CN106244605B - CYP71Z18 gene and its coding albumen and application - Google Patents
CYP71Z18 gene and its coding albumen and application Download PDFInfo
- Publication number
- CN106244605B CN106244605B CN201610819977.5A CN201610819977A CN106244605B CN 106244605 B CN106244605 B CN 106244605B CN 201610819977 A CN201610819977 A CN 201610819977A CN 106244605 B CN106244605 B CN 106244605B
- Authority
- CN
- China
- Prior art keywords
- cyp71z18
- atcpr1
- pcdf
- pdest14
- added
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Nutrition Science (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a kind of CYP71Z18 genes, and the nucleotide sequence of the gene is as shown in SEQ ID NO:1.The invention also discloses a kind of coding albumen of CYP71Z18 gene, and amino acid sequence is as shown in SEQ ID NO:2.The invention also discloses a kind of coding albumen of CYP71Z18 gene to adjust and produce the application in plant diterpene-kind compound and rice breeding.The present invention helps industrially to produce a variety of new diterpene-kind compounds using CYP71Z18 catalysis characteristics, and has most important theories and practice significance to the route of synthesis etc. of transformation rice diterpene-kind compound.
Description
Technical field
The invention belongs to crops genetic engineering fields, specifically, being related to a kind of CYP71Z18 gene and its coding egg
White and application.
Background technique
Natural antimicrobial substance protective plant protecting agent can respond pathogen infection, provide disease resistance.Rice terpene protective plant protecting agent is in early stage
It is just found in research, this makes rice become the modular system that research protective plant protecting agent is formed.The terpene plant protection found for the first time in corn
Element is reported in recent years, including Diterpenes protective plant protecting agent kauralexins (Schmelz E A, Kaplan F, Huffaker A, et
al.Identity,regulation,and activity of inducible diterpenoid phytoalexins in
maize[J].Proceedings of the National Academy of Sciences of the United States
Of America, 2011,108 (13): 5455-60.) and sesquiterpenoids protective plant protecting agent zealexins (Huffaker A, Kaplan
F,Vaughan M M,et al.Novel acidic sesquiterpenoids constitute a dominant class
of pathogen-induced phytoalexins in maize[J].Plant Physiology,2011,156(4):
2082-97.).CYP71Z18 participates in zealexin biosynthesis, and the methyl of catalysis β-macrocarpene C15 forms carboxyl
(Mao H,Jiang L,Fei R,et al.Characterization of CYP71Z18 indicates a role in
maize zealexin biosynthesis[J].Phytochemistry,2015,121:4-10.)。
Diterpene-kind compound biosynthesis is to pass through prenyl on the basis of the synthesis of terpenoid precursor substance
The effect of transferase (Prenyl Transferases, PT) generates the Mang ox base Mang ox base pyrophosphoric acid of 20 carbon atoms
(Geranylgeranyl Diphosphate, GGPP), GGPP is further in Ke Baji pyrophosphate synthase (Copalyl
Diphosphate Synthase, CPS) and class kaurene synthase (Kaurene Synthase Like, KSL) under the action of
Two terpenes of basic framework for forming diterpene-kind compound forms Diterpenes by hydroxylating and carboxylated etc. on the basis of terpenes
Compound, wherein Cytochrome P450 is played an important role in modification.
Cytochrome P450 (CYPs, P450) is the superfamily of a kind of heme-thiolate proteins, it is with mercaptides
It is that oxidation reaction occurs for activated centre catalysis substrate in conjunction with heme, an oxygen atom is added in substrate, usual shape
At hydroxylated product.P450 can be catalyzed a variety of reactions, in addition to hydroxylating further includes dealkylation, the ring at the end N-, O- and S-
Oxygroup, deamination, desulfurization, dehalogenation and peroxidization etc..P450 needs the cell on endoplasmic reticulum when being catalyzed
The presence of cytochrome p 450 reductase, with electronics needed for providing oxidation reaction.
Rice generates more than 20 kinds of Diterpenes protective plant protecting agents, and nearly all relevant Terpene synthase all passes through the life of recombinant expression enzyme
Change mode has been accredited function (Xu M, Wilderman P R, Morrone D, et al.Functional
characterization of the rice kaurene synthase-like gene family[J]
.Phytochemistry,2007,68(3):312-26.).On the other hand, P450 catalysis characteristics are different, however how to utilize it
Diterpene substrates a variety of in rice are converted to new product and had not been reported by the catalysis of multiplicity.
Summary of the invention
In view of this, the present invention is directed to above-mentioned problem, provides a kind of CYP71Z18 gene and its coding albumen and answer
With the present invention encodes albumen by Metabolism of E. coli engineering, using CYP71Z18 in corn sequiterpene protective plant protecting agent biosynthesis
Catalytic activity analysis is carried out to a variety of rice diterpene, discovery CYP71Z18 can be catalyzed a variety of rice diterpene and form new product,
Its catalysis substrate is extensive.Therefore, a variety of new diterpene-kind compounds, and transformation can be industrially produced using its catalysis characteristics
The route of synthesis etc. of rice diterpene-kind compound.
In order to solve the above-mentioned technical problem, the invention discloses a kind of CYP71Z18 gene, the nucleotide sequences of the gene
As shown in SEQ ID NO:1, which is gene related with terpenoid anabolism.The DNA sequence dna of the gene by
1518 base compositions.
The invention also discloses a kind of albumen of CYP71Z18 gene coding, the ammonia with SEQ ID NO.2 in sequence table
Base acid residue sequence and the identical active egg as derived from SEQ IDNO.2 of amino acid residue sequence with SEQ IDNO.2
White matter.The coding albumen is made of 505 amino acid residues.
It prokaryotic expression carrier, cell line and host strain containing gene C YP71Z18 of the present invention and is being adjusted using the gene
Also within protection scope of the present invention with the application in production plant diterpene-kind compound and rice breeding.By SEQ ID
No.1 gene cloning to prokaryotic expression carrier pCDFDuet second multiple cloning sites (MCS2) restriction enzyme Nde I and
Between II site Bgl, the MCS1 of pCDFDuet contain arabidopsis cell cytochrome p 450 reductase gene AtCPR1 (Mizutani M,
Ohta D.Two isoforms of NADPH:cytochrome P450reductase in Arabidopsis
thaliana.Gene structure,heterologous expression in insect cells,and
Differential regulation. [J] .Plant Physiology, 1998,116 (1): 357-67.), AtCPR1 is
CYP450 provides required reducing power, and building has the recombinant expression carrier pCDF-AtCPR1- of CYP71Z18 gene
CYP71Z18.The MCS1 of pACYCDuet is connected with rice Ke Baji pyrophosphate synthase (OsCPS4) in the same direction, and MCS2 is connected with bracted fir Mang
Ox geranylpyrophosphate synthase (AgGGPS), carrier abbreviation pGGsC (Cyr A, Wilderman P R, Determan M, et
al.A modular approach for facile biosynthesis of labdane-related diterpenes.
[J].Journal of the American Chemical Society,2007,129(21):6684-5.).PGGeC's
MCS1 is connected with Ke Baji pyrophosphate synthase AtCPS, MCS2 inside arabidopsis and is connected with bracted fir Mang ox geranylpyrophosphate synthase
(AgGGPS).PDEST14-OsKSL be connected with respectively a variety of rice diterpene synthase genes (OsKSL4, OsKS7, OsKSL8,
OsKSL10, OsKSL11).PGGsC/pGGeC, pDEST14-OsKSL and pCDF-AtCPR1-CYP71Z18 are transferred to jointly big
Enterobacteria bacterial strain C41 (DE3) is overexpressed host strain, using isopropyl-beta D-thio galactopyranoside (IPTG) inducing expression,
And co-factor needed for Cytochrome P450 reacts is added in inducing expression.By n-hexane extraction bacterium solution, GC-MS analysis is produced
Object.
The present invention also provides a kind of coding albumen of above-mentioned CYP71Z18 gene to adjust and produce plant Diterpenes
Close the application in object.
Further, the application, comprising the following steps:
By tri- kinds of each 100- of recombinant plasmid of pGGsC/pGGeC, pDEST14-OsKSL and pCDF-AtCPR1-CYP71Z18
150ng is added in 40 μ L Escherichia coli C41 (DE3) competent cells simultaneously, ice bath 20min, 42 DEG C of heat shock 1min30s, on ice
200 μ L recovery 2h of LB liquid medium is added after cooling 2min, is coated that is mould in containing chloramphenicol 50mg/L, sulfuric acid card simultaneously
On the solid LB media plate of plain 50mg/L and spectinomycin hydrochloride 50mg/L；37 DEG C are incubated overnight, and select within second day average
Bacterium colony is placed in the 5mL liquid containing chloramphenicol 50mg/L, kanamycin sulfate 50mg/L and spectinomycin hydrochloride 50mg/L simultaneously
In LB culture medium, bacterium is shaken overnight and prepares strain by 37 DEG C；These strains are Escherichia coli C41 (DE3) background strain, and each bacterium
Kind contains three kinds of plasmids respectively:
1. pGGsC, pDEST14-OsKSL4, pCDF-AtCPR1-CYP71Z18；
2. pGGsC, pDEST14-OsKSL8, pCDF-AtCPR1-CYP71Z18；
3. pGGsC, pDEST14-OsKSL10, pCDF-AtCPR1-CYP71Z18；
4. pGGsC, pDEST14-OsKSL11, pCDF-AtCPR1-CYP71Z18；
5. pGGeC, pDEST14-OsKSL7, pCDF-AtCPR1-CYP71Z18；
6. pGGeC, pDEST14-OsKSL10, pCDF-AtCPR1-CYP71Z18；
Next day takes 1mL strain to be placed in 50mL TB fluid nutrient medium, is added corresponding antibiotic in culture medium, and 37 DEG C,
200rpm culture, bacterium solution are supported to A600Reach 0.8-1.0,1mM isopropyl-beta D-thio galactopyranoside is added thereto and lures
Expression is led, and co-factor 75mg/L δ-aminolevulinic acid needed for Cytochrome P450 reacts, 1mM sulphur are added in inducing expression
Amine element, 5mg/L riboflavin；Then 16 DEG C are gone to, 200rpm Fiber differentiation 72h；With isometric n-hexane extraction terpene after 72h
Product；All products detect carboxylic acids product for GC-MS all after triazonmethane methylates, and carboxylic acids production is prepared
Object.
Further, LB liquid medium specifically: yeast extract 5g, tryptone 10g, NaCl 10g, deionization
Water 1L, with the NaOH tune pH value of 1mol/L to 7.0；High pressure sterilization, 4 DEG C of preservations；Solid LB media adds 15g/L before sterilization
Agar.
Further, TB fluid nutrient medium specifically: NaCl 5g, MgSO4.7H2O 2g, yeast extract 24g hydrolyze junket
Protein 12 g, glycerol 20mL, deionized water 900mL；10 × TB buffer: KH2PO42.31g K2HPO412.54g deionization
Water 100mL；High pressure sterilization, 4 DEG C of preservations, 10 × TB buffer 100mL is added when use.
The invention also discloses a kind of application of the coding albumen of above-mentioned CYP71Z18 gene in rice breeding.
Compared with prior art, the present invention can be obtained including following technical effect:
1) GC-MS analysis the result shows that: CYP71Z18 albumen enzymatic syn-pimaradiene generate molecular weight be 288
(m/z) novel substance identifies that the product is the novel substance not being reported by nuclear magnetic resonance spectroscopy.CYP71Z18 albumen enzymatic
Molecular weight is the novel substance of 318 (m/z) after syn-stemarene generates methylation, and retention time is 19.778 minutes；
It is 316 (m/ that CYP71Z18 albumen enzymatic syn-labdatriene, which generates molecular weight after molecular weight is 304 (m/z) and methylation,
Z) novel substance, retention time are respectively 20.464 minutes and 19.527 minutes；CYP71Z18 albumen enzymatic syn-
Stemodene generates the novel substance that molecular weight is 318 (m/z) after molecular weight is 288 (m/z) and methylation, retention time point
It Wei not be 20.361 minutes and 21.350 minutes；It is 288 (m/ that CYP71Z18 albumen enzymatic ent-cassadiene, which generates molecular weight,
Z) novel substance, retention time are 21.935 minutes；CYP71Z18 albumen enzymatic ent-sandaracopimaradiene
The novel substance that molecular weight is 288 (m/z) is generated, retention time is 19.414 minutes.
2) result of study shows to be catalyzed the present invention relates to CYP71Z18 in corn sequiterpene protective plant protecting agent biosynthesis more
Kind rice diterpene forms new product, and catalysis substrate is very extensive.
3) present invention helps industrially to produce a variety of new diterpene-kind compounds using CYP71Z18 catalysis characteristics, with
And route of synthesis of transformation rice diterpene-kind compound etc. has most important theories and practice significance.
Certainly, it implements any of the products of the present invention it is not absolutely required to while reaching all the above technical effect.
Detailed description of the invention
The drawings described herein are used to provide a further understanding of the present invention, constitutes a part of the invention, this hair
Bright illustrative embodiments and their description are used to explain the present invention, and are not constituted improper limitations of the present invention.In the accompanying drawings:
Fig. 1 is the recombinant expression carrier pCDF-AtCPR1-CYP71Z18 of building；
Fig. 2 is the mass spectrogram of CYP71Z18 catalysis syn-pimaradiene reaction product GC-MS structure elucidation of the present invention,
The molecular weight of product is 288 (m/z)；
Fig. 3 is CYP71Z18 catalysis syn-pimaradiene reaction product NMR structure elucidation of the present invention；
Fig. 4 is the total ion chromatogram of CYP71Z18 catalysis syn-stemarene reaction product GC-MS analysis of the present invention；
Fig. 5 is the corresponding mass spectrogram in peak 1 in chromatogram in Fig. 4 of the present invention；
Fig. 6 is total ion chromatography of CYP71Z18 catalysis syn-labdatriene reaction product GC-MS analysis of the present invention
Figure；
Fig. 7 is the corresponding mass spectrogram in peak 2 in Fig. 6 chromatogram of the present invention；
Fig. 8 is the corresponding mass spectrogram in peak 3 in Fig. 6 chromatogram of the present invention；
Fig. 9 is the total ion chromatogram of CYP71Z18 catalysis syn-stemodene reaction product GC-MS analysis of the present invention；
Figure 10 is the corresponding mass spectrogram in peak 4 in Fig. 9 chromatogram of the present invention；
Figure 11 is the corresponding mass spectrogram in peak 5 in Fig. 9 chromatogram of the present invention；
Figure 12 is total ion chromatography of CYP71Z18 catalysis ent-cassadiene reaction product GC-MS analysis of the present invention
Figure；
Figure 13 is the corresponding mass spectrogram in peak 6 in Figure 12 chromatogram of the present invention；
Figure 14 CYP71Z18 of the present invention catalysis ent-sandaracopimaradiene reaction product GC-MS analysis always from
Sub- chromatogram；
Figure 15 is the corresponding mass spectrogram in peak 7 in Figure 14 chromatogram of the present invention.
Specific embodiment
The following all chemicals used, in addition to n-hexane and ethyl acetate are chromatographically pures, remaining is all that analysis is pure.
GC-MS analysis uses Agilent 6890-5973 model, HP-5GC column, four times of mass spectrometer detectors, using electron bombardment mould
Formula.1 μ L of sample feeding, with not shunt mode, 70 DEG C of initial temperature, furnace temperature keeps 70 DEG C of 2min, with the speed liter of 10 DEG C/min
To 300 DEG C, 300 DEG C of 2min are kept.MS data collection since retention time 10min up to EP (end of program), mass-to-charge ratio show from
50 to 600.
20% hypochlorite disinfectant 20min of the seed of corn B73 strain, is placed on water-agar medium and germinates.7
After it, aseptic seedlings are extracted for fungal infection and RNA.Fusarium graminearum grows on potato glucose agar medium, so
After be transferred to product spore culture medium (sodium carboxymethylcellulose 7.5g/L, potassium dihydrogen phosphate 0.5g/L, yeast extract 0.5g/L, nitre
Sour ammonium 0.5g/L, magnesium sulfate 0.25g/L), spore is collected after 5 days.By 10 after scuffing blade6mL-1Spore is dissolved in 0.1% tween
20, spore inoculating is carried out to blade.
Embodiment 1: the clone of CYP71Z18 gene and modification in corn
Number of the CYP71Z18 in NCBI gene pool is NM_001147894, encodes region nucleotide sequence according to it, if
Count primer Cloning of full length sequence from corn；Primer is as follows:
CYP71Z18F:5 '-ATGGAGGACAAGGTGCTCATCGC-3 '；Its nucleotide sequence such as SEQ ID NO:3 institute
Show；
CYP71Z18R:5 '-TTAGGCATTAACCGGAGCAATGTGG-3 '；Its nucleotide sequence such as SEQ ID NO:4 institute
Show.
Maize leaf extracts RNA by Fusarium graminearum spore inoculating afterwards for 24 hours, is inverted with reverse transcriptase M-MLV (Takara)
Record obtains cDNA.Using cDNA as template, CYP71Z18F and CYP71Z18R are primer, with high fidelity enzyme PrimeSTAR HS DNA
Polymerase (Takara) expands CYP71Z18 coding region sequence.PCR program: 95 DEG C of 5min initial denaturations, 35 circulations: 98 DEG C
10s, 55 DEG C of 5s, 72 DEG C of 1min30s, 72 DEG C of 5min, 12 DEG C of ∞.After the completion of amplification, the agarose that PCR product carries out 1% is coagulated
Gel electrophoresis detects and utilizes plastic recovery kit (OMEGA) gel extraction target fragment.The piece for the 1518bp that glue is recycled
Section is cloned into pGM-T (Tiangen, Beijing) carrier, through the code area CYP71Z18 for being confirmed as announcing in database is sequenced
Sequence.
In order to smoothly in expression in escherichia coli CYP71Z18 albumen, referring to forefathers' research method (Swaminathan S,
Morrone D,Wang Q,et al.CYP76M7 Is an ent-Cassadiene C11-Hydroxylase Defining
a Second Multifunctional Diterpenoid Biosynthetic Gene Cluster in Rice[J]
.Plant Cell, 2009,21 (10): 3315-25.), 32 amino acid substitutions before the N-terminal of CYP71Z18 are relied into ammonia at 10 richnesses
Acid sequence MAKKTSSKGK.Design N-terminal Mdification primer:
CYP71Z18-d32 ES-F1:CCTCCAGGGCCATGGACGCT；Its nucleotide sequence such as SEQ ID NO:5 institute
Show；
CYP71Z18-d32 ES-F2:AACATATGGCGAAAAAAACCAGCAGCAAAGGTAAACCTCCAGGGCCAT
GG；Its nucleotide sequence is as shown in SEQ ID NO:6；
CYP71Z18-ES-R:AAAGATCTTTAGGCATTAACCGGAGCAATGTGG；Its nucleotide sequence such as SEQ ID
Shown in NO:7；
Wherein, sequence shown in underscore is digestion recognition site.
By two-step pcr, first step PCR using pGM-T/CYP71Z18 as template, CYP71Z18-d32 ES-F1 and
CYP71Z18-ES-R is primer, expands to obtain segment with high fidelity enzyme PrimeSTAR HS DNA polymerase, is returned through glue
Receive the target fragment that kit recycles a length of 1422bp.The 1422bp target fragment that second step PCR or more step recycling obtains is mould
Plate, CYP71Z18-d32 ES-F2 and CYP71Z18-ES-R are primer, with high fidelity enzyme PrimeSTAR HS DNA
Polymerase expands a length of 1468bp of the segment after being modified, gel extraction segment.
Gene after modification is subcloned into second multiple cloning sites (MCS) limit of pCDF-Duet (Novagen) carrier
Between II site property restriction endonuclease Nde I and Bgl processed, the restriction enzyme Nco I of first multiple cloning sites of pCDF-Duet and
P450 reductase (AtCPR1) containing the dependence NADPH in arabidopsis between Sal I site.Upper step is recycled and is modified
Segment and pCDF-AtCPR1 afterwards uses II (Takara) double digestion of Nde I and Bgl and digested liquid recycling respectively, utilizes T4DNA
Ligase (Takara) connection, the recombinant expression carrier structure finally constructed are as shown in Figure 1.
The coding albumen of embodiment 2:CYP71Z18 gene and the pronuclear recombination of a variety of two diterpene synthases of rice are expressed
The coding albumen of CYP71Z18 gene is overexpressed in strain at Escherichia coli C41 (DE3) (Lucigen) and expresses, will
AgGGPS, OsCPS4/AtCPS, OsKSL, AtCPR1 and CYP71Z18 are transferred to Escherichia coli, AgGGPS, OsCPS4/ jointly
AtCPS is to provide precursor GGPP and CPP, reducing power needed for AtCPR1 provides CYP71Z18.OsKSL provides a variety of diterpene bottoms
Object, wherein OsKSL4 is catalyzed Ke Baji pyrophosphoric acid (syn-CPP) in the same direction and generates syn-pimaradiene；OsKSL8 is catalyzed syn-
CPP generates syn-stemarene；OsKSL10 is catalyzed syn-CPP and generates syn-labdatriene；OsKSL11 is catalyzed syn-CPP
Generate syn-stemodene.OsKSL7 is catalyzed internal Ke Baji pyrophosphoric acid (ent-CPP) and generates ent-cassadiene；
OsKSL10 is catalyzed ent-CPP and generates ent-sandaracopimaradiene.
Specific embodiment is as follows: by pGGsC/pGGeC, pDEST14-OsKSL and pCDF-AtCPR1-CYP71Z18 tri-
Kind of each 100-150ng of recombinant plasmid is added in 40 μ L Escherichia coli C41 (DE3) competent cells simultaneously, ice bath 20min, and 42 DEG C
After heat shock 1min30s, cooled on ice 2min be added LB liquid medium (yeast extract 5g, tryptone 10g, NaCl 10g,
Deionized water 1L, with the NaOH tune pH value of 1mol/L to 7.0.High pressure sterilization, 4 DEG C of preservations.Solid LB media adds before sterilization
The agar of upper 15g/L.) 200 μ L recovery 2h, be coated in simultaneously contain three kinds of plasmid resistances (chloramphenicol 50mg/L, sulfuric acid
Kanamycins 50mg/L, spectinomycin hydrochloride 50mg/L) solid LB media plate on.37 DEG C are incubated overnight, and choose within second day
Average colony is selected, is placed in the 5mL LB liquid medium simultaneously containing three kinds of plasmid resistances, 37 DEG C, is shaken bacterium overnight and be prepared 6
Middle strain.These strains are Escherichia coli C41 (DE3) background strain, and each strain contains three kinds of plasmids respectively:
1. pGGsC, pDEST14-OsKSL4, pCDF-AtCPR1-CYP71Z18；
2. pGGsC, pDEST14-OsKSL8, pCDF-AtCPR1-CYP71Z18；
3. pGGsC, pDEST14-OsKSL10, pCDF-AtCPR1-CYP71Z18；
4. pGGsC, pDEST14-OsKSL11, pCDF-AtCPR1-CYP71Z18；
5. pGGeC, pDEST14-OsKSL7, pCDF-AtCPR1-CYP71Z18；
6. pGGeC, pDEST14-OsKSL10, pCDF-AtCPR1-CYP71Z18.
Next day takes 1mL strain to be placed in 50mL TB fluid nutrient medium (NaCl 5g, MgSO4.7H2O 2g, yeast extract
24g, caseinhydrolysate 12g, glycerol 20mL, deionized water 900mL；10 × TB buffer: KH2PO42.31g
K2HPO412.54g deionized water 100mL；High pressure sterilization, 4 DEG C of preservations, 10 × TB buffer 100mL is added when use.), culture
Corresponding antibiotic is added in base, 37 DEG C, 200rpm culture, bacterium solution is supported to A600Reach 0.8-1.0,1mM isopropyl is added thereto
Base-β-D- Thiogalactopyranoside (IPTG) inducing expression, and be added needed for Cytochrome P450 reaction in inducing expression
Co-factor 75mg/L δ-aminolevulinic acid, 1mM thiamine, 5mg/L riboflavin.Then 16 DEG C are gone to, 200rpm Fiber differentiation
72h.With isometric n-hexane extraction terpene product after 72h.All products are used for GC- all after triazonmethane methylates
MS detects carboxylic acids product.Enough CYP71Z18 are catalyzed the product of syn-pimaradiene and carry out nuclear-magnetism and be total in order to obtain
It shakes (NMR) analysis, the volume of culture solution increases to 6L, and with n-hexane extraction product, is concentrated by Rotary Evaporators.Concentration is steamed
Product after dry is resuspended with 5mL n-hexane, is separated by silica gel column chromatography.Use n-hexane, methylene chloride mixed solvent (body
Product ratio is 10:1) it is eluent.Finally obtain the primary product about 5mg of CYP71Z18 catalysis syn-pimaradiene, purity
It is 95%, and is used for nuclear magnetic resonance spectroscopy.This method is applied to industrial fermentation, that is, expands the volume of zymocyte liquid, then can produce
A large amount of a variety of new diterpene products as described above, realize the vision of a large amount of synthesis Diterpenes novel substances of industry.
As a result such as Fig. 2~Figure 15, in Metabolism of E. coli Engineering System, CYP71Z18 is catalyzed syn-pimaradiene
The novel substance for generating that molecular weight is 288 (m/z) is formed, identifies that the product is syn-pimaradiene by nuclear magnetic resonance spectroscopy
C15 and the product that is at least partially epoxidized of C16 carbon atoms, be a kind of novel substance not being reported.CYP71Z18 albumen enzymatic
Molecular weight is the novel substance of 318 (m/z) after syn-stemarene generates methylation, and retention time is 19.778 minutes；
It is 316 (m/ that CYP71Z18 albumen enzymatic syn-labdatriene, which generates molecular weight after molecular weight is 304 (m/z) and methylation,
Z) novel substance, retention time are respectively 20.464 minutes and 19.527 minutes；CYP71Z18 albumen enzymatic syn-
Stemodene generates the novel substance that molecular weight is 318 (m/z) after molecular weight is 288 (m/z) and methylation, retention time point
It Wei not be 20.361 minutes and 21.350 minutes.It is 288 (m/ that CYP71Z18 albumen enzymatic ent-cassadiene, which generates molecular weight,
Z) novel substance, retention time are 21.935 minutes；CYP71Z18 albumen enzymatic ent-sandaracopimaradiene
The novel substance that molecular weight is 288 (m/z) is generated, retention time is 19.414 minutes.Result of study shows that the present invention relates to jade
CYP71Z18 can be catalyzed a variety of rice diterpene and form new product, catalysis substrate ten in rice sequiterpene protective plant protecting agent biosynthesis
Divide extensive.
In consideration of it, the CYP71Z18 in corn is overexpressed by the present invention in rice by transgenic technology, then
CYP71Z18 can synthesize relevant two terpenes to participation rice Diterpenes protective plant protecting agents a variety of in rice body and aoxidize, to produce
Raw new diterpene product, this may change the biosynthesis pathway of diterpene protective plant protecting agent in rice body, or generate new diterpene
Protective plant protecting agent changes the resistance of rice.
Above description has shown and described several preferred embodiments of invention, but as previously described, it should be understood that invention is not
It is confined to form disclosed herein, should not be regarded as an exclusion of other examples, and can be used for various other combinations, modification
And environment, and can be carried out within that scope of the inventive concept describe herein by the above teachings or related fields of technology or knowledge
Change.And changes and modifications made by those skilled in the art do not depart from the spirit and scope of invention, then it all should be in the appended power of invention
In the protection scope that benefit requires.
Claims (1)
1. a kind of coding albumen of CYP71Z18 gene is adjusting and producing the application in plant diterpene-kind compound, feature exists
In, comprising the following steps:
By tri- kinds of each 100-150ng of recombinant plasmid of pGGsC/pGGeC, pDEST14-OsKSL and pCDF-AtCPR1-CYP71Z18
It is added in 40 μ L Escherichia coli C41 (DE3) competent cells simultaneously, ice bath 20min, 42 DEG C of heat shock 1min30s, cooled on ice
After 2min be added 200 μ L recovery 2h of LB liquid medium, be coated in simultaneously contain chloramphenicol 50mg/L, kanamycin sulfate
On the solid LB media plate of 50mg/L and spectinomycin hydrochloride 50mg/L；37 DEG C are incubated overnight, and select average bacterium within second day
It falls, is placed in the 5mL liquid LB containing chloramphenicol 50mg/L, kanamycin sulfate 50mg/L and spectinomycin hydrochloride 50mg/L simultaneously
In culture medium, bacterium is shaken overnight, 6 kinds of strains are prepared by 37 DEG C；These strains are Escherichia coli C41 (DE3) background strain, and every
A strain contains three kinds of plasmids respectively:
1. pGGsC, pDEST14-OsKSL4, pCDF-AtCPR1-CYP71Z18；
2. pGGsC, pDEST14-OsKSL8, pCDF-AtCPR1-CYP71Z18；
3. pGGsC, pDEST14-OsKSL10, pCDF-AtCPR1-CYP71Z18；
4. pGGsC, pDEST14-OsKSL11, pCDF-AtCPR1-CYP71Z18；
5. pGGeC, pDEST14-OsKSL7, pCDF-AtCPR1-CYP71Z18；
6. pGGeC, pDEST14-OsKSL10, pCDF-AtCPR1-CYP71Z18；
Next day takes 1mL strain to be placed in 50mL TB fluid nutrient medium, corresponding antibiotic is added in culture medium, 37 DEG C, 200rpm is trained
It supports, bacterium solution is supported to A600Reach 0.8-1.0,1mM isopropyl-beta D-thio galactopyranoside inducing expression is added thereto, and
Co-factor 75mg/L δ-aminolevulinic acid needed for Cytochrome P450 reacts, 1mM thiamine, 5mg/ are added in inducing expression
L riboflavin；Then 16 DEG C are gone to, 200rpm Fiber differentiation 72h；With isometric n-hexane extraction terpene product after 72h；It is all
Product all after triazonmethane methylates for GC-MS detect carboxylic acids product, carboxylic acids product is prepared；
The LB liquid medium specifically: yeast extract 5g, tryptone 10g, NaCl 10g, deionized water 1L are used
The NaOH tune pH value of 1mol/L is to 7.0；High pressure sterilization, 4 DEG C of preservations；Solid LB media adds the agar of 15g/L before sterilization；
The TB fluid nutrient medium specifically: NaCl 5g, MgSO4.7H2O 2g, yeast extract 24g, caseinhydrolysate 12g,
Glycerol 20mL, deionized water 900mL；10 × TB buffer: KH2PO42.31g K2HPO412.54g deionized water 100mL；It is high
Pressure sterilizing, 4 DEG C of preservations, 10 × TB buffer 100mL is added when use.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610819977.5A CN106244605B (en) | 2016-09-13 | 2016-09-13 | CYP71Z18 gene and its coding albumen and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610819977.5A CN106244605B (en) | 2016-09-13 | 2016-09-13 | CYP71Z18 gene and its coding albumen and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106244605A CN106244605A (en) | 2016-12-21 |
| CN106244605B true CN106244605B (en) | 2019-11-08 |
Family
ID=57599717
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610819977.5A Expired - Fee Related CN106244605B (en) | 2016-09-13 | 2016-09-13 | CYP71Z18 gene and its coding albumen and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106244605B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109517830A (en) * | 2018-12-06 | 2019-03-26 | 江苏师范大学 | Euphorbia diterpenoids class compound synthesis gene C YP71D452, the protein of its coding and application |
-
2016
- 2016-09-13 CN CN201610819977.5A patent/CN106244605B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| BT041181;Genbank;《Genbank》;20120614;全文 * |
| Characterization of CYP71Z18 indicates a role in maize zealexin Biosynthesis;Hongjie Mao.et al;《Phytochemistr》;20160131;第121卷;参见摘要，第5页右栏，第7页2.6部分，第9页左栏 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106244605A (en) | 2016-12-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Frébort et al. | Evolution of cytokinin biosynthesis and degradation | |
| US10253335B2 (en) | Method for producing beta-santalene | |
| AU763068B2 (en) | Nucleic acids encoding (taxus) geranylgeranyl diphosphate synthase, and methods of use | |
| Kumar et al. | Molecular basis of the evolution of methylthioalkylmalate synthase and the diversity of methionine-derived glucosinolates | |
| Bömke et al. | Isolation and characterization of the gibberellin biosynthetic gene cluster in Sphaceloma manihoticola | |
| Fujisawa et al. | Cloning and characterization of a novel gene that encodes (S)-β-bisabolene synthase from ginger, Zingiber officinale | |
| Chai et al. | Sesterterpene ophiobolin biosynthesis involving multiple gene clusters in Aspergillus ustus | |
| Frébortová et al. | Light influences cytokinin biosynthesis and sensing in Nostoc (cyanobacteria) | |
| Wang et al. | Specific downregulation of the bacterial-type PEPC gene by artificial microRNA improves salt tolerance in Arabidopsis | |
| Peters | Gibberellin phytohormone metabolism | |
| CN106244605B (en) | CYP71Z18 gene and its coding albumen and application | |
| US7807867B2 (en) | Gene encoding protein involved in cytokinin synthesis | |
| Mao et al. | CYP701A26 is characterized as an ent-kaurene oxidase with putative involvement in maize gibberellin biosynthesis | |
| Lin et al. | Molecular cloning and functional analysis of the gene encoding geranylgeranyl diphosphate synthase from Jatropha curcas | |
| Chu et al. | Cloning, expression, and purification of His-tagged rat mevalonate kinase | |
| Gorina et al. | Detection of unprecedented allene oxide synthase member of CYP74B subfamily: CYP74B33 of carrot (Daucus carota) | |
| JP4668176B2 (en) | Triterpene hydroxylase | |
| Malonek et al. | Restoration of gibberellin production in Fusarium proliferatum by functional complementation of enzymatic blocks | |
| KR20010084864A (en) | Amorpha-4,11-diene synthase derived from artemisia annua, gene encoding same, expression vector containing said gene and, e. coli and plant transformed with said vector | |
| US20200308612A1 (en) | Vetiver | |
| Liao et al. | A new Farnesyl diphosphate synthase gene from Taxus media Rehder: cloning, characterization and functional complementation | |
| Cao et al. | Cloning, characterization and expression analysis of HSP70 gene from sweet potato | |
| Safari et al. | Engineering 4-hydroxyisoleucine biosynthesis by ectopic expression of bacterial IDO gene in fenugreek and tobacco | |
| Johnson | Exploring Flavin Biosynthesis in Plants and Bacteria | |
| WO2023021392A1 (en) | Heterologous production of cytokinins in yeasts |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20191108 Termination date: 20200913 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |