and beaten with pipettor It mixes, 37 DEG C of reaction 3h is placed in, to obtain the digestion products of slow virus carrier GV358, to obtain linearized vector DNA.
Slow virus carrier GV358 digestion system such as following table (table 3):
Reagent Volume (μ l)
ddH2O 42
10×CutSmartBuffer 5
The Plasmid DNA (1 μ g/ μ L) of purifying 2
AgeI(10U/μl) 1
Total 50
Fig. 3 is the GV358 Vector map, and the carrier element is suitable
Sequence: Ubi-MCS-3FLAG-SV40-EGFP-IRES-puromycin.
C) reaction system (table 4) is formulated as follows in ice-water bath with linearized vector DNA and target gene amplified production again. Mixing is gently blown and beaten with pipettor, a gram generation bubble is kept away, in 37 DEG C of reaction 30min.To obtain by linearized vector and purpose base The Lentiviral GV358-c-met formed by recombination；
Table 4:
Reagent Volume (μ l)
ddH2O 3.5
5×CEIIBuffer 2
Linearized vector DNA after digestion 2.5
Target gene c-met 1
ExnaseTMII 1
Total 10
D) 10 μ L Lentiviral GV358-c-met are added in 100 μ L competent cell DH5 α, flick tube wall Several lower mixings, after placing 30min on ice, heat shock 90s in 42 DEG C of water-baths is then incubated for 2min in ice-water bath；Then it is added Into 500 μ L LB liquid mediums, it is placed in 37 DEG C of shaking table shaken cultivation 1h；
It takes 100 μ L bacterium solutions to be uniformly coated on the LB plate containing ampicillin antibiotic to be inverted in constant incubator Cultivate 12-16h；The monoclonal on picking plate carries out PCR identification again, and specific method is to be formulated as follows reaction system, and concussion is mixed It is even.In superclean bench, with single bacterium colony on sterile pipette tips picking plate into 20 μ L identification systems, piping and druming is mixed, and is set It is reacted in PCR instrument.
Bacterium colony PCR identification reaction system such as following table (table 5):
Reagent Volume (μ l)
ddH2O 9.2
2×TaqPlusMasterMix 10
Upstream primer SEQIDNO.3 (10 μM) 0.4
Downstream primer SEQIDNO.4 (10 μM) 0.4
Single colonie -
Total 20
PCR reaction condition (table 6):
By PCR product row agarose gel electrophoresis, as a result shows that PCR product size is 1181bp, show the monoclonal colonies For the positive.Sequencing and interpretation of result are carried out to the positive colony again.Then correct clone's bacterium solution is expanded into culture, extracting, To obtain high purity plasmid (size 1181bp).
Fig. 4 is recombinant vector GV358-c-met positive colony PCR qualification result electrophoretogram, in Fig. 4,1: negative control (ddH2O), 2: negative control (GV358 zero load connects control group certainly), 3: (GAPDH, the gene are purchased from Shanghai Ji Kaiji to positive control Because of chemical technology Co., Ltd), 4:Marker, 5-12:c-met 1-8 transformant；It can be seen that row sun after the conversion of 1-8 transformant Property clone PCR identification (PCR product size be 1181bp) as a result unanimously show the success of slow virus construction of recombinant vector.
(3) c-met genetic recombination slow virus packaging, concentration and purifying
1) before transfection for 24 hours, contain the culture keynote of 10% serum with the 293T cell of trypsin digestion logarithmic growth phase Whole cell density about 5x106Cell/15ml is reinoculated on 10cm Tissue Culture Dish, 37 DEG C, 5%CO2Culture in incubator. It can be used to transfect when cell density is up to 70%~80% afterwards for 24 hours；And serum free medium is changed in the preceding 2h of transfection and (is purchased from Hyclone company)；
2) 20 μ g of GV358-c-met, pHelper1.015 μ g, 2.010 pHelper μ are added into a sterile centrifugation tube G, and 2000 transfection reagent of Invitrogen Lipofectamine is added and is uniformly mixed, adjustment total volume is 1ml, in room temperature After lower incubation 15min；Mixed liquor is slowly added dropwise into the culture solution of 293T cell, mixes, in 37 DEG C, 5%CO2Cell incubator Middle culture；
3) culture medium containing transfection mixture is discarded after cultivating 6h, and is slowly added to the cell culture medium containing 10% serum 10ml, in 37 DEG C, containing 5%CO2Continue to cultivate 48-72h in incubator；
4) the 293T cell supernatant of 48h (as 0h is counted when transfection) after transfecting is collected；In 4 DEG C, 4000g is centrifuged 10min removes cell fragment；Again with 0.45 μm of filter filtering supernatant in the ultracentrifugation pipe of 40ml；Then distinguish trim Ultracentrifugation pipe with vial supernatant is put into Beckman ultracentrifuge by sample one by one, and setting parameter of noncentricity is 25000rpm, centrifugation time 2h, centrifuging temperature are controlled at 4 DEG C；It after centrifugation, discards supernatant, removal as far as possible remains in pipe Liquid on wall is added virus and saves liquid (being purchased from Shanghai JiKai Gene Chemical Technology Co., Ltd), it is sick slowly to obtain c-met gene Poison；
(4) c-met recombinant slow virus titer determination
Using fluorescence spectrometry virus titer, measurement the previous day, using 293T attached cell bed board, 96 orifice plates, every hole 4 × 104A cell；Prepare 7 sterile EP pipes, 90 μ l serum free mediums (being purchased from Hyclone company) be added in every pipe, take to The 10 μ l of virus stock solution used of measurement is added in first pipe, after mixing, is taken 10 μ l to be added in second pipe, is continued identical behaviour Make a to the last pipe；Cell hole needed for choosing discards 90 μ l culture mediums, and the viral solution that 90 μ l have diluted is added, culture Case culture after 4 days, observes luciferase expression situation, fluorecyte number is reduced with the increase of extension rate, according to formula: virus Titre=fluorecyte number/virus stock solution used amount, can calculate virus titer.Fig. 5 is fluorescence microscope after transfection 293T cell 72h GFP fluorogram is observed under (× 100), Fig. 5 A is the white light visual field, and Fig. 5 B is the fluorescence visual field；As it can be seen that c-met slow-virus transfection 293T Cell, 72h after transfection, fluorescence microscopy microscopic observation fluorescent positive rate are calculated according to formula according to the above method up to 90% or more Virus titer is 2 × 108TU/ml。
(5) puromycin screening concentration is determined
The rat bone marrow mesenchymal stem cells of logarithmic growth phase are cleaned twice with 2mlPBS (being purchased from Hyclone company) Afterwards, 2ml pancreatin (being purchased from Sigma company) is added and digests 2min, after microscopically observation BMSCs all digests, be added 2ml terminates digestion containing 10% serum low sugar culture medium, and adds it in 15ml sterile centrifugation tube, and 1000rpm is centrifuged 5min, It discards supernatant, 6ml is added containing 10% serum low sugar culture medium and rushes outstanding bottom precipitation, and is inoculated in 6 orifice plates.It is thin to each hole After born of the same parents cover with, former culture medium is discarded, gradient addition purine-containing mycin contains 10% serum low sugar culture medium 2ml, and each hole purine is mould Plain concentration is respectively 0,6,7,8,9,10 μ g/ml.37 degree, 5%CO2Cell incubator culture.Replacement in cell every two days once contains The complete medium of respective concentration puromycin, and each hole cell growth status is observed daily.It can kill within 4 days corresponding The puromycin minimum concentration of whole cells is final drug screening concentration in hole.
Fig. 6 is rat bone marrow mesenchymal stem cells microscope photo (× 100) after various concentration puromycin screens 4 days, Wherein A:0 μ g/ml, B:6 μ g/ml, C:7 μ g/ml, D:8 μ g/ml, E:9 μ g/ml, F:10 μ g/ml；As it can be seen that drug concentration is 9 μ When g/ml, whole cells can be killed, therefore finally determine that puromycin screening concentration is 9 μ g/ml.
(6) recombined lentivirus vector transfected into rat BMSCs and transfection after puromycin screen
The rat bone marrow mesenchymal stem cells of logarithmic growth phase are inoculated in 96 orifice plates by the day before transfection, and every hole is added 4 ~5 × 104A cell (inoculum density is to cover within cell 3~4 days to be advisable)；And be added into every hole 100 μ l containing 10% serum Low sugar culture medium, be then placed in 37 degree, 5%CO2Cell incubator culture.When cell fusion degree reaches 30% or so, abandon Original fluid is removed, according to step (5) experiment as a result, transfected with infection multiplicity (MOI=100), 10 μ are added into each hole (virus liquid is the virus stock solution used that step 3 obtains to l virus liquid, and virus titer is 2 × 108TU/ml), the final concentration of 5 μ g/ of 10 μ l The low sugar culture medium containing 10% serum of the ploybrene enhancement solution of ml and 80 μ l, and cell is put back into 37 degree, 5%CO2Cell Incubator is incubated for.12h discards original fluid after infecting, and gains the low sugar culture medium containing 10% serum.After transfecting 48h, i.e., Fluorescence microscope transfected condition can be used, Fig. 7 is to be seen after slow-virus transfection BMSCs 48h under fluorescence microscope (× 100) GFP fluorogram is examined, Fig. 7 A: the white light visual field；Fig. 7 B: the fluorescence visual field；As it can be seen that after c-met slow-virus transfection BMSCs 48h, fluorescence Microscopically observation visible fluorescence, GFP positive cell account for total cell 10%；
After transfecting 72h, cell changes liquid (changing the low sugar culture medium containing 10% serum) and is added into each cell culture medium fast Purine mycin (concentration is 9 μ g/ml), the drug screening period is one week, after a week the observing effect under fluorescence microscope, it is seen that cell Fluorescent positive rate is up to 100%.Then puromycin drug concentration is maintained 1.8 μ g/ml, after ten days under fluorescence microscope after Continuous observing effect, it is seen that cell fluorescence positive rate remains within 100%.Therefore obtain the cell strain for stablizing expression c-met gene.
Fig. 8 is that slow-virus transfection BMSCs sieve medicine observes GFP fluorogram under fluorescence microscope (× 100) after a week, wherein Fig. 8 A: the white light visual field, Fig. 8 B: the fluorescence visual field, it is seen then that after a week fluorescent positive rate forms up to 100% and stablizes expression c- for screening The rat BMSCs of met gene.
(7) Western-blot method detects stable transfected cells strain c-met protein expression situation
GFP slow virus carrier is constructed using above-mentioned same procedure, and transfects BMSCs, forms the BMSCs for stablizing expression GFP. Two groups of BMSCs of the BMSCs (step (6) obtains) and stable transfection GFP of the stable transfection c-met of same cell number are taken respectively The detection of cell row Western blot method.
The specific method is as follows:
Cell culture fluid is discarded, PBS exhausts after washing twice, and adds 1 × Lysis of 150ul buffer and (is purchased from green cloud Its company), it is blown and beaten with liquid transfer gun head to cell and is sufficiently cracked, obtained cell cracking sample is transferred in EP pipe, is split again on ice Cell 10-15min is solved, then 4 DEG C, 12000g, 5min is centrifuged, is put into boiling water after water-bath 10min, then 4 DEG C, 12000g, It is centrifuged 1min, -80 DEG C save backup.
8%SDS-PAGE separation gel is prepared, preparation method is as shown in table 7:
7 8%SDS-PAGE separation gel of table prepares system
H2O 4.6ml
30%PAGE 2.7ml
1.5mol/LTris(pH8.8) 2.5ml
10%SDS 0.1ml
10%APS 0.1ml
TEMED 0.006ml
After equal gellings are admittedly good, comb is taken out, electrophoretic buffer cleans loading hole, ready sample is subjected to loading, on Power on after sample, starts electrophoresis after checking positive and negative anodes, constant pressure 80V when electrophoresis, 2 hours.After electrophoresis, transfer is used Electrophoretic apparatus, electricity turns 150min under 4 DEG C, 300mA constant current conditions, (will be purchased from millipore public affairs on protein delivery to pvdf membrane Department).Pvdf membrane 1h is closed with confining liquid (the TBST solution containing 5% skim milk) room temperature, primary antibody (rabbit-anti c-met, 5ml) is incubated for After 2h, TBST is washed film 3 times, and secondary antibody (donkey anti-rabbit IgG, 15ml) is incubated for 2h, and TBST is washed film 3 times.Using Amersham company ECL+ PlusTM Western blotting system kit develops the color, exposure, imaging analysis.
Fig. 9 is c-met protein expression situation in Western-blot detection BMSCs, wherein 1 is stable transfection c-met's BMSCs group, albumen size are 154KD, show that stable transfection c-met gene BMSCs cell strain can high efficient expression c-met egg It is white；The BMSCs group of 2 stable transfection GFP.
(8) stablize the BMSCs group of expression c-met, the BMSCs group of stable expression GFP and physiological saline group and treat liver respectively Three groups of rat liver pathological change situations after failure SD rat 72h
6 week old SD male rat (weight 220-260g) 15 is chosen, is divided into three groups (A, B, C), every group 5.Using D- Amine-galactose (dosage 900mg/kg is purchased from Sigma company) and LPS (dosage 10ug/kg is purchased from Sigma company) joint abdomen Chamber injection manufacture rats'liver exhaustion model.After modeling is completed for 24 hours, A group SD rat stablizes expression c-met by tail vein injection BMSCs (dosage be 1.4 × 107A cell/kg, is dissolved in 1ml physiological saline), B group SD rat is steady by tail vein injection Surely (dosage is 1.4 × 10 to the BMSCs of expression GFP7A cell/kg, is dissolved in 1ml physiological saline), C group SD rat is quiet by tail Arteries and veins injects 1ml physiological saline.After completion 72h to be injected, cervical dislocation puts to death three groups of SD rats, takes out liver respectively and is put in It impregnates and fixes in 4% formaldehyde (being purchased from Xilong Chemical Co., Ltd), HE dyeing three groups of SD rat liver pathological changes of observation.
Figure 10 is that the BMSCs group for stablizing expression c-met, the BMSCs group of stable expression GFP and physiological saline group are treated respectively Three groups of hepatic pathology figures after hepatic failure SD rat 72h (A: stablize expression c-met BMSCs treatment group hepatic pathology figure (× 100), B: stablize the BMSCs treatment group hepatic pathology figure (× 100) of expression GFP, C: saline therapy group hepatic pathology figure (×100).From three groups of pathology figures as it can be seen that the BMSCs treatment group hepatic pathology for stablizing expression c-met has no obvious degeneration of liver cells And large stretch of necrosis of liver cells and inflammatory infiltration, stabilization express the visible degeneration of liver cells of BMSCs treatment group hepatic pathology of GFP, water Swollen and inflammatory infiltration, has no large stretch of necrosis of liver cells, and the visible obvious degeneration of liver cells of saline therapy group hepatic pathology, water Swollen and large stretch of necrosis of liver cells and inflammatory infiltration.Show that A group SD rat therapeutic effect is best.
Embodiment 2 is stablized the BMSCs group of expression c-met, the BMSCs group of stable expression GFP and physiological saline group and is controlled respectively Surviving rats rate after treatment hepatic failure SD rat
6 week old SD male rat (weight 220-260g) 18 is chosen, is divided into three groups (A, B, C), every group 6.Using D- Amine-galactose (dosage 900mg/kg is purchased from Sigma company) and LPS (dosage 10ug/kg is purchased from Sigma company) joint abdomen Chamber injection manufacture rats'liver exhaustion model.
After modeling is completed for 24 hours, A group SD rat stablizes the BMSCs (dosage 1.4 of expression c-met by tail vein injection ×107A cell/kg, is dissolved in 1ml physiological saline), B group SD rat stablizes the BMSCs of expression GFP by tail vein injection (dosage is 1.4 × 107A cell/kg, is dissolved in 1ml physiological saline), C group SD rat passes through tail vein injection 1ml physiology salt Water.Then the Survival of three groups of SD rats is observed.
Figure 11 is that the BMSCs group for stablizing expression c-met, the BMSCs group for stablizing expression GFP and three groups of SD of physiological saline group are big Mouse survival rate curve graph, as seen from the figure, after 1 week, A group (c-met-BMSCs group) SD rats death 1, B group (GFP-BMSCs Group) SD rats death 3, C group (physiological saline group) SD rat is all dead.Show that A group SD rat therapeutic effect is best.
SEQUENCE LISTING
<110>Zhu Chuanlong
<120>method of the rat bone marrow mesenchymal stem cells cell strain of building stability and high efficiency expression c-met albumen
<130> 4
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 56
<212> DNA
<213>artificial synthesized
<400> 1
gaggatcccc gggtaccggt cgccaccatg aaggctccca ccgcgctggc acctgg 56
<210> 2
<211> 47
<212> DNA
<213>artificial synthesized
<400> 2
tccttgtagt ccatacctgt gttcgcttcg ccgtcaatgt tgtcttg 47
<210> 3
<211> 22
<212> DNA
<213>artificial synthesized
<400> 3
ccagtttccc aactcctctc ag 22
<210> 4
<211> 22
<212> DNA
<213>artificial synthesized
<400> 4
ccttatagtc cttatcatcg tc 22

Claims (1)

1. a kind of method of the rat bone marrow mesenchymal stem cells cell strain of building stability and high efficiency expression c-met albumen, feature It is, the specific steps are as follows:
A SPF grades of SD male rats of 4 week old) are chosen, extracts and cultivates BMSCs；
B) respectively using SEQ ID NO.1 and SEQ ID NO.2 as upstream and downstream primer, using c-met gene as template, PCR expansion is carried out Increase target gene c-met and identification is sequenced；
PCR reaction system: the 4 μ l of dNTP Mix of 5 × PS Buffer 10 μ l, 2.5 mM each, 10 μM of upstream primer 1 μ l, 1 μ l, PrimeSTAR HS DNA polymerase of template, the 0.5 μ l of 10 μM of downstream primer 1 μ l, 10 ng/ μ L, ddH2O complements to 50 μ l；
PCR reaction condition: 98 DEG C of preheating 5min；98 DEG C of 10s, 55 DEG C of 10s, 72 DEG C of 90s, totally 30 recycle；4 DEG C are prolonged It stretches；
C restriction enzyme A geI digestion slow virus carrier GV358) is utilized, in 37 DEG C of 3 h of reaction, i.e. acquisition slow virus carrier The digestion products linearized vector DNA of GV358；
Digestion system: 10 × CutSmart Buffer, 5 μ l, the 2 μ l of Plasmid DNA of the purifying of 1 μ g/ μ L, the limitation of 10 U/ μ l Property restriction endonuclease AgeI enzyme 1 μ l, ddH2O complements to 50 μ l；
D linearized vector DNA and target gene recombining reaction system) are prepared, in 37 DEG C of 30 min of reaction, obtains slow virus table Up to carrier GV358-c-met；
Recombining reaction system: 5 × CE II Buffer 2 μ l, step C) obtain the linearized vector that concentration is 800ng/ μ L DNA 2.5 μ l, step B) obtain 1 μ l, Exnase II of target gene c-met 1 μ l, ddH that concentration is 700ng/ μ L2O is supplied To 10 μ l；
E 20 μ g of GV358-c-met, 15 pHelper1.0 μ g, 10 pHelper2.0 μ g) are added into centrifuge tube, with 2000 transfection reagent of Invitrogen Lipofectamine complements to 1ml, is incubated for 15min at room temperature；Then it is close to instill cell Degree is in 70%~80% 293T cell, in 37 DEG C, 5% CO26h is cultivated, culture medium is then discarded, is added containing 10% serum Cell culture medium, in 37 DEG C, containing 5% CO2Continue to cultivate 48-72h；
What the 293T cell that the cell density is 70%~80% was obtained by: preceding 24 h of transfection, with trypsin digestion pair The 293T cell in number growth period, with the cell culture medium adjustment cell density containing 10% serum for 5 × 106 Cell/15 ml, inoculation In the Tissue Culture Dish that diameter is 10cm, in 37 DEG C, containing 5% CO2Incubator in culture, to cell density up to 70%~ It can be used to transfect when 80%；And 2h replaces medium to serum free medium before transfecting；
F 293T cell supernatant) is collected, in 4 DEG C, 4000 g are centrifuged 10 min；Supernatant is taken to filter with 0.45 μm of filter, Filtrate is regathered in 4 DEG C, 25000 rpm, is centrifuged 2h；It discards supernatant, virus is added and saves liquid, is i.e. acquisition c-met gene is sick slowly Poison；
G) BMSCs of logarithmic growth phase is inoculated in 96 orifice plates, every hole is added 4~5 × 104A cell and 100 μ l contain 10% blood Clear cell culture medium discards culture medium when cell fusion degree reaches 30%, and 10 μ l step F are added into each hole) obtain disease Malicious titre is 2 × 108 The c-met gene slow virus of TU/ml, the final concentration of 5 μ g/ml of 10 μ l ploybrene enhancement solution and 80 μ The cell culture medium containing 10% serum of l, in 37 DEG C, 5% CO2Culture；
After infecting 12h, culture medium is discarded, the cell culture medium that 100 μ l contain 10% serum is added in every hole；Infect 72h after, again with Cell culture medium containing 10% serum changes liquid, and the puro of final concentration of 9 μ g/ml is added to every hole；To microscopically observation Drug screening concentration is maintained 1.8 μ g/ml up to after 100% by cell fluorescence positive rate, i.e. acquisition stability and high efficiency expresses c-met egg White rat bone marrow mesenchymal stem cells cell strain；
Wherein, the cell culture medium preparation method for containing 10% serum are as follows: by percentage to the quality, 89% DMEM is cultivated It is obtained after base, 10% fetal calf serum and the mixing of 1% Pen .- Strep solution.
CN201610662140.4A 2016-08-12 2016-08-12 Method for constructing rat bone marrow mesenchymal stem cell strain for stably and efficiently expressing c-met protein Active CN106282240B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610662140.4A CN106282240B (en) 2016-08-12 2016-08-12 Method for constructing rat bone marrow mesenchymal stem cell strain for stably and efficiently expressing c-met protein

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610662140.4A CN106282240B (en) 2016-08-12 2016-08-12 Method for constructing rat bone marrow mesenchymal stem cell strain for stably and efficiently expressing c-met protein

Publications (2)

Publication Number Publication Date
CN106282240A CN106282240A (en) 2017-01-04
CN106282240B true CN106282240B (en) 2019-09-13

Family

ID=57669589

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610662140.4A Active CN106282240B (en) 2016-08-12 2016-08-12 Method for constructing rat bone marrow mesenchymal stem cell strain for stably and efficiently expressing c-met protein

Country Status (1)

Country Link
CN (1) CN106282240B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107502594A (en) * 2017-07-14 2017-12-22 中国药科大学 A kind of bone marrow mescenchymal stem cell strain of Stable Expression of Exogenous EX-4 genes
CN114703145A (en) * 2022-05-19 2022-07-05 山东灵犀生物科技有限公司 Mesenchymal stem cell and preparation method thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101912618A (en) * 2010-08-09 2010-12-15 祝荫 Preparation method of bone mesenchymal stem cell carrying NK4 gene and application thereof
CN103160469A (en) * 2013-03-19 2013-06-19 山西大学 DLD1 stable cell strain efficiently expressing human PKM1 protein and construction method thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101912618A (en) * 2010-08-09 2010-12-15 祝荫 Preparation method of bone mesenchymal stem cell carrying NK4 gene and application thereof
CN103160469A (en) * 2013-03-19 2013-06-19 山西大学 DLD1 stable cell strain efficiently expressing human PKM1 protein and construction method thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
转染绿色荧光蛋白的大鼠胚胎肝干细胞的鉴定及治疗急性肝损伤的研究;双剑博;《中国优秀硕士学位论文全文数据库医药卫生科技辑》;20091215(第12期);第14页第2段 *

Also Published As

Publication number Publication date
CN106282240A (en) 2017-01-04

Similar Documents

Publication Publication Date Title
CN104450620B (en) A kind of replied immortalized hepatocyte strain carrying double independent variable and its construction method
EA024878B1 (en) Gene encoding human glucokinase mutant characterized by enhanced stability, and use thereof for controlling blood glucose or for preventing and treating disturbances of carbonydrate metabolism
CN106163572A (en) Composition for inducing direct transdifferentiation of somatic cells into vascular progenitor cells and use thereof
CN110123828A (en) Application of the inhibitor of PRALR in the drug that resistance to taxol oophoroma is treated in preparation
CN106282240B (en) Method for constructing rat bone marrow mesenchymal stem cell strain for stably and efficiently expressing c-met protein
Alaee et al. Biodistribution of LV-TSTA transduced rat bone marrow cells used for “ex-vivo” regional gene therapy for bone repair
CN107353333A (en) A kind of bone protectiveness molecule Semaphorine3A and its pharmacy application
CN107287224A (en) Secrete TRAIL mescenchymal stem cell and its treat the purposes of brain tumor
CN111494634B (en) Nucleic acid medicine for treating chronic pain
CN103224956B (en) A kind of carry Neuritin gene II type adeno-associated virus and repairing the application in optic nerve injury
CN110772483B (en) Application of hydrogen sulfide modified mesenchymal stem cell outer vesicle serving as miRNA delivery vector in hypoxic-ischemic brain injury
CN105039342A (en) siRNA capable of inhibiting MAT2A genetic expression and application of siRNA
CN110129318A (en) Long-chain non-coding RNA PRALR and its expression plasmid and purposes
CN112251410A (en) Mouse-derived gastric cancer cell line NCCG1, and establishment method and application thereof
CN105457028B (en) The stress sensitivity microRNA of regulating and controlling effect is played in bon e formation
CN109536497A (en) The application of schistosoma japonicum infection and its component in human tumor prevention and treatment
CN106065401B (en) Treatment use of the lentivirus mediated CXCR7 high expression engineering endothelial progenitor cells in ischemic disease
CN110129319A (en) A kind of siRNA of PRALR and application thereof
CN106148341A (en) The inhibitor of a kind of lncRNA-MSR and application thereof
CN107345221A (en) A kind of TGF β 1 modify the preparation method of umbilical cord mesenchymal stem cells and the application in rheumatism
CN114042064A (en) Application of nitazoxanide in pharmacy
CN111549033B (en) Lentiviral-infected human epidermal keratinocyte strain and construction method and application thereof
CN110343165A (en) Tumor-antigen peptide and its application
CN101940796A (en) Preparation of gene immunization treating tumor used for vein
CN114134181B (en) Expression unit, recombinant lentivirus expression vector, recombinant lentivirus, and preparation method and application thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right

Effective date of registration: 20190814

Address after: 210019 No. 300 Guangzhou Road, Gulou District, Nanjing City, Jiangsu Province

Applicant after: JIANGSU PROVINCE HOSPITAL(The First Affiliated Hospital of Nanjing Medical University)

Address before: Department of Jiangsu Province People's Hospital, No. 300 Guangzhou Road, Gulou District of Nanjing City, Jiangsu province 210029 infection

Applicant before: Zhu Chuanlong

TA01 Transfer of patent application right
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20220614

Address after: No. 19, Taizishan Road, Dachang street, Jiangbei new district, Nanjing, Jiangsu 210000

Patentee after: Jiangsu Nahua Biotechnology Co.,Ltd.

Address before: 210019 No. 300, Guangzhou road, Gulou District, Nanjing City, Jiangsu Province

Patentee before: JIANGSU PROVINCE HOSPITAL(The First Affiliated Hospital of Nanjing Medical University)

TR01 Transfer of patent right