CN106282189B - A kind of application in rice stem and the specifically expressed promoter of young fringe - Google Patents
A kind of application in rice stem and the specifically expressed promoter of young fringe Download PDFInfo
- Publication number
- CN106282189B CN106282189B CN201610914788.6A CN201610914788A CN106282189B CN 106282189 B CN106282189 B CN 106282189B CN 201610914788 A CN201610914788 A CN 201610914788A CN 106282189 B CN106282189 B CN 106282189B
- Authority
- CN
- China
- Prior art keywords
- promoter
- rice
- stem
- fringe
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8226—Stem-specific, e.g. including tubers, beets
Abstract
The invention discloses a kind of applications in rice stem and the specifically expressed promoter of young fringe, belong to plant genetic engineering field.It is in rice stem and the young specifically expressed promoter of fringeOsPTR10The promoter of gene, sequence is as shown in SEQ ID NO.1.The present invention is detected by constructing promoter-GUS transfer-gen plants and GUS expression activities, it is found that the promoter is a specifically expressed promoter in stem and young fringe, it is specific expressed in the stem of rice and young fringe can to start downstream gene.It willOsPTR10The promoter of gene is applied in transgenic engineering, can make the expression product of other purposes gene is special to be accumulated in stem and fringe, increase local expression amount, therefore the promoter has good application prospect in transgenic engineering.
Description
Technical field
The invention belongs to plant genetic engineering fields, and in particular to a kind of in rice stem and the specifically expressed promoter of young fringe
Application.
Background technology
In the various a great number of elements needed for plant growth, nitrogen is to have the call in plant growth and play restrictive function
Important element, be the primary factor of limiting plant growth and plant products, meanwhile, nitrogen is also most common in the ecosystem
Limitation sex factor [acute Cheng Xin, consumption, Wang Zhiqin wait rice high yields and High Efficient nitrogen research on utilization progress [J] China rice,
2013,19：16-21.].The appropriate amount of application of nitrogen fertilizer that increases is one of the major measure for making crop obtain high yield, however nitrogen fertilizer use
Rate is low and with a large amount of applied nitrogen of people, causes the loss of a large amount of nitrogens, right due to its discharge to air and water body
Environment brings a series of the problem of making people worried, and different degrees of destruction is then caused to the ecological balance.Thus, improve farming
Absorption and recycling efficiency of the object to nitrogen, not only can provide theoretical foundation, to improving crop yield for research from now on
It is also of great significance with the pollution for reducing ecological environment.
As molecular biology and genetic engineering are in the rapid development of plant field, the molecule that plant transports Nitrogen Absorption
Mechanism is also more and more clear.Show that the transport protein of nitrogen is broadly divided into amino acid transport proteins, oligopeptides fortune according to probing into for forefathers
Egg output is white, five large family of purine and purine derivative transport protein, ammonium root transport protein and nitrate anion transport protein (NRT1).It is few
Peptide transporter gene family is divided into the PTR transporter genes family (peptide of oligopeptides of the transport containing 2~3 amino acid residues
Transporter family, PTR) and transport 4~5 amino acid residues oligopeptides OPT transporter genes family
[Cai Zhaoyan, Liu Tao, Fang Zhongming wait plant oligopeptides to transport to (oligopeptide transporter family, OPT) two major classes
Defeated progress [J] tropical and subtropical plant journals with nitrate anion transporter gene family, 2011,19 (1)：91-96.].Its
Middle NRT1 and PTR belongs to same gene family NPF (NRT1/PTR, nitrate transporter on sequence homology
1/peptide tansporter 1) family, the substances such as the small-molecular peptides of nitrate anion, 2-3 amino acid can be mediated to carry out
Albumen [Rentsch D, Schmidt S, the Tegeder M.Transporters for uptake and of transdermal delivery
allocation of organic nitrogen compounds in plants.FEBS Let,2007,581:2281-
2289.]。
There are 84 NPF homologous genes in rice, but the function of these gene families member and effect are also known little about it at present,
Only a few gene it has been reported that.Studies have found that one nitric acid for belonging to PTR families of SP1 (OsNPF4.1) gene code
Salt transport protein determines spike length of rice [Li SB, Qian Q, Fu ZM, et al.Short panicle1encodes a
putative PTR family transporter and determines rice panicle size.The Plant J,
2009,58(4)：592-605.]；The expression of OsPTR9 (OsNPF8.20) is adjusted by exogenous nitrogen and circadian rhythm, changes OsPTR9
Expression influence rice nitrogen utilization efficiency, growth and yield [Fang ZM, Xia KF, Yang X et al.Altered
expression of the PTR/NRT1homologue OsPTR9affects nitrogen utilization
efficiency,growth and grain yield in rice.Plant Biotech J,2013,11(4)：446-
458.].The spatial and temporal expression specificity of other members of NPF gene families is not known.
Invention content
It is an object of the invention to solve problems of the prior art, provide a kind of in rice stem and the special table of young fringe
The application of the promoter of the rice NPF gene family member's OsPTR10 genes reached.
The purpose of the invention is achieved by the following technical solution：
The present invention will be built first using the promoter of NPF gene family member's OsPTR10 genes of rice as object
In the callus that promoter-GUS expression vectors are induced by agrobacterium mediation converted to Mature Embryos of Rice, transgenosis plant is obtained
Positive plant is identified after strain, is then obtained T1 for transfer-gen plant, is obtained T2 for mature seed.Then in T2 for seed growth
Different times carry out GUS histochemical stains respectively, are dyed respectively to different tissues such as the root of its plant, stem, leaf, fringes,
GUS expression activities are detected, its tissue expression specificity is analyzed.As a result, it has been found that the promoter is a special table in stem and young fringe
It is specific expressed in the stem of rice and young fringe can to start downstream gene for the promoter reached.The promoter is applied to turn base
Because that in engineering, can make the expression product of other purposes gene is special to be accumulated in stem and fringe, increase local expression amount.Therefore,
The promoter of OsPTR10 genes has good application prospect in transgenic engineering.
A kind of application of the promoter of OsPTR10 genes in rice, can start downstream gene in water for the promoter
It is specific expressed in rice stem and/or fringe.The method for realizing the application specifically comprises the following steps：Build the promoter-purpose base
The expression vector of cause, then transgenic paddy rice will be obtained in expression vector Introduced into Rice, target gene can be in rice stem and/or fringe
In it is specific expressed, achieve the purpose that increase target gene local expression amount.
The promoter sequence is as shown in SEQ ID NO.1, or is to be taken to sequence shown in SEQ ID NO.1
In generation, adds and/or lack that one or several nucleotide obtain does not influence downstream gene expression, the DNA sequences with same function
Row.
The skeleton carrier of the expression vector is preferably pCAMBIA-1301 carriers.
Present invention finds the promoter of OsPTR10 genes, can to start downstream gene special in the stem and young fringe of rice
Property expression.The promoter is applied in transgenic engineering, can make the expression product of other purposes gene it is special in stem and
Fringe accumulates, and increases local expression amount, there is good application prospect.
Description of the drawings
Fig. 1 is the PCR qualification figures of the transfer-gen plant of promoter-GUS expression vectors.In figure, M is DNA size bars
Band, each swimming lanes of 1-11 are T0 for transfer-gen plant, wherein swimming lane 1,2,4,10 has band, is positive plant.
Fig. 2 is GUS expression activities situation in transfer-gen plant pustulation period stem, and the blue in figure is deep, indicates GUS expression activities
Height illustrates that promoter can start downstream gene and be expressed in stem.
Fig. 3 is GUS expression activities situation in transfer-gen plant pustulation period fringe, and the blue in figure is deep, indicates GUS expression activities
Height illustrates that promoter can start downstream gene and be expressed in fringe.
Specific implementation mode
With reference to embodiment, the present invention will be further described in detail, and embodiments of the present invention are not limited thereto.
Unless otherwise specified, the conventional means that the technological means used in following embodiments is well known to those skilled in the art；Used
Experimental method is conventional method, and can according to described recombinant technique (referring to molecular cloning, laboratory manual, second edition,
CSH Press, Cold SpringHarbor, New York) it completes；Material, reagent used etc., are commercially available.
The structure of the promoter-GUS transfer-gen plants of embodiment 1OsPTR10 genes
The DNA that 11 are spent in extraction rice, utilizes amplimer F (AAGCTTGGAGGAAGGGTAGCTCAA, SEQ ID
NO.2) and amplimer R (CCATGGGAATGGTGTAATGGTGGC, SEQ ID NO.3) passes through PCR amplification OsPTR10 genes
Promoter sequence after, being connected into pCAMBIA-1301 carriers using HindIII, NcoI digestion, (pCAMBIA-1301 carriers are purchased from
Cambia companies), construct promoter-GUS expression vectors pOsPTR10-p1301.The heredity mediated using Agrobacterium EHA105
Promoter-GUS expression vectors are imported normal rice varieties by method for transformation by rice transformation mature embryo-derived callus
In spend in 11.
By the transplanting of all transgenic plants in the basket with soil, periodically water, fertilising, when seedling grows tall about 10cm,
Kind after seedling is grown up, is detected transfer-gen plant by PCR in big Tanaka.Detection primer to for：
Detection primer F：TCACGGCACTGTGTAGGT (SEQ ID NO.4),
Detection primer R：CTCTGCTCTGTTATCTTTGC(SEQ ID NO.5).
If amplifying the segment of 624bp, transfer-gen plant is positive plant, the result is shown in Figure 1.Positive plant single plant sowing
And plant, until in T2 generations, identify the transfer-gen plant of the unseparated homozygosis of strain gene.
The detection of 2 transfer-gen plant different parts promoter-GUS expression activities of embodiment
Stage, seedling period, tillering stage, reproduction period are sprouted to T2 for the different portions of homozygous transgenic plant in seed respectively
Position carries out GUS dyeing, and detailed process is as follows：
After harvest identifies successful T2 for seed, impregnated in water, and cultivated in 37 DEG C of constant incubators.It waits planting
The sub- sprouting stage is showing money or valuables one carries unintentionally period and germination period carries out GUS dyeing respectively.
It waits for that the bud of seed grows to 2cm or so, is seeded into 96 orifice plates, pancebrin water planting is used under greenhouse illumination, is waited for
In seedling period, use rice nutrition liquid culture instead, rice nutrition liquid uses International Rice Research Institute's conventional nutrient liquid, ingredient to see below
Table 1.It waits for that seedling grows to 15cm or so, GUS dyeing is carried out to leaf, the root of seedling.
The ingredient of 1 International Rice Research Institute's conventional nutrient liquid of table
Note：When preparing micro- stock solution, various salts dissolve respectively, then the sulfuric acid mixing with 50mL, add distilled water
It is diluted to 1L.Per the micro- stock solution 5mL of 4L nutrient solution additions when use.PH value is adjusted to 5.0 with NaOH, changes one within every two days
Secondary culture solution.
It waits for that seedling is grown in 20cm or so, is transplanted in soil, greenhouse illumination cultivation.Tillering stage is waited for, to plant
Leaf, root, stem and base portion carry out GUS dyeing.
In reproduction period, respectively boot stage, heading stage, florescence, pustulation period and maturity period respectively to T2 for plant leaf,
The different tissues such as stem, root and fringe position carries out GUS dyeing.
The above material invades bubble and is placed in 37 DEG C of heat preservations after GUS dyeing liquors to overnight.Then after being decolourized 3 times with 75% alcohol
It is stored in 4 DEG C.Material after being decolourized with alcohol is placed in microscopically observation, blue position is GUS activity expressions site.
As a result see Fig. 2,3, find that GUS activity is higher in stem and fringe by dyeing.
The above results show that the promoter of OsPTR10 genes is a specifically expressed promoter in stem and young fringe, energy
It is specific expressed in the stem of rice and young fringe enough to start downstream gene.The promoter is applied in transgenic engineering, it can be
Rice generative growth phase promotes reallocation of the leaf nutrition substance by cane to fringe portion, promotes seed Grain Filling, also may be used
It is accumulated in stem and fringe so that the expression product of other purposes gene is special, increases local expression amount.Therefore OsPTR10 genes
Promoter has good application prospect in transgenic engineering.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, it is other it is any without departing from the spirit and principles of the present invention made by changes, modifications, substitutions, combinations, simplifications,
Equivalent substitute mode is should be, is included within the scope of the present invention.
Claims (3)
1. a kind of application of promoter of OsPTR10 genes in rice, it is characterised in that：The application is the promoter energy
It is specific expressed in rice stem and/or fringe enough to start downstream gene；The sequence of the promoter such as SEQ ID NO.1 institutes
Show.
2. application according to claim 1, it is characterised in that：Include the following steps：Build the promoter-target gene
Expression vector, then transgenic paddy rice will be obtained in expression vector Introduced into Rice, target gene can be special in rice stem and/or fringe
Opposite sex expression.
3. application according to claim 2, it is characterised in that：The skeleton carrier of the expression vector is pCAMBIA-
1301 carriers.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610914788.6A CN106282189B (en) | 2016-10-20 | 2016-10-20 | A kind of application in rice stem and the specifically expressed promoter of young fringe |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610914788.6A CN106282189B (en) | 2016-10-20 | 2016-10-20 | A kind of application in rice stem and the specifically expressed promoter of young fringe |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106282189A CN106282189A (en) | 2017-01-04 |
| CN106282189B true CN106282189B (en) | 2018-11-13 |
Family
ID=57719114
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610914788.6A Active CN106282189B (en) | 2016-10-20 | 2016-10-20 | A kind of application in rice stem and the specifically expressed promoter of young fringe |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106282189B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107142261B (en) * | 2017-06-02 | 2020-11-03 | 武汉生物工程学院 | Promoter specifically expressed in young ears of rice and application thereof |
| CN109486821B (en) * | 2018-12-28 | 2021-05-18 | 武汉生物工程学院 | Application of promoter specifically expressed in rice stem |
| CN110982828B (en) * | 2020-01-02 | 2022-08-30 | 南京农业大学 | Nitrate transport protein gene specifically induced by rice arbuscular mycorrhiza and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7560626B2 (en) * | 2005-12-23 | 2009-07-14 | Arcadia Biosciences, Inc. | Promoter sequence obtained from rice and methods of use |
| MX2010008052A (en) * | 2008-01-31 | 2010-08-23 | Basf Plant Science Gmbh | Plants having increased yield-related traits and a method for making the same. |
| CN102604962B (en) * | 2011-01-20 | 2013-07-10 | 中国科学院华南植物园 | Gene OsPTR9 capable of improving nitrogen absorption efficiency and yield of rice and application thereof |
-
2016
- 2016-10-20 CN CN201610914788.6A patent/CN106282189B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN106282189A (en) | 2017-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106434666B (en) | A kind of application in rice tillering bastem portion and the specifically expressed promoter of fringe | |
| CN105949295B (en) | With the albumen and its encoding gene of flowering of plant time correlation and application | |
| CN106282189B (en) | A kind of application in rice stem and the specifically expressed promoter of young fringe | |
| CN106337055B (en) | Application of the nitrate anion transporter gene OsNRT1.8 in rice breeding | |
| CN106518993A (en) | Application of amino acid transporter gene OsAAP3 in rice seed selection | |
| CN106929522A (en) | Amino acid transport gene OsAAP1 promotes the application of paddy growth under low nitrogen | |
| CN104232682B (en) | Method for cultivating high-yield plant by overexpression of gma-miR156b | |
| CN106119262A (en) | Improve Oryza sativa L. nitrogen use efficiency and the gene OsPTR10 of yield and purposes | |
| CN107099549A (en) | Application of the OsNPF5.16 genes in paddy rice single plant yield is improved | |
| CN108034672A (en) | Applications of the nitrate anion transporter gene OsNRT1.9b in rice selection and breeding | |
| CN106434693A (en) | Application of amino acid transport gene OsAAP4 to rice breeding | |
| CN106967730A (en) | Application of the OsNPF6.3 genes in rice tillering number is improved | |
| CN113754732B (en) | Small molecular substance for improving cotton yield and fiber quality | |
| CN106591354A (en) | Application of amino acid transport gene OsAAP5 to rice breeding | |
| CN108070601A (en) | Application of the OsNPF8.6b genes in rice yield is improved | |
| CN106868022B (en) | Nitrogen transport gene OsNPF2.4b for promoting increase of effective spike number of rice and application thereof | |
| CN1858206A (en) | Plant multifunction activity and broad spectrum resistance cell signal factor encoding hrpN gene and its expression product and use | |
| CN106480029B (en) | A kind of application of the rice starter by extraneous organic nitrogen regulating and expressing | |
| CN109097360B (en) | Biological method for visually detecting low nitrogen stress degree of rice root system | |
| CN107936103A (en) | Application of the OsNPF7.11b genes in rice yield is improved | |
| CN107325161A (en) | A kind of albumen related with high-salt stress to resistance to Low nitrogen stress and its encoding gene and application | |
| CN108034661A (en) | Application of the OsNPF8.8b genes in rice yield and nutritional quality is improved | |
| CN109486823A (en) | A kind of application of highly expressed long-grained nonglutinous rice type promoter in japonica rice | |
| CN107056909A (en) | Application of the OsNPF5.11 genes in rice yield is improved | |
| CN107354191A (en) | It is a kind of to be used to promote plant growth and the biological agent of the prevention and control of plant diseases, pest control |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |