CN106244566A - A kind of chondroitin synthase mutant and application thereof - Google Patents

A kind of chondroitin synthase mutant and application thereof Download PDF

Info

Publication number
CN106244566A
CN106244566A CN201610652888.6A CN201610652888A CN106244566A CN 106244566 A CN106244566 A CN 106244566A CN 201610652888 A CN201610652888 A CN 201610652888A CN 106244566 A CN106244566 A CN 106244566A
Authority
CN
China
Prior art keywords
mutant
chrondroitin
chondroitin synthase
chondroitin
bacillus subtilis
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201610652888.6A
Other languages
Chinese (zh)
Other versions
CN106244566B (en
Inventor
康振
陈坚
堵国成
张琳培
周正雄
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangnan University
Original Assignee
Jiangnan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangnan University filed Critical Jiangnan University
Priority to CN201610652888.6A priority Critical patent/CN106244566B/en
Publication of CN106244566A publication Critical patent/CN106244566A/en
Application granted granted Critical
Publication of CN106244566B publication Critical patent/CN106244566B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/01—Hexosyltransferases (2.4.1)
    • C12Y204/01175—Glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase II (2.4.1.175)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y501/00—Racemaces and epimerases (5.1)
    • C12Y501/03—Racemaces and epimerases (5.1) acting on carbohydrates and derivatives (5.1.3)
    • C12Y501/03002—UDP-glucose 4-epimerase (5.1.3.2), i.e. UDP-galactose 4-epimerase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/101—Plasmid DNA for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/60—Vectors containing traps for, e.g. exons, promoters

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a kind of chondroitin synthase mutant and application thereof, belong to technical field of bioengineering.The chondroitin synthase that escherichia coli K4 is originated by the present invention carries out the combinatorial mutagenesis of nonconserved amino acid in conservative region in bacillus subtilis, it is thus achieved that the mutant that chrondroitin output increased, molecular weight reduce.Meanwhile, fermentation is amplified by 3L fermentation tank, it is achieved that the chrondroitin of bacillus subtilis high yield low-molecular-weight, on 3L tank, Product yields is 7.25g/L, and product mean molecule quantity is 41.62kDa.The present invention is that food-grade microorganisms efficiently production is prepared chrondroitin and established certain basis, is suitable for industrialized production application.

Description

A kind of chondroitin synthase mutant and application thereof
Technical field
The present invention relates to a kind of chondroitin synthase mutant and application thereof, belong to technical field of bioengineering.
Background technology
Chrondroitin (chondroitin) is the polysaccharide family of glycosaminoglycans (GAG).Glycosaminoglycans is that a class is by two repeated Unbranched, the electronegative polysaccharide chain of sugar unit composition, due to the character of inflexibility and the high negative charge of its uniqueness, GAG shows the conformation of high extensibility, takies big quantity space, absorbs cation and water and forms porous in extracellular matrix Gel, the GAG being found in most animals helps hydration and extension tissue, and enables substrate to bear pressure (compressive force).Therefore, glycosaminoglycans constitutes a class and has the compound of huge treatment use potentiality.Cartilage A kind of structure of element is 4-GlcA-β-1,3-GalNAc-β-1 (GlcUA: glucuronic acid, GalNAc: acetylgalactosamine) two sugar monomers The poly-polysaccharide being alternately formed by connecting with β-1,3 key.Chondroitin sulfate (chondroitin sulfate, CS), is chrondroitin sugar chain Sulphation is carried out by sulfotransferase at 4, carbon or 6, the carbon of GalNAc after generation.Can according to its chemical composition and structure difference Being divided into A, B, C, D, E, F, H etc. multiple, generally extracting the chondroitin sulfate obtained from mammalian tissues with CS-A, CS-C is Main.General chondroitin sulfate about contains 50-70 dissacharide units, and molecular weight is between 10000-50000 dalton.
Chondroitin sulfate is the biopolymer that a class is important, has biological activity widely, has multiple pharmacological effect With physiological function.Research finds that chondroitin sulfate has study of anti-atherogenic effect, analgesic and anti-inflammatory effects, promotes osteoblast Hypertrophy, induces new bone formation；Antitumor action, immunoregulation effect, the slow old and feeble effect in antioxidation, removing free radical and the court of a feudal ruler, Also there is the effect of antiinflammatory, antiviral, antiallergic and accelerating wound healing, such as HIV (human immunodeficiency virus)-resistant activity.Along with to chondroitin sulfate physiology Function and the further investigation of biochemical property, in Europe, the United States, Deng developed country, chondroitin sulfate is long-term as popular health product Should, it is used for preventing and treating the diseases such as coronary heart diseases and angina pectoris, myocardial infarction, coronary insufficiency, myocardial ischemia, without significantly poison Side effect, can significantly reduce the M & M of patients with coronary heart disease, also as meal supplement for Saving cortilage.Although CS Existing a lot of drug effect, but the CS drug effect of little molecule is the most notable.The CS of little molecule, the egg constituted for main body with chondroitin sulfate White polysaccharide plays a part one " molecule spring " in cartilage matrix, has pain relieving, effect of promotion regenerating bone or cartilage, can be from root This improves joint prob.And the CS of low-molecular-weight, the most oral or injection, assimilation effect is superior to high molecular CS.
Chondroitin sulfate is primarily present in the cartilaginous tissue of animal, and the industrialized production of chondroitin sulfate mainly uses Traditional extraction processes such as enzyme process combines with alkaline process, from the animal soft tissue such as trachea, nasal septum, chicken Os Draconis and shark cartilage Extract chondroitin sulfate.Traditional extracting method causes the yield of chrondroitin low, relatively costly, and a large amount of industry that alkaline hydrolysis produces Waste water easily produces considerable influence to environment.Meanwhile, the complexity of raw-material shortage and downstream purification technique limits this work The global availability of property composition, therefore market is limited to meet increasing need.And, in the long run, due to Constantly promulgating the management rules to animal origin Drug safety increasingly stringent, animal tissue extracts the chondroitin sulfate obtained May will be limited in outside crude drug market.Become needed head to this end, use safely and effectively method to prepare chondroitin sulfate Problem to be solved.This is sought for new alternative route with regard to urgent needs people.
Many microorganisms such as fungus and antibacterial chondroitin sulfate that all energy synthesis of oligonucleotides is right or its analog in nature, It has now been found that the microorganism that can produce chrondroitin is concentrated mainly on p pestic Pasteurellamultocida, large intestine bar Bacterium Escherichia coli K4.But need to possess as industrial producing strain: person poultry safety；Rapidly, fermentation period is short in growth； Genetic background understands；The condition such as chondroitin sulfate or its analog can be synthesized in a large number.Certain cause is all there is due to above-mentioned bacterial strains Characteristic of disease and escherichia coli produce endotoxin and heat source substance etc., it is impossible to meet present food medical safety requirement.Therefore the present invention Select this food stage genetic engineering bacterium of bacillus subtilis, possess above-mentioned condition.
Summary of the invention
First purpose of the present invention is to provide a kind of chondroitin synthase mutant, and described mutant is: (a) or (b) or (c):
(a) in sequence basis shown in SEQ ID NO.2, A236-P246The Amino acid sequence mutants in region is DILDCDMAPYA, D461-D473The Amino acid sequence mutants in region is DLEVCTSEDGSPD, I600-Y609The aminoacid sequence in region Row are by sporting MTNAVDYDVG；
B () is passed through replacement in the aminoacid sequence that (a) limits, is lacked or add one or several aminoacid and have The protein derivative by (a) of chondroitin synthase activity；
C aminoacid sequence that () and (a) limit has 85% and above homology and have the egg of chondroitin synthase activity White matter.
Second object of the present invention is to provide the gene encoding described chondroitin synthase mutant.
Third object of the present invention is to provide the carrier containing described gene or cell.
Fourth object of the present invention is to provide the method obtaining described chondroitin synthase mutant, and described method is to large intestine The chondroitin synthase A in bacillus K4 source236-P246, D461-D473, G516-E530And I600-Y609Region is combined sudden change.
In one embodiment of the invention, described method is by the institute to the chondroitin synthase that escherichia coli K4 originates State nonconserved amino acid in region and be combined sudden change, and heterogenous expression in bacillus subtilis.
In one embodiment of the invention, described method also includes that, to chrondroitin output increased, molecular weight reduces The high flux screening of mutant.
5th purpose of the present invention is to provide the genetic engineering bacterium of a kind of recombinant expressed described chondroitin synthase mutant.
In one embodiment of the invention, described genetic engineering bacterium is with bacillus subtilis Bacillus Subtilis 168 is host, with inducible promoter PxylAStart the expression of the gene of encoding cartilage element synthase mutant.
In one embodiment of the invention, described genetic engineering bacterium is to utilize to have to be integrated in Bacillus On subtilis 168, the upstream and downstream homology arm in lacA site and the pAX01 of erythromycin resistance marker are expression vector.
Present invention also offers a kind of method applying described recombinant bacterium fermenting and producing chrondroitin, be that recombinant bacterium is seeded to In fermentation medium, at 37 DEG C, cultivate 54-80h.
In one embodiment of the invention, described fermentation medium is using sucrose as carbon source.
In one embodiment of the invention, the constituent of described fermentation medium is: 20g/L yeast powder, 50g/L Sucrose, potassium sulfate 3.9g/L, magnesium sulfate 1.5g/L, 50mM phosphate buffer, pH 7.0.
Present invention also offers described mutant and the application in producing chrondroitin of the cell strain system containing this mutant.
In one embodiment of the invention, described recombined bacillus subtilis only integrant expression SEQ on genome Synthase gene kfoC shown in ID NO.1, and galactosamine isomerase gene kfoA shown in coexpression SEQ ID NO.3.
In one embodiment of the invention, described recombined bacillus subtilis integrant expression chrondroitin on genome Synthase gene mutant library VkfoC, and coexpression galactosamine isomerase gene kfoA, screening obtains 1 strain chrondroitin yield and carries Height, the mutant that molecular weight reduces, after its sudden change, synthase gene is VkfoC1.
Beneficial effect: the present invention utilizes tachytelic evolution chondroitin synthase to produce chrondroitin in bacillus subtilis, has relatively Big application advantage.First, the host used in process of the present invention be food stage, and can meet health care and food safety will Ask, without endotoxin and the risk of pathogen infection；Secondly, the chondroitin synthase after molecular modification, the yield of synthesis chrondroitin has Raising by a relatively large margin, and obtain the product that molecular weight reduces, amplify fermentation by 3L tank, it is possible to obtain improve further Chrondroitin yield, on 3L tank, Product yields is 7.25g/L, and product mean molecule quantity is 41.62kDa.Based on applied analysis, this Bright method is industrially used for preparing high yield, low molecular chrondroitin has potential and is worth widely.
Accompanying drawing explanation
Fig. 1 show in high flux screening the chrondroitin output trend of the yield forward mutant obtained；
Fig. 2 show during shaking flask is sieved again 1 strain output increased, the mutant B.subtilis VCH of molecular weight reduction obtained And the chrondroitin production curve of wild strain B.subtilis ECH；
Fig. 3 show the cell growth of mutant B.subtilis VCH and wild strain B.subtilis ECH on 3L tank Curve and chrondroitin production curve.
Detailed description of the invention
Chrondroitin tunning molecular weight detection analyzes method: use Efficient numerical method-multiple angle laser light scattering It is analyzed, selects differential refraction detector RI, use gel chromatographic columns Ultrahydrogel Linear to be analyzed.Flowing Selecting 0.1M sodium nitrate to carry out eluting mutually, flow velocity is 0.5mL/min, and column temperature is set as 50 degrees Celsius, and sample size is 20 μ L, Each sample elution time is 20min, utilizes software to be averaged the calculating of molecular mass.
The nucleotide sequence information that embodiment relates to:
(1) SEQ ID NO.1 sequence information is for deriving from escherichia coli K4 (E.coli O5:K4 (L): H4, E.coli K4) chondroitin synthase encoding gene kfoC coded sequence；
(2) SEQ ID NO.2 sequence information is for deriving from escherichia coli K4 (E.coli O5:K4 (L): H4, E.coli The aminoacid sequence of chondroitin synthase KfoC K4)；
(3) SEQ ID NO.3 sequence information is for deriving from escherichia coli K4 (E.coli O5:K4 (L): H4, E.coli K4) galactosamine isomerase encoding gene kfoA coded sequence；
(4) SEQ ID NO.4 sequence information is bacillus subtilis inducible promoter PxylAGene order；
The mutational site of embodiment 1 escherichia coli K4 chondroitin synthase selects and mutant library builds
The chondroitin synthase amino originated with other by the chondroitin synthase aminoacid sequence that escherichia coli K4 is originated Acid sequence carries out BLAST comparison, finds out following 6 relatively conservative motifs, respectively L238DCDMAP244, D461LEVC465, D231GS-D235, G516QLDSDD522, P526DAVE530, N602AVDYD607.Design is by the nonconserved amino acid near these 6 motifs Suddenly change simultaneously, and conserved positions is constant, i.e. selectes 4 sections of region A236-P246, D461-D473, G516-E530And I600-Y609Carry out Combinatorial mutagenesis.Use " RECODE " mutation strategy, design 4 degenerate primers, wherein should keep away when codeword triplet simultaneous mutation Exempt from termination codon, such as use " VNN；V=A, C, G；N=A, T, C, G ", with the pAX01-kfoC-kfoA plasmid built (Efficient biosynthesis of polysaccharides chondroitin and heparosanby Metabolically engineered Bacillus subtilis, Carbohydrate Polymers, 2016, Jinpeng) be template, respectively amplification mutant gene storehouse VkfoC and carrier pXYKA, pXYKA include pAX01 expression vector and KfoA gene.
Primer sequence information: 5 '-3 ' direction
KfoC-F0:GGATCCGAGCTCCCGCGGGCATGTCTATCTTAAATCAAGC
MC-F1:
GCTAAATACAATTACGTCGCNATNCTTGATTGTGATATGGCACCTANCNCACTGTGGGTACAGTCCTAC
MC-F2:
TACAGACTTGGAAGTGTGCANCNGTGANGATGGTTCTNCTGACGACACTTTGCGGATA
MC-F3:
CTATATNGGGCAACTGGACTCTGATGACTTNNTGGNACCTGATGCAGTCGAACTTT
MC-F4:
GAAGGATTTAATGAGTCCATNNCAAACGCCGTGGATTACGATANGNACTTAAAGCT GTCCGAGGTGKfoC-R0: ATGTAAATGCCTCCTTTTTATTACAAATCGTTTTCGATTTTCTC
PXYKA-F:TAAAAAGGAGGCATTTACAT
PXYKA-R:GCCCGCGGGAGCTCGGATCC
During RECODE sudden change, first by degenerate primer phosphorylation, system 50 μ L:300pmol each degenerate primer mixture, 1 × T4 connects liquid buffer, 8U polynueleotide kinase.37 DEG C of incubation 30min, 75 DEG C make enzyme inactivate 10min.RECODE reactant It is 50 μ L:0.1 μM each phosphorylation degenerate primer and upstream anchor primer KfoC-F0,0.2 μM of reverse primer KfoC-R0, 0.01pmol DNA profiling, 1U Phusion archaeal dna polymerase, 5UAmpligase heat stability DNA ligase, 1 × optimize RECODE buffer (20mM Tris-HCl, 25mM KCl, 0.5mM NAD, 2mM dNTPs, 5mM Mg2+, 0.1%Triton X-100, pH 8.3), One_step PCR response procedures is: 94 DEG C, 2min；94 DEG C, 30s；50 DEG C, 30s；72 DEG C, 2min；25 are followed Ring；66 DEG C, 3min；4 DEG C, keep.VkfoC gene mutation body storehouse and carrier pXYKA that PCR amplification obtains carry out Gibson mono-step Assemble, system 10 μ L:(0.01 × bp/DNA concentration) μ L carrier, (0.02 × bp/DNA concentration) μ L fragment, 1 μ L Exnase II, 2 μ L 5 × CE buffer.37 DEG C connect 30min, place 5min, Transformed E .coli JM109 competent cell on ice, receive Collect all recombiant plasmid mutation libraries, convert to B.subtilis 168 cell, carry out screening with the erythromycin flat board of 1 μ g/mL whole Close sudden change recon, it is thus achieved that recombined bacillus subtilis mutation library.
The high flux screening of embodiment 2 recombined bacillus subtilis mutation library sieves again with shaking flask
1000 bacillus subtilis mutant strains of the above-mentioned acquisition of picking, single colony inoculation is cultivated in the LB of 96 shallow bore hole plates Base, is placed in 37 DEG C of incubated overnight of 200rpm.Transfer in the fermentation medium of 96 deep-well plates by the inoculum concentration of 10%, and in sending out Ferment 2h adds final concentration 2% xylose and induces, and fermentation medium is: 20g/L yeast powder, 50g/L sucrose, potassium sulfate 3.9g/L, magnesium sulfate 1.5g/L, 50mM phosphate buffer, pH 7.0.Each hole liquid amount is less than the 1/3 of pore volume, and Use the plate lid of good air permeability, be placed in 200rpm 37 DEG C and cultivate 48h.
The forward mutant obtained for high flux screening, carries out shaking flask and sieves again, simultaneously with prime strain B.subtilis ECH is as comparison, and monoclonal is inoculated in 5mL LB culture medium, and adds 2% glucose and 2% xylose, is placed in 200rpm 37 DEG C Incubated overnight.Transferring in 250ml triangular flask by the inoculum concentration of 10% after 16h, fermentation medium liquid amount is 50mL, and in fermentation 2h adds final concentration 2% xylose and induces, and fermented incubation time is 48h, and is spaced sampling, and sample time is 12h, 24h, 36h, 48h, 54h.
In high flux screening and shake-flask culture, the collection of chrondroitin and purification process are by fermentation liquid in 96 orifice plates or shaking flask 10000 × g is centrifuged 5min, and supernatant shifts.The dehydrated alcohol adding 2 times of volumes in supernatant fully mixes, precipitation fermentation Chrondroitin in liquid.Stand room temperature under 1h, then 10000 × g at 4 DEG C and be centrifuged 10min, outwell supernatant, add in precipitation and send out The isopyknic ultra-pure water of ferment liquid fully dissolves.
During shake flask fermentation, the chondroitin content of the sample of each sampling time point uses Bitter-Muir sulfuric acid carbazole method Measuring, in 96 orifice plates, the chondroitin content in 48h fermentation liquid carries out batch also by Bitter-Muir sulfuric acid carbazole method simultaneously Measuring, but system is reduced at double by the mensuration system of shake flask fermentation sample, reaction condition is constant.Shake flask fermentation sample determination method For, color comparison tube adds 1ml Borax sulphate reagent and the 200 μ l chrondroitin sample after certain multiple dilutes, after mixing After boiling water boils 15min, it is cooled to room temperature, adds 50 μ l carbazole reagent, in boiling water, boil 15min after mixing again, be cooled to Room temperature, and at 530nm, measure light absorption value.Utilize mark product chondroitin sulfate A to draw standard curve, calculate soft according to standard curve Ossein yield.In 1000 bacillus subtilis mutants of 96 deep-well plates screenings, compared to wild type chondroitin synthase The yield about 0.97g/L of the produced chrondroitin of KfoC, the yield having the mutant of 6% to produce chrondroitin significantly improves (accompanying drawing 1).
Select the mutant that wherein 8 strain yield significantly improve and carry out after shaking flask sieves again, eliminate wherein yield and have no and substantially carry High and molecular weight has no the mutant of reduction, it is thus achieved that only one plant mutant strain B.subtilis VCH produced chrondroitin yield substantially carries Height, and molecular weight reduction.This mutant is detected with to compare strain B.subtilis ECH each by Bitter-Muir sulfuric acid carbazole method The content of sampling time point chrondroitin, and draw yield with fermentation time change curve.Use HPSEC-MALLS to measure the simultaneously Weight-average molecular weight (the M of 48h chrondroitinw), number average molecular weight (Mn) and coefficient of dispersion Ip.Accompanying drawing 2 shows original bacteria In B.subtilis ECH shaking flask, maximum output is 1.83g/L, the M of produced chrondroitinwFor 83.51kDa.And mutant In B.subtilis VCH shaking flask, maximum output reaches 2.41g/L, for the 131.7% of original bacteria, and the M of produced chrondroitinwFor 50.33kDa, reduces by 39.7% than the molecular weight of product of original bacteria.
Chondroitin synthase in mutant B.subtilis VCH is checked order, knows in 4 sections of regions of design sudden change have 3 Section there occurs sudden change, by original A236ILDCDMAPNP246Become D236ILDCDMAPYA246；D461LEVCICDDGSTD473Become D461LEVCTSEDGSPD473, I600SNAVDYDMY609Become M600TNAVDYDVG609.There is no relevant at present due to chondroitin synthase Structural analysis, such as enzyme crystal structure and Analysis of Topological Structure, therefore the discussion for conservative region the most only rests on irrational layer Face, thus it is speculated that in said mutation region, amino acid whose change has been likely to result in synthase for the reinforcement of substrate binding ability or catalysis energy Power improves.
Embodiment 3 produces the 3L tank fermentation of chrondroitin bacillus subtilis mutant strain
Picking recombined bacillus subtilis bacterial strain B.subtilis VCH, monoclonal is inoculated in 15mL LB culture medium, and adds Enter 2% glucose and 2% xylose, be placed in 37 DEG C of incubated overnight of 200rpm.Transfer in 500ml tri-by the inoculum concentration of 10% after 16h Angle bottle, LB culture medium liquid amount is 150mL, is simultaneously introduced 2% glucose and 2% xylose, continues to be placed in 200rpm 37 DEG C overnight Cultivate as seed liquor.Transferring in 3L fermentation tank by the inoculum concentration of 10% after 16h, liquid amount is 1.5L, 37 DEG C of constant temperature culture, logical Tolerance is 2vvm, maintains 7.0 by 5M NaOH solution regulation pH.Front 4h speed of agitator is 400rpm, becomes afterwards 600rpm.7h treats that just sugar exhausts beginning feed supplement, and 7-9h feed supplement is 10g/L/h, and 10-12h feed supplement is 15g/L/h, 13- 24h feed supplement is that 8g/L/h, 25h are 5g/L/h to fermentation ends feed supplement later, and fermentation time is 80h.Sample time is 2h, 4h, 6h, 8h, 12h, 18h, 24h, 30h, 36h, 42h, 48h, 54h, 60h, 70h, 78h, 80h.Measure each time point respectively The cell density OD of sampling sample600With chrondroitin yield, measure the molecular weight of product (M of fermentation termination simultaneouslyw).Measure cell During density, taking 1ml fermentation liquid, 8000 × g is centrifuged 10min, removes supernatant, thalline is used 1ml ddH2O is resuspended, with ddH2O adjusts Zero, at 600nm, measure cell density OD600.Chrondroitin yield is implemented according to described in embodiment 2.Find out from accompanying drawing 3, bacterium Body extends in time and increases, and reaches maximum to biomass during 24h, OD600It is about 45.Chrondroitin yield in continuing to increase state, But with thalli growth non-coupled, when biomass is constant, yield continues to rise, and reaches maximum when 78h, for 7.25g/L, For the 139% of prime strain B.subtilis ECH yield, hereafter yield keeps stable, can stop fermentation.To fermentation ends period The molecular weight M of 80h purified productwBeing measured, result is 41.62kDa, low compared with molecular weight in shaking flask, probably due to 3L tank The effect stirring shearing force during fermentation makes polysaccharide molecule chain reduce.
Although the present invention is open the most as above with preferred embodiment, but it is not limited to the present invention, any is familiar with this skill The people of art, without departing from the spirit and scope of the present invention, can do various changes and modification, therefore the protection model of the present invention Enclosing should be with being as the criterion that claims are defined.

Claims (10)

1. a chondroitin synthase mutant, it is characterised in that be (a) or (b) or (c):
(a) in sequence basis shown in SEQ ID NO.2, A236-P246The Amino acid sequence mutants in region is DILDCDMAPYA, D461-D473The Amino acid sequence mutants in region is DLEVCTSEDGSPD, I600-Y609The Amino acid sequence mutants in region is MTNAVDYDVG；
B () is passed through replacement in the aminoacid sequence that (a) limits, is lacked or add one or several aminoacid and have cartilage The protein derivative by (a) of element synthase activity；
C aminoacid sequence that () and (a) limit has 85% and above homology and have the protein of chondroitin synthase activity.
2. the gene of chondroitin synthase mutant described in coding claim 1.
3. contain carrier or the cell of gene described in claim 2.
4. one kind obtains the method for chondroitin synthase mutant described in claim 1, it is characterised in that originate escherichia coli K4 Chondroitin synthase A236-P246, D461-D473, G516-E530And I600-Y609Region is combined sudden change.
Method the most according to claim 4, it is characterised in that by the institute to the chondroitin synthase that escherichia coli K4 originates State nonconserved amino acid in region and be combined sudden change, and heterogenous expression in bacillus subtilis.
6. the recombinant bacterium producing chrondroitin, it is characterised in that chondroitin synthase mutant described in recombinant expressed claim 1, And galactosamine isomerase gene kfoA shown in coexpression SEQ ID NO.3.
Recombinant bacterium the most according to claim 6, it is characterised in that with Bacillus subtilis 168 For host, with inducible promoter PxylAStart the expression of the gene of encoding cartilage element synthase mutant.
Recombinant bacterium the most according to claim 6, it is characterised in that be integrated on Bacillus subtilis to have The upstream and downstream homology arm in lacA site and the pAX01 of erythromycin resistance marker are expression vector.
9. the method applying the arbitrary described recombinant bacterium fermenting and producing chrondroitin of claim 6-8, it is characterised in that by described Genetic engineering bacterium is seeded to fermentation medium, cultivates 54-80h at 37 DEG C；Described fermentation medium: 20g/L yeast powder, 50g/ L sucrose, 3.9g/L potassium sulfate, 1.5g/L magnesium sulfate, 50mM phosphate buffer, pH7.0.
10. mutant described in claim 1 and the application in producing chrondroitin of the cell strain system containing this mutant.
CN201610652888.6A 2016-08-10 2016-08-10 A kind of chondroitin synthase mutant and its application Active CN106244566B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610652888.6A CN106244566B (en) 2016-08-10 2016-08-10 A kind of chondroitin synthase mutant and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610652888.6A CN106244566B (en) 2016-08-10 2016-08-10 A kind of chondroitin synthase mutant and its application

Publications (2)

Publication Number Publication Date
CN106244566A true CN106244566A (en) 2016-12-21
CN106244566B CN106244566B (en) 2019-08-20

Family

ID=58078755

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610652888.6A Active CN106244566B (en) 2016-08-10 2016-08-10 A kind of chondroitin synthase mutant and its application

Country Status (1)

Country Link
CN (1) CN106244566B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107189992A (en) * 2017-06-29 2017-09-22 江南大学 A kind of heparosan synthase and its application
CN108841771A (en) * 2018-07-11 2018-11-20 江南大学 It is a kind of produce chondroitin recombination Corynebacterium glutamicum and its application

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101679955A (en) * 2007-04-24 2010-03-24 生化学工业株式会社 Chondroitin-producing bacterium and method of producing chondroitin
CN104388372A (en) * 2014-12-04 2015-03-04 江南大学 Recombinant bacillus subtilis for producing chondroitin and application of recombinant bacillus subtilis

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101679955A (en) * 2007-04-24 2010-03-24 生化学工业株式会社 Chondroitin-producing bacterium and method of producing chondroitin
CN104974973A (en) * 2007-04-24 2015-10-14 生化学工业株式会社 Chondroitin-producing bacterium and method of producing chondroitin
CN104388372A (en) * 2014-12-04 2015-03-04 江南大学 Recombinant bacillus subtilis for producing chondroitin and application of recombinant bacillus subtilis

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
NCBI: "chondroitin synthase [Escherichia coli], NCBI Reference Sequence: WP_000025667.1", 《GENBANK》 *
吴秋林等: "发酵法生产硫酸软骨素的研究进展", 《生物工程学报》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107189992A (en) * 2017-06-29 2017-09-22 江南大学 A kind of heparosan synthase and its application
CN107189992B (en) * 2017-06-29 2019-09-03 江南大学 A kind of heparosan synthase and its application
CN108841771A (en) * 2018-07-11 2018-11-20 江南大学 It is a kind of produce chondroitin recombination Corynebacterium glutamicum and its application

Also Published As

Publication number Publication date
CN106244566B (en) 2019-08-20

Similar Documents

Publication Publication Date Title
CN105087456B (en) A method of producing the recombined bacillus subtilis building of specified molecular weight hyaluronic acid
CN104388372B (en) A kind of recombined bacillus subtilis for producing chondroitin and its application
CN104894047A (en) Construction method of recombinant Bacillus subtilis strain for expressing D-allulose 3-epimerase based on D-alanine defective selection marker
CN104293726A (en) Recombinant bacillus subtilis producing micromolecular hyaluronic acid
CN103468624B (en) Genetic engineering bacteria used for high efficient production of mycose
US10633658B2 (en) Method for producing N-acetylglucosamine by co-utilizing glucose and xylose based on CRISPRi
CN101294149A (en) Alpha-cyclodextrin glucosyl transferase gene clone and expression
CN104651287A (en) Engineering bacterium for synthesizing glycosylglycerol and application thereof
CN107603937A (en) A kind of recombination bacillus coli and its construction method for expressing lysine aminopeptidase
CN108753669A (en) A kind of adenine production bacterial strain and its construction method and application
CN106434590A (en) Fucosyltransferase, genetically engineered bacteria thereof and application
CN109182423A (en) Promote the method for Escherichia coli fermentation production poly sialic acid
CN107058200A (en) The method for preparing the glucoside of L ascorbic acid 2
CN104046586B (en) One strain gene engineering bacterium and the application in producing (2R, 3R)-2,3-butanediol thereof
CN101691560B (en) Colibacillus and method for performing soluble expression of transglutaminase proenzyme thereof
CN103789282B (en) The preparation method of a kind of high temperature mannase ManAHr and gene thereof and application
CN103205391A (en) Gene engineering strain and application thereof
CN106244566B (en) A kind of chondroitin synthase mutant and its application
CN113073074B (en) Genetically engineered bacterium for efficiently synthesizing riboflavin and application thereof
CN101979644A (en) Method for preparing N-acetylneuraminic acid by one-step catalysis of fusion protein
CN105567779A (en) Fermentation method of high-yield and low-molecular-weight thermal gel
CN105200076A (en) Bacillus subtilis recombined to express gamma-lactamase and immobilization and application
CN102120999A (en) Method for synthesizing human milk fucosylation oligosaccharide by using genetic engineering strain through coupling and fermenting
CN102367448A (en) Construction method of genetic engineering strain for high expression and easy purification of beta-mannanase
CN104789586A (en) Escherichia coli genome integration vector, genetically engineered bacterium and application of genetically engineered bacterium to xylitol production

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant