CN106220736B

CN106220736B - Chimeric antigen receptor, cell expressing same, preparation method and application thereof

Info

Publication number: CN106220736B
Application number: CN201610575370.7A
Authority: CN
Inventors: 李鹏; 魏新茹; 赖允鑫; 秦乐; 林思妙
Original assignee: Shenzhen In Vivo Biological Medicine Technology Co Ltd
Current assignee: Shenzhen In Vivo Biological Medicine Technology Co Ltd
Priority date: 2016-07-20
Filing date: 2016-07-20
Publication date: 2020-01-10
Anticipated expiration: 2036-07-20
Also published as: CN106220736A

Abstract

The present invention relates to a chimeric antigen receptor, nucleic acids encoding the same, constructs, expression vectors and transformed cells comprising the nucleic acids, and their pharmaceutical uses. The chimeric antigen receptor of the present invention comprises at least one extracellular domain comprising SC-FV fragments derived from the heavy and light chains of a monoclonal antibody specific for MUC1 or PSCA or genetic alterations based on this domain and optionally a signal peptide, optionally a transmembrane domain, and at least one intracellular signaling domain comprising an immune co-stimulatory signal combination. The capability of the transformed cell of the invention for killing solid tumor cells in vitro and in vivo is obviously enhanced, and is higher than that of the conventional chimeric antigen receptor with a second generation structure.

Description

Chimeric antigen receptor, cell expressing same, preparation method and application thereof

Technical Field

The invention relates to the technical field of cell immunotherapy of tumors, in particular to a chimeric antigen receptor, nucleic acid for coding the chimeric antigen receptor, a construct, an expression vector and a transformed cell containing the nucleic acid, and pharmaceutical applications of the chimeric antigen receptor and the nucleic acid.

Background

In recent years, the incidence and mortality of lung cancer has been increasing, making it one of the most serious types of cancer worldwide. Particularly in china, the incidence of lung cancer has risen rapidly in the last decade, mainly because of the rapidly increasing number of smokers (mostly men), and it is statistically estimated that about three thousand people die of smoking every day [1 ]. Lung cancer is largely classified into small cell lung cancer (15%) and non-small cell lung cancer, which in turn can be classified into adenocarcinoma (40%), squamous cell carcinoma (30%) and large cell carcinoma (15%). Different types of lung cancer, treatment strategies and prognosis vary, with about 70-80% of patients diagnosed with non-small cell lung cancer. The clinical treatment scheme of the non-small cell lung cancer mainly comprises a novel treatment scheme represented by surgical resection treatment, radiotherapy, chemotherapy, traditional Chinese medicine treatment and molecular targeted treatment. However, despite the rapid advances in current diagnostic and therapeutic techniques, many lung cancers remain to be discovered at a later date. Approximately 80% of lung cancer patients are found to have entered late metastatic stage and are unable to undergo surgical resection. In 20% of treatable cases, relapse often occurs in the later stages, and five-year survival rate is very low. And the non-small cell lung cancer has poor sensitivity to radiotherapy and chemotherapy and poor treatment effect. The targeted therapy of lung cancer mainly aims at EGFR, ALK and other gene mutations, however, the effect of the current targeted drugs is short, and the tumor can acquire resistance in almost one year. Targeting therapy based on the genetic profile of lung cancer patients seems to be a difficult task. Therefore, the search for effective therapeutic approaches and more effective lung cancer-associated biomarkers is a problem that needs to be addressed in current lung cancer treatments.

Currently, tumor immunotherapy CAR-T (chimeric antigen receptor T cell immunotherapy) is a new therapeutic approach that appears following surgery, chemotherapy, radiotherapy and targeted therapy, called "fifth therapy" for cancer treatment, with more and more encouraging research efforts in recent years. Clinical trials of CAR-T therapy technology are actively being conducted in countries around the world, including the United states, United kingdom, Sweden, China, Japan, and so on. Thus, CAR-T can be a novel therapeutic approach to the treatment of lung cancer. CAR-T therapy requires the selection of tumor-specific or tumor-associated antigens as its target. At present, no specific antigen for lung cancer has been found. Therefore, by summarizing a large amount of literature, MUC-1 mucin and PSCA are selected as targets for treating lung cancer.

Mucin MUC-1(Mucin 1) plays an important role in epithelial cell renewal, differentiation and integrity maintenance, carcinogenesis and metastasis. MUC1 is an important tumor biological marker due to its abnormal expression in tumor tissues. MUC1 is widely distributed and expressed abnormally abundantly on the surface of cancer cells, and glycosylation is incomplete, thus exposing normally cryptic epitopes, and the MUC1 polypeptide backbone on the surface of cancer cells is more exposed than that in normal cells, thus becoming a target for immune cell attack. The expression of PSCA is increased in tumors such as prostate cancer, pancreatic cancer, bladder cancer and the like, the expression of PSCA is also high in partial lung cancer, and the PSCA as a target of immunotherapy of tumors also shows good clinical application potential. Therefore, PSCA not only becomes a biological marker for tumor diagnosis and prognosis judgment, but also is an important candidate target protein for tumor immunotherapy.

Based on the problems and deficiencies of current lung cancer treatments, for example: first, approximately 80% of lung cancer patients are found to have entered late metastatic stage and are unable to undergo surgical resection. In about 20% of cases that can be treated, relapse often occurs in the later period, and the five-year survival rate is very low; secondly, the non-small cell lung cancer has poor sensitivity to radiotherapy and chemotherapy and poor treatment effect; thirdly, the effect of the lung cancer targeting drug aiming at EGFR, ALK and other gene mutations is short, and the tumor can obtain resistance in almost one year.

Therefore, if a chimeric antigen receptor T cell targeting PSCA and MUC1 can be researched and used for treating lung cancer, the chimeric antigen receptor T cell can help to relieve excessive non-specific immune effect and side effects such as cytokine storm and the like, and is beneficial to effective treatment of the lung cancer.

Disclosure of Invention

In view of the problems in the prior art, the present invention aims to provide a chimeric antigen receptor, a nucleic acid encoding the same, a construct, an expression vector and a transformed cell containing the nucleic acid, and pharmaceutical uses thereof. The capability of the transformed cell of the invention for killing solid tumor cells in vitro and in vivo is obviously enhanced, and the cell is higher than the chimeric antigen receptor with the conventional second generation structure, and is particularly suitable for treating lung cancer.

The present inventors have generated MUC1 or PSCA-specific CAR (CAR-PSCA; CAR-MUC1) comprising scFV derived from MUC1 or PSCA-specific monoclonal antibody, and surprisingly found that introducing the CAR-PSCA or CAR-MUC1 into primary T cells by transfection detects the proliferation of CAR T cells in vitro and in vivo, and the killing and effector functions to lung cancer cell lines and primary patient samples of lung cancer, which have a superior killing effect on lung cancer, can be used as a new and effective method for treating lung cancer, opening up a new avenue for the treatment of lung cancer.

In a first aspect, the present invention provides a chimeric antigen receptor, which is a PSCA and MUC1 targeted chimeric antigen receptor comprising at least one extracellular domain, optionally a transmembrane domain, and at least one intracellular signaling domain, wherein the extracellular domain comprises SC-FV fragments derived from the heavy and light chains of a monoclonal antibody specific for MUC1 or PSCA or genetic modifications based on this domain and optionally a signal peptide.

According to the invention, the optional signal peptide is a signal peptide corresponding to the chimeric antigen receptor.

In the present invention, the intracellular signaling domain comprises a combination of immune co-stimulatory signals.

The invention is directed to second and third generation CAR molecules to MUC-1, designated CAR-MUC1, CAR-MUC1T1, and CAR-MUC1T2, and second and third generation CAR molecules to PSCA, designated CAR-PSCA, CAR-PSCAT1, and CAR-PSCAT 2. Through killing experiments on lung cancer cell lines in vitro and in vivo, the second generation CAR-T with MUC1 and PSCA as targets can well kill the lung cancer cell lines. The two antigens MUC1 and PSCA provided by the invention can be used as effective targets for treating lung cancer; in addition, the third generation CAR molecules are more effective than the second generation CAR molecules, which indicates that the third generation CAR structure is superior to the second generation CAR structure in the invention.

Therefore, the invention provides the application of the chimeric antigen receptor in preparing the medicaments for treating the diseases related to the lung cancer, and the chimeric antigen receptor can be used as a target to well kill lung cancer cell lines.

In vitro CAR molecules with MUC-1 and PSCA as targets are co-cultured with lung cancer cell line A549 and the like according to a certain proportion, and the killing effect and the secretion level of cell factors IFNgamma, IL-2 and TNF-alpha are detected. The killing activity of control T cells as well as second and third generation CAR-T cells against lung cancer cell lines was tested in vivo by NOD/SCIDIL-2 gamma-immunodeficient mice. In addition, a primary lung cancer patient PDX model is constructed in NOD/SCIDIL-2 gamma-immunodeficiency mice, and the model is used for verifying the killing effect of second-generation and third-generation CAR molecules taking MUC-1 and PSCA as targets on lung cancer, so that a result with a good killing effect on the lung cancer is obtained.

Preferably, the immune co-stimulatory signal combination comprises a TLR1 and/or a TLR2 signaling domain.

Further preferably, the intracellular signaling domain is TLR1 and/or TLR2 in combination with a CD3 ζ, CD28 signaling domain.

Preferably, the TLR1 and/or TLR2 signaling domain is disposed C-terminal to the intracellular domain of CD3 ζ.

Preferably, the CD28 signaling domain is disposed on the N-terminal side of the intracellular domain of CD3 ζ.

In a second aspect, the present invention provides a nucleic acid encoding the chimeric antigen receptor of the first aspect.

In a third aspect, the present invention provides a nucleic acid construct comprising a nucleic acid according to the second aspect operably linked to one or more control sequences capable of directing expression of the chimeric antigen receptor in a host cell.

In a fourth aspect, the present invention provides an expression vector comprising the nucleic acid construct of the third aspect; preferably, the expression vector is a lentivirus.

In a fifth aspect, the invention provides a transformed cell comprising a nucleic acid according to the second aspect, or into which a nucleic acid construct according to the third aspect or an expression vector according to the fourth aspect has been transformed.

Preferably, the transformed cell is an immune cell, more preferably a T cell, a B cell, an NK cell or a combination thereof, and may be, for example, any one of a T cell, a B cell or an NK cell, or a combination of any two or three of a T cell, a B cell and an NK cell.

In a sixth aspect, the present invention provides a method of preparing a transformed cell according to the fifth aspect, comprising: a step of introducing into a cell a nucleic acid according to the second aspect, or transforming a nucleic acid construct according to the third aspect or an expression vector according to the fourth aspect.

In a seventh aspect, the present invention provides the use of a chimeric antigen receptor according to the first aspect, a nucleic acid according to the second aspect, a nucleic acid construct according to the third aspect, an expression vector according to the fourth aspect or a transformed cell according to the fifth aspect, for the manufacture of a medicament for the treatment of a disease associated with the expression of a chimeric antigen receptor, preferably MUC1 or PSCA.

Preferably, the disease is a solid tumor, preferably lung and/or breast cancer.

Compared with the prior art, the invention at least has the following beneficial effects:

the second generation and third generation CAR molecules taking MUC-1 and PSCA as targets have good killing effect on solid tumors, can be used as a new method for effectively treating the solid tumors, particularly lung cancer and/or breast cancer, and opens up a new way for treating the solid tumors.

Drawings

FIG. 1 is a synthetic sequence map in example 1.

FIG. 2 is a functional diagram comparing WT-T, CAR-MUC-1T, CAR-MUC-1T1 and CAR-MUC-1T2 in vitro;

FIG. 3 is a functional diagram comparing WT-T, CAR-PSCA, CAR-PSCAT1 and CAR-PSCAT2 in vitro;

FIG. 4 is a graph comparing in vivo tumor killing function of T cells of WT-T, CAR-MUC-1T, CAR-MUC-1T1 and CAR-MUC-1T2, wherein FIG. 4-1 is a graph of tumor mass size for 30 days (after tumor transplantation day) for four groups of T cell tumor mice injected separately, and FIG. 4-2 is a graph of change in tumor mass volume for 12, 15, 18, 21, 24, 27, 30 days (after tumor transplantation day) for four groups of T cell tumor mice injected separately;

FIG. 5 is a graph comparing in vivo tumor killing function of WT-T, CAR-PSCA, CAR-PSCAT1 and CAR-PSCAT2 infected T cells, wherein FIG. 5-1 is a graph of tumor mass size for 30 days (after tumor transplantation day) and FIG. 5-2 is a graph of tumor mass volume change for 12, 15, 18, 21, 24, 27, 30 days (after tumor transplantation day) for four groups of T cell tumor mice injected separately;

FIG. 6 is a graph comparing the killing function of T cells of WT-T, CAR-MUC-1T, CAR-MUC-1T1 and CAR-MUC-1T2 on breast cancer cells in vitro.

The present invention is described in further detail below. The following examples are merely illustrative of the present invention and do not represent or limit the scope of the claims, which are defined by the claims.

Detailed Description

The technical scheme of the invention is further explained by the specific implementation mode in combination with the attached drawings.

To better illustrate the invention and to facilitate the understanding of the technical solutions thereof, typical but non-limiting examples of the invention are as follows:

example 1 CAR plasmid construction

1. Plasmid construction

1) Through gene synthesis, CAR-PSCA, CAR-MUC1, CAR-PSCA-T1, CAR-PSCA-T2, CAR-MUC1-T1 and CAR-MUC1-T2 are respectively synthesized (the gene sequence map is shown in figure 1), the C end of the synthesized gene contains a restriction enzyme Pme1 enzyme cutting site and a protection base thereof, and the N end of the synthesized gene contains a restriction enzyme Spe1 enzyme cutting site and a protection base thereof.

The synthesized gene sequence is shown in a sequence map of a figure 1 and is formed by combining SEQ NO.1 (a DNA sequence of Anti-PSCA-scFV), SEQ NO.2 (a DNA sequence of Anti-MUC-1-scFV), SEQ NO.3 (a DNA sequence of TLR1 structural domain), SEQ NO.4 (a DNA sequence of TLR2 structural domain), SEQ NO.5 (a DNA sequence of CD3 zeta structural domain) and SEQ NO.6 (a DNA sequence of CD28 intracellular structural domain).

2) Synthetic DNA fragments containing cohesive ends (CAR-PSCA, CAR-MUC1, CAR-PSCA-T1, CAR-PSCA-T2, CAR-MUC1-T1, CAR-MUC1-T2) and linearized DNA (containing cohesive ends) of pWPXld-eGFP vector were obtained by double digestion with (restriction endonucleases) Pme1 and Spe1, respectively.

3) Synthesized DNA fragments with sticky ends (CAR-PSCA, CAR-MUC1, CAR-PSCA-T1, CAR-PSCA-T2, CAR-MUC1-T1, CAR-MUC1-T2) and linearized pWPXLD-EGFP vector DNA fragments were obtained by recovery by agar gel electrophoresis.

4) Linearized pWPXld-2A-EGFP was ligated with cohesive-ended synthetic DNA fragments (CAR-PSCA, CAR-MUC1, CAR-PSCA-T1, CAR-PSCA-T2, CAR-MUC1-T1, CAR-MUC1-T2), respectively, by T4DNA ligase (Invitrogen Corp.) to obtain CAR plasmid transformation vectors (pWPXld-CAR-PSCA-2A-EGFP, pWPXld-CAR-MUC1-2A-EGFP, pWPXld-CAR-PSCA-T1-2A-EGFP, pWPXld-CAR-PSCA-T2-2A-EGFP, pWPXld-MUC 1-T1-WPA-EGFP, pXld-MUC 1-MUC 2-2A-EGFP).

CAR lentivirus packaging

1) 293T cells were cultured in 10cm dishes in the following media: DMEM high glucose medium + 10% FBS (fetal bovine serum) + 1% diabody (100 × penicillin-streptomycin mixed solution);

2) when the density of 293T cells in a 150mm culture dish reaches 80-90%, the culture medium is replaced: DMEM high-glucose medium + 1% FBS + 1% double antibody;

3) after 2-6 hours of culture medium replacement, pWPXLD-CAR-EGFP plasmids (pWPXLD-CAR-PSCA-2A-EGFP, pWPXLD-CAR-MUC1-2A-EGFP, pWPXLD-CAR-PSCA-T1-2A-EGFP, pWPXLD-CAR-PSCA-T2-2A-EGFP, pWPXLD-CAR-MUC1-T1-2A-EGFP, pWPXLD-CAR-MUC1-T2-2A-EGFP) or control plasmids pXLD-EGFP were co-transferred with lentivirus packaging helper plasmids pMD2.G, psPAX2 into 293T cells with PEI, respectively, and reagents and dosages were as follows:

4) at 24, 48 and 72 hours after transformation, respectively, culture medium supernatants were collected and fresh medium (DMEM high-glucose medium + 1% FBS + 1% diabody) was added;

5) after collecting the culture medium supernatant, centrifuging 2500g of the supernatant for 0.5 hour (optional step);

6) taking the centrifugal supernatant, filtering the centrifugal supernatant by using a 0.45um filter, and centrifuging the centrifugal supernatant for 1.5 hours by using a super high speed centrifuge at 28000rpm (optional step);

7) after ultra-high speed centrifugation, gently removing the supernatant, adding 200ul PBS, and dissolving at 4 ℃ for 12-16 hours to obtain CAR lentivirus or blank control GFP lentivirus (optional step);

8) after the virus is dissolved, collecting virus solution, subpackaging in a PCR tube, and freezing and storing at-80 ℃ for later use.

T cell activation and CAR Lentiviral infection

1) Separation and purification of T cells: separating mononuclear cells in blood by a Ficoll density gradient method, removing red blood cells by cracking a red blood cell lysate, and then separating T cells by MACS Pan-T magnetic beads;

2) the sorted T cells were diluted with medium (AIM-V medium + 5% FBS + penicillin 100U/ml + streptomycin 0.1mg/ml) to a cell concentration of 2.5X 10⁶Each ml is ready for use;

3) magnetic beads coated with CD2, CD3, CD28 antibodies (product source: tian and whirlwind of Germany and America), namely the coating magnetic beads are mixed with the T cells in a ratio of 1:2, and the final density of the T cells is 5 multiplied by 10⁶Per ml/cm². Mixing, and standing at 37 deg.C with 5% CO₂The incubator is used for 48 hours of culture stimulation.

4) Lentivirus-transfected T cells: the beads in the activated T cell-bead mixture were removed by magnetic field, centrifuged at 300g for 5min, the supernatant removed, resuspended in fresh medium, and added with CAR-and GFP-expressing lentiviruses (virus loading MOI 10) respectively, followed by 8. mu.g/ml polybrene and 300IU/ml IL-2. Standing at 37 deg.C for 5% CO₂After 24h of culture in an incubator, centrifuging for 5min at 300g, removing supernatant, and resuspending with fresh culture medium containing 300IU/ml IL-2 to obtain the T cells over-expressing CAR plasmid.

5) CAR T cell expansion: maintenance of CAR T cell density at 1X 10⁶About one/ml, and half liquid change is carried out every 2 to 3 days. After two weeksCAR T cell numbers can be expanded 100-fold. GFP positive cells are cells which are transfected successfully, and the GFP positive proportion is detected by flow type, so that the proportion of CAR T cells (CAR-PSCA, CAR-MUC1, CAR-PSCA-T1, CAR-PSCA-T2, CAR-MUC1-T1, CAR-MUC1-T2) or blank control T cells (GFP-T) is obtained.

Example 2 in vitro test of the killing function of CAR-MUC1-T1/2T cells on tumor (lung cancer) cells

1) GFP T (blank control), CAR-MUC1T (negative control), CAR-MUC1-T1T, CAR-MUC1-T2T cells prepared in example 1 were mixed with 1X 10 cells, respectively⁴The tumor cells A549-GL are mixed at a ratio of 2:1, 1:1, 0.5:1 and 0.25:1, added into a 96-hole U-shaped plate, each group is provided with 3 multiple holes, centrifuged at 250g for 5min, and then placed at 37 ℃ with 5% CO₂Co-culturing for 18h in an incubator;

2) in vitro comparison of the recognition and killing functions of GFP T, CAR-MUC1T, CAR-MUC1-T1T and CAR-MUC1-T2T cells on lung cancer cells, the tumor cells are human lung adenocarcinoma cell lines with A549-GL luciferase.

3) Luciferase (Luciferase) quantitative killing efficiency assessment method: 18 hours after the CAR T cells were co-cultured with the tumor cells (experimental control group was tumor cell culture alone), 100 μ l/well of luciferase substrate was added to a 96-well cell culture plate (1 ×), the cells were resuspended and mixed, rlu (relative light unit) was immediately measured by a multifunctional plate reader, and the measurement time was set to 1 second. The killing proportion calculation formula is as follows: 100% × (control well reading-experimental well reading)/control well reading (blank reading without cells negligible); the results are shown in FIG. 2.

4) The results show that the killing efficiency of the CAR-MUC1-T1T and CAR-MUC1-T2T cells to A549-GL tumor cells in vitro is remarkably higher than that of the CAR-MUC1T cells, and under the condition that the ratio of E to T (namely the ratio of Effector T cells to Target cells) is very small, namely the tumor Target cells are far larger than Effector T cells, the CAR-MUC1-T1T and CAR-MUC1-T2T cells can also show very strong tumor killing activity, which is remarkably higher than that of CAR-MUC1T cells (see figure 2).

Example 3 in vitro test of the killing function of CAR-PSCA-T1/2T cells on tumor (lung cancer) cells

1) G prepared in example 1FP T (blank control), CAR-PSCA T (negative control), CAR-PSCA-T1T, CAR-PSCA-T2T cells were compared with 1X 10 cells, respectively⁴The tumor cells A549-GL are mixed at a ratio of 2:1, 1:1, 0.5:1 and 0.25:1, added into a 96-hole U-shaped plate, each group is provided with 3 multiple holes, centrifuged at 250g for 5min, and then placed at 37 ℃ with 5% CO₂Co-culturing for 18h in an incubator;

2) in vitro comparison of the recognition and killing functions of GFP T, CAR-PSCA-T1T and CAR-PSCA-T2T cells on lung cancer cells, wherein the tumor cells are human lung adenocarcinoma cell lines with A549-GL luciferase.

3) Luciferase (Luciferase) quantitative killing efficiency assessment method: 18 hours after the CAR T cells were co-cultured with the tumor cells (experimental control group was tumor cell culture alone), 100 μ l/well of luciferase substrate was added to a 96-well cell culture plate (1 ×), the cells were resuspended and mixed, rlu (relative light unit) was immediately measured by a multifunctional plate reader, and the measurement time was set to 1 second. The killing proportion calculation formula is as follows: 100% × (control well reading-experimental well reading)/control well reading (blank reading without cells negligible); the results are shown in FIG. 3.

4) The results show that the killing efficiency of the CAR-PSCA-T1T and CAR-PSCA-T2T cells to tumor cells A549-GL in vitro is remarkably higher than that of the CAR-PSCA T cells, and the CAR-PSCA-T1T and CAR-PSCA-T2T cells can also show strong tumor killing activity and are remarkably higher than that of the CAR-PSCA T cells under the condition that the ratio of E to T (namely the ratio of Effector T cells to Target cells) is very small, namely the tumor Target cells are far larger than the Effector T cells (see figure 3).

Example 4 detection of CAR-MUC1-T1/2T cells in vivo recognition of tumor killing

1) The number of cells was 1X 10⁵Transplantation of A549-GL cells into NOD/SCID IL2rg^-/-Constructing a lung cancer mouse model in an immunodeficient mouse body;

2) 12 days after tumor transplantation, the number of cells injected intravenously was 2X 10 in each of the lung cancer mouse models⁶The GFP T (blank control), CAR-MUC1T (negative control), CAR-MUC1-T1T, CAR-MUC1-T2T cells of (1), for four experimental groups, four replicates per group;

3) measuring subcutaneous tumor masses of four experimental mice with vernier calipers at 12 th, 15 th, 18 th, 21 th, 24 th, 27 th and 30 th days after tumor transplantation, recording, and drawing a tumor growth curve (as shown in fig. 4-2);

4) on day 30 after tumor transplantation, tumor masses of four experimental mice were taken, and the sizes were compared (see FIG. 4-1);

5) the results show that the CAR-MUC1-T1T and CAR-MUC1-T2T cells can recognize and kill A549-GL cells in vivo, and the killing function is higher than that of CAR-MUC1T cells.

Example 5 detection of CAR-PSCA-T1/2T cell recognition in vivo killing of tumors

2) 12 days after tumor transplantation, the number of cells injected intravenously was 2X 10 in each of the lung cancer mouse models⁶GFP T (blank control), CAR-PSCA T (negative control), CAR-PSCA-T1T, CAR-PSCA-T2T cells, for four experimental groups, with four replicates per group;

3) measuring subcutaneous tumor masses of four experimental mice with vernier calipers at 12 th, 15 th, 18 th, 21 th, 24 th, 27 th and 30 th days after tumor transplantation, recording, and drawing a tumor growth curve (as shown in fig. 5-2);

4) on day 30 after tumor transplantation, tumor masses of four experimental mice were taken, and the sizes were compared (see FIG. 5-1);

5) the results show that the CAR-PSCA-T1T and CAR-PSCA-T2T cells can recognize and kill A549-GL cells in vivo, and the killing function is higher than that of CAR-PSCA T cells.

Example 6 in vitro test of the killing function of CAR-MUC1-T1/2T cells on tumor (breast cancer) cells

1) GFP T (blank control), CAR-MUC1T (negative control), CAR-MUC1-T1T, CAR-MUC1-T2T cells prepared in example 1 were mixed with 1X 10 cells, respectively⁴Mixing the tumor cells T47D-GL at a ratio of 2:1, 1:1, 0.5:1, 0.25:1, adding into a 96-well U-shaped plate, each group having 3 multiple wells, centrifuging 250g for 5min, and placing at 37 deg.C with 5% CO₂Co-culturing for 18h in an incubator;

2) in vitro comparison of the recognition and killing functions of GFP T, CAR-MUC1T, CAR-MUC1-T1T and CAR-MUC1-T2T cells on breast cancer cells, the tumor cells are selected from human breast cancer cell lines with T47D-GL luciferase.

3) Luciferase (Luciferase) quantitative killing efficiency assessment method: 18 hours after the CAR T cells were co-cultured with the tumor cells (experimental control group was tumor cell culture alone), 100 μ l/well of luciferase substrate was added to a 96-well cell culture plate (1 ×), the cells were resuspended and mixed, rlu (relative light unit) was immediately measured by a multifunctional plate reader, and the measurement time was set to 1 second. The killing proportion calculation formula is as follows: 100% × (control well reading-experimental well reading)/control well reading (blank reading without cells negligible); the results are shown in FIG. 6.

4) The results show that the killing efficiency of the CAR-MUC1-T1T and CAR-MUC1-T2T cells on T47D-GL tumor cells is higher than that of CAR-MUC1T cells, and the CAR-MUC1-T1T and CAR-MUC1-T2T cells can also show strong tumor killing activity in the case of small E: T (i.e. the ratio of Effector T cells to Target cells), namely the tumor Target cells are larger than the Effector T cells, and the CAR-MUC1-T1T and CAR-MUC1-T2T cells are higher than that of CAR-MUC1T cells (see figure 6).

The applicant declares that the present invention illustrates the detailed structural features of the present invention through the above embodiments, but the present invention is not limited to the above detailed structural features, that is, it does not mean that the present invention must be implemented depending on the above detailed structural features. It should be understood by those skilled in the art that any modifications of the present invention, equivalent substitutions of selected components of the present invention, additions of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

The preferred embodiments of the present invention have been described in detail, however, the present invention is not limited to the specific details of the above embodiments, and various simple modifications may be made to the technical solution of the present invention within the technical idea of the present invention, and these simple modifications are within the protective scope of the present invention.

It should be noted that the various technical features described in the above embodiments can be combined in any suitable manner without contradiction, and the invention is not described in any way for the possible combinations in order to avoid unnecessary repetition.

In addition, any combination of the various embodiments of the present invention is also possible, and the same should be considered as the disclosure of the present invention as long as it does not depart from the spirit of the present invention.

List of Gene sequences referred to herein

SEQ NO.1：

atggagacagacacactcctgctatgggtgctgctgctctgggttccaggttccaccggtgacattcagctgacccaatctccaagctctttgtccgcctctgtgggggatagggtcaccatcacctgcagtgccagttcaagtgtaagattcattcactggtaccagcagaaaccaggaaaagctcccaaaagactcatctatgacacatccaaactggcttctggcgtcccttctaggttcagtggctccgggtctgggacagacttcaccctcaccattagcagtctgcagccggaagatttcgccacctattactgtcagcagtggagtagtagcccattcacgttcggacaggggaccaaggtggagataaaaggcagtactagcggcggtggctccggaggcggctccggaggtggcggcagctcagaggttcagctggtggagtctgggggtggccttgtgcagccagggggctcactccgtttgtcctgcgcagcttctggcttcaacattaaagactactatatacactgggtgcgtcaggcccctggtaagggcctggaatgggttgcatggattgatcctgagaatggtgacactgaatttgtcccgaagttccagggccgtgccactataagcgcagacacatccaaaaacacagcctacctgcagatgaacagcctgcgtgctgaggacactgccgtctattattgtaaaacgggggggttctggggtcaaggaaccctggtcaccgtctcgagcgagcccaaatcttgtgacaaaactcacacatgcccaccgtgcggcggaggtagctctggcggtggatccggcgggcagccccgagaaccacaggtgtacaccctgcccccatcccgggatgagctgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctatcccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgctggactccgacggctccttcttcctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaagcggccgca

SEQ NO.2：

Atggagacagacacactcctgctatgggtgctgctgctctgggttccaggttccaccggtgatatcgttgtgactcaggaatctgcactcaccacatcacctggtgaaacagtcacactcacttgtcgctcaagtactggggctgttacaacaagtaactatgccaactgggtccaagaaaaaccagatcatttattcactggtctaataggtggtaccaacaaccgagcaccaggtgttcctgccagattctcaggctccctgattggagacaaggctgccctcaccatcacaggggcacagactgaggatgaggcaatatatttctgtgctctatggtacagcaaccattgggtgttcggtggaggaaccaaactgactgtcctaggatccgagggtggctcaggatcgggtggatcaggctctggtggctcaggatcggaggtccagctgcagcagtcaggaggaggcttggtgcaacctggaggatccatgaaactctcctgtgttgcctctggattcactttcagtaactactggatgaactgggtccgccagtctccagagaaggggcttgagtgggttgctgaaattagattgaaatctaataattatgcaacacattatgcggagtctgtgaaagggaggttcaccatctcaagagatgattccaaaagtagtgtctacctgcaaatgaacaacttaagagctgaagacactggcatttattactgtacctttggtaactcctttgcttactggggccaagggaccacggtcaccgtctcctcacgctggccagagtctccaaaggcacaggcctcctcagtgcccactgcacaaccccaagcagagggcagcctcgccaaggcaaccacagccccagccaccacccgtaacacaggaagaggaggagaagagaagaagaaggagaaggagaaagaggaacaagaagagagagagacaaagacaccagagtgcccg

SEQ NO.3：

AACATACCCTTAGAAGAACTCCAAAGAAATCTCCAGTTTCATGCATTTATTTCATATAGTGGGCACGATTCTTTCTGGGTGAAGAATGAATTATTGCCAAACCTAGAGAAAGAAGGTATGCAGATTTGCCTTCATGAGAGAAACTTTGTTCCTGGCAAGAGCATTGTGGAAAATATCATCACCTGCATTGAGAAGAGTTACAAGTCCATCTTTGTTTTGTCTCCCAACTTTGTCCAGAGTGAATGGTGCCATTATGAACTCTACTTTGCCCATCACAATCTCTTTCATGAAGGATCTAATAGCTTAATCCTGATCTTGCTGGAACCCATTCCGCAGTACTCCATTCCTAGCAGTTATCACAAGCTCAAAAGTCTCATGGCCAGGAGGACTTATTTGGAATGGCCCAAGGAAAAGAGCAAACGTGGCCTTTTTTGGGCTAACTTAAGGGCAGCCATTAATATTAAGCTGACAGAGCAAGCAAAGAAA

SEQ NO.4：

CAGGCCAAAAGGAAGCCCAGGAAAGCTCCCAGCAGGAACATCTGCTATGATGCATTTGTTTCTTACAGTGAGCGGGATGCCTACTGGGTGGAGAACCTTATGGTCCAGGAGCTGGAGAACTTCAATCCCCCCTTCAAGTTGTGTCTTCATAAGCGGGACTTCATTCCTGGCAAGTGGATCATTGACAATATCATTGACTCCATTGAAAAGAGCCACAAAACTGTCTTTGTGCTTTCTGAAAACTTTGTGAAGAGTGAGTGGTGCAAGTATGAACTGGACTTCTCCCATTTCCGTCTTTTTGATGAGAACAATGATGCTGCCATTCTCATTCTTCTGGAGCCCATTGAGAAAAAAGCCATTCCCCAGCGCTTCTGCAAGCTGCGGAAGATAATGAACACCAAGACCTACCTGGAGTGGCCCATGGACGAGGCTCAGCGGGAAGGATTTTGGGTAAATCTGAGAGCTGCGATAAAGTCC

SEQ NO.5：

Agagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccccctcgc

SEQ NO.6：

Aggagtaagaggagcaggctcctgcacagtgactacatgaacatgactccccgccgccccgggcccacccgcaagcattaccagccctatgccccaccacgcgacttcgcagcctatcgctcc

Claims

1. A chimeric antigen receptor comprising at least one extracellular domain, a transmembrane domain, and at least one intracellular signaling domain, wherein the extracellular domain comprises SC-FV fragments of the heavy and light chains of a monoclonal antibody specific for MUC1 or PSCA and a signal peptide; the intracellular signaling domain comprises an immune co-stimulatory signal combination; the immune co-stimulatory signaling combination comprises a TLR1 and/or a TLR2 signaling domain;

the DNA sequences of SC-FV fragments of the heavy chain and the light chain of the MUC1 specific monoclonal antibody are shown in SEQ NO. 1;

the DNA sequences of SC-FV fragments of the heavy chain and the light chain of the PSCA specific monoclonal antibody are shown in SEQ NO. 2;

the intracellular signaling domain is TLR1 or TLR2 in combination with CD3 ζ, CD28 signaling domain;

the TLR1 or TLR2 signaling domain is disposed C-terminal to the intracellular domain of CD3 ζ;

the CD28 signal domain is disposed at the N-terminal side of the intracellular domain of CD3 ζ;

the DNA sequence of the TLR1 is shown in SEQ NO. 3;

the DNA sequence of the TLR2 is shown in SEQ NO. 4.

2. The chimeric antigen receptor of claim 1, wherein the signal peptide is a signal peptide corresponding to the chimeric antigen receptor.

3. A nucleic acid encoding the chimeric antigen receptor of claim 1 or 2.

4. A nucleic acid construct comprising the nucleic acid of claim 3 operably linked to one or more control sequences that direct expression of the chimeric antigen receptor in a host cell.

5. An expression vector comprising the nucleic acid construct of claim 4.

6. The expression vector of claim 5, wherein the expression vector is a lentivirus.

7. A transformed cell comprising the nucleic acid of claim 3, or into which the nucleic acid construct of claim 4 or the expression vector of claim 5 has been transformed.

8. The transformed cell of claim 7, wherein the transformed cell is an immune cell.

9. The transformed cell of claim 8, wherein the immune cell is a T cell, a B cell, an NK cell, or a combination thereof.

10. A method of making the transformed cell of claim 7, comprising: the step of introducing the nucleic acid according to claim 3 into the genome of a cell, or transforming the nucleic acid construct according to claim 4 or the expression vector according to claim 5.

11. Use of the chimeric antigen receptor of claim 1 or 2, the nucleic acid of claim 3, the nucleic acid construct of claim 4, the expression vector of claim 5, or the transformed cell of claim 7 in the preparation of a medicament for the treatment of a solid tumor.

12. The use according to claim 11, wherein the solid tumor is lung cancer and/or breast cancer.