CN106191262A - A kind of Ig kappa gene secondary of analyzing resets method and the test kit of intermediate product - Google Patents
A kind of Ig kappa gene secondary of analyzing resets method and the test kit of intermediate product Download PDFInfo
- Publication number
- CN106191262A CN106191262A CN201610571502.9A CN201610571502A CN106191262A CN 106191262 A CN106191262 A CN 106191262A CN 201610571502 A CN201610571502 A CN 201610571502A CN 106191262 A CN106191262 A CN 106191262A
- Authority
- CN
- China
- Prior art keywords
- pcr
- linker
- kappa gene
- lch
- genomic dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The present invention relates to a kind of Ig kappa gene secondary that captures and reset method and the test kit of intermediate product.Test kit is by the oligodeoxynucleotide linker of engineer, 6 pairs of forward primer and a downstream primer composition, utilize ligation mediated PCR (lm pcr) technology to capture and expand during Ig kappa gene secondary is reset the first rearrangement fragment V κ J κ intron RS replaced.The test kit of the present invention can be applicable to luminous efficiency and the molecular mechanism of research Ig kappa gene secondary rearrangement generation that analyzed in vitro Ig kappa gene secondary is reset.
Description
Technical field
The present invention relates to immunoglobulin gene rearrangement field, be specifically related in capture and amplification Ig kappa gene secondary rearrangement
Between method lm-pcr of product.
Background technology
The differentiation of bone marrow bone-marrow-derived lymphocyte and growth course are along with heavy chain immunoglobulin (IgH) and light chain (Ig κ) embryonal system base
The rearrangement of cause and the expression of functional B cell surface receptor (BCR), V (D) J gene rearrangement creates rich and varied immunity
Globulin gene storehouse.But, V (D) J gene rearrangement process also can produce the BCR of autoreactivity.In negative selection processes,
The bone-marrow-derived lymphocyte of autoreactivity by apoptosis, or can replace (IgH replacement) and Ig kappa gene by heavy chain gene
Secondary is reset the specificity of (secondary Ig κ rearrangements) change autoreactivity BCR and is reached immunologic tolerance
(immune tolerance), thus avoid autoreactivity B cell by apoptosis.
Ig kappa gene secondary resets the main path as receptor editing, and the molecular mechanism starting this approach is the most indefinite,
The molecular mechanism of this approach is analyzed by the intermediate product that research worker attempts by PCR amplification Ig kappa gene secondary is reset,
But the time of origin reset due to Ig kappa gene secondary is instantaneous, could expand and obtain in the presence of enough template amounts
Target fragment, therefore, research worker utilizes southern blot method to combine lm-pcr to expand in the rearrangement of Ig kappa gene secondary
Between product, but downstream primer without modify, sensitivity and specificity are low, and32The probe of P labelling has radiation, is harmful to health,
Target fragment can not reclaim, it is impossible to carries out follow-up order-checking and information analysis.Additionally, some research worker for specific V κ and
J κ design primer expands V κ J kappa gene fragment by regular-PCR, but so expand the V κ J kappa gene fragment obtained can not be true
The fixed genetic fragment whether excluded by Ig kappa gene secondary.Therefore, this field needs a kind of high specificity, sensitivity
High method captures is reset, by Ig kappa gene secondary, the V κ J kappa gene fragment that replaces, and this product can reclaim order-checking carries out
Further information analysis.
Summary of the invention
It is an object of the present invention to provide a kind of Ig kappa gene secondary of analyzing and reset method and the test kit of intermediate product.
Lm-pcr i.e. ligation-mediated PCR, is initially that oligonucleotide chain (linker) is connected to genome
The DNA fragmentation broken ends of fractured bone, combines with PCR and has the DNA fragmentation of linker for expanding to be connected, so complete genomic DNA order-checking with
And external DNA footprint.Lm-pcr technology transfer is sheared the disconnected of immunoglobulin gene fragment generation to capture RAG enzyme by the present invention
End, and utilize the downstream primer of the forward primer of specific binding V kappa gene fragment and specific binding RS sequence to expand quilt
Ig kappa gene secondary resets the first rearranged gene fragment replaced.
The know-why of the present invention is: optimize the reaction system that linker is connected on genomic DNA.According to V kappa gene man
The V kappa gene fragment design forward primer that in race, homology is higher, forward primer includes V κ out and V κ in, by Vector NTI
The V kappa gene sequence that software comparison homology is higher, designs V κ out and V κ at its framework region 2, utilizes degenerate primer, it is ensured that
The sensitivity of forward primer and specificity, improve lm-pcr amplification efficiency.According to conservative 7 oligomeric sequences in RS sequence, under
3 ' the ends of trip primer J κ BW-LCH, plus six bases of TSACAC, improve sensitivity and the specificity of amplification target fragment.In addition
Annealing temperature according to primer and the size of target fragment, use PCR two one-step circulation method, and thermal starting enzyme, continue to optimize
Reaction system, obtains the lm-pcr reaction system of optimum.
Technical solution of the present invention
A kind of method analyzing Ig kappa gene secondary rearrangement intermediate product, the method uses lm-pcr method to capture at Ig κ base
The first rearrangement fragment V κ J κ-intron-RS being replaced in resetting because of secondary, the method includes: the stream of bone marrow bone-marrow-derived lymphocyte
Formula sorts, the extraction of bone-marrow-derived lymphocyte genomic DNA, the preparation of linker, genomic DNA and the coupled reaction of linker, lm-
Pcr expands, and agarose gel electrophoresis also reclaims target fragment, cloning and sequencing checking target fragment.
Invention also provides a kind of Ig kappa gene secondary of analyzing and reset the test kit of intermediate product, test kit comprises system
Oligonucleotide chain BW-1 and BW-2 needed for standby linker, its sequence is as shown in SEQ ID NO 1 and SEQ ID NO 2；lm-
The forward primer of pcr: V κ 4A out, V κ 4Ain, V κ 4C out, V κ 4C in, V κ 19A out, V κ 19Ain, V κ 23A out, V κ
23Ain, V κ 12out, V κ 12in, V κ RF out and V κ RF in, its sequence is as shown in SEQ ID NO 4-15；Under lm-pcr
Trip primer J κ BW-LCH, its sequence is as shown in SEQ ID NO 3.
Test kit of the present invention has 6 pairs of forward primer, every pair of forward primer all include V κ out and V κ in, V κ out and
V κ in is all complementary with the framework region 2 of V kappa gene fragment, and the complementary region of V κ out is positioned at the outside of V κ in, and both are degenerate primer,
Can combine from the different V kappa gene fragments in same V kappa gene family and expand, thus improve the sensitive of lm-pcr reaction
Property and specificity.
In the inventive method, the template of described lm-pcr is the genomic DNA connecting and having linker, and linker is by manually closing
Become oligodeoxynucleotide chain BW-1 and BW-2 be prepared from, the preparation condition of linker is: take respectively 2nmolesBW-1 and
BW-2 is in the Tris solution that pH value is that 7.7 concentration are 250mM, and constant volume is 100ul, is placed in PCR instrument by mixture, 90 DEG C
5min, 60 DEG C of 5min, room temperature cools down ,-20 DEG C of Refrigerator stores.
Described connection has the genomic DNA of linker to be to extract the genomic DNA and preparation that obtain from bone-marrow-derived lymphocyte
Good linker is attached reacting gained, and reaction system is as shown in table 1, and reaction system is at 4 DEG C of reaction overnight ,-20 DEG C of refrigerators
Preserve.
Table 1: coupled reaction system
Lm-pcr can sensitive and specifically capture V κ J κ-intron-RS genetic fragment.
3 ' the ends of described specific amplification downstream primer J κ BW-LCH are containing six bases of TSACAC, these six bases and weight
Conserved sequence in group signal sequence RS is complementary, enhances susceptiveness and the specificity of lm-pcr.
Described specific amplification forward primer include V κ out and V κ in, V κ out and V κ in all with the framework of V kappa gene fragment
District 2 is complementary, and the complementary region of V κ out is positioned at the outside of V κ in, and both are degenerate primer, it is possible to in same V kappa gene family
Different V kappa gene fragments combine and expand, thus improve susceptiveness and the specificity of lm-pcr reaction.
There is the Ig kappa gene secondary rearrangement intermediate product amount contained in the genomic DNA of linker fewer owing to connecting,
Lm-pcr includes twice amplification lm-pcr1 and lm-pcr2, and the template of lm-pcr1 is the genomic DNA connecting and having linker, on
Downstream primer is respectively V κ out and J κ BW-LCH, and the template of lm-pcr2 is the amplified production of lm-pcr1, and upstream and downstream primer is respectively
Being to expand the template amount in genome for V κ in and J κ BW-LCH, lm-pcr1, it is big that lm-pcr2 is to ensure that specificity is held concurrently
Amount amplification Ig kappa gene secondary resets intermediate product.
In order to be further ensured that the specificity of lm-pcr and improve amplification efficiency, lm-pcr1 and lm-pcr2 all uses heat
Starting enzyme, and use two one-step circulation methods, reaction system and the PCR program of lm-pcr1 and lm-pcr2 are provided that
The reaction system of table 2:lm-pcr1
The reaction system of table 3:lm-pcr2
The PCR program of lm-pcr1 and lm-pcr2 is as follows:
Lm-pcr method of the present invention comprises the steps:
1, the airflow classification of bone marrow bone-marrow-derived lymphocyte.
2, the extraction of bone-marrow-derived lymphocyte genomic DNA.
3, the preparation of linker.
4, genomic DNA and the coupled reaction of linker.
5, the genomic DNA of linker is had to carry out lm-pcr1 amplification for template with connection.
6, lm-pcr2 amplification is carried out with the product of lm-pcr1 for template.
7, agarose gel electrophoresis separates lm-pcr2 product and reclaims target fragment.
8, cloning and sequencing checking target fragment.
Test kit of the present invention includes preparing the upper of oligonucleotide chain BW-1 and BW-2, lm-pcr needed for linker
Trip primer: V κ 4A out, V κ 4Ain, V κ 4C out, V κ 4C in, V κ 19A out, V κ 19Ain, V κ 23A out, V κ 23Ain, V
κ 12out, V κ 12in, V κ RF out and V κ RF in, the downstream primer J κ BW-LCH of lm-pcr.
Advantages of the present invention and beneficial effect:
Comparing more traditional method, the present invention avoids using P in Southern blot tests32Radioactivity DNA of labelling
Probe, the present invention can be reliable, is analyzed a large amount of V (D) J gene rearrangement simply and fastly, measures antibody library multiformity
Stage of development and degree, and then bone-marrow-derived lymphocyte multiformity is inferred.Therefore, The inventive process provides multiple
Apply in (such as autoimmune disease lupus erythematosus and the leukemic immunoassay of bone-marrow-derived lymphocyte) thin to B lymph in sample
The selection instrument that born of the same parents storehouse multiformity is analyzed, for the generation of research autoimmune disease, and is used for studying leukemia
Treat and immune system is rebuild, and the effect of the kinetics immune detection of detection hematopoietic stem cell transplantation.Such as, drench in B cell
In bar sample leukemia, by identifying the signal of secondary V (D) the J gene rearrangement of B cell clone, if treatment is effectively, this test resists
Igkappa combination multiformity in body storehouse increases；On the contrary, if nonreply, the multiformity of antibody library reduces.At monitoring hematopoietic stem cell
During (bone marrow) is transplanted, immune library is rebuild or treatment is effective, and secondary V (D) the J gene rearrangement that can monitor B cell clone increases, with
The Quantityanddiversity of instruction bone-marrow-derived lymphocyte increases, and shows that this therapeutic scheme is effective.
Accompanying drawing explanation
The first rearrangement fragment and lm-pcr method schematic diagram replaced reset by accompanying drawing 1 for Ig kappa gene secondary.
Accompanying drawing 2 (A) is with MRL.FASlprMouse bone marrow cells single cell suspension is experiment material, from sorting obtain pro-B,
Small pre-B and immatureB cell extract genomic DNA and obtains the rearrangement of Ig kappa gene secondary by lm-pcr method
Replace resets fragment for the first time, and purpose band is between 400-500bp.
Accompanying drawing 2 (B) is with B6.FASlprMouse bone marrow cells single cell suspension is experiment material, from sorting obtain pro-B,
Small pre-B and immatureB cell extract genomic DNA and obtains the rearrangement of Ig kappa gene secondary by lm-pcr method
Replace resets fragment for the first time, and purpose band is between 400-500bp.
Accompanying drawing 2 (C) is with C3H mouse bone marrow single cell suspension as experiment material, pro-B, the small obtained from sorting
Pre-B and immatureB cell extracts genomic DNA and is replaced by the acquisition Ig kappa gene secondary rearrangement of lm-pcr technology
Reset fragment for the first time, purpose band is between 400-500bp.
Accompanying drawing 2 (D) is with MRL.FASlprMouse bone marrow cells single cell suspension is experiment material, from sorting obtain pro-B,
Small pre-B and immatureB cell extract genomic DNA and measures depositing of genome C D14 by conventional PCR method
, with the integrity of this indicator group DNA extraction.
Accompanying drawing 3 is for deriving from MRL.FASlprOne target sequence of mice immature-B cell, is labelled with this in the drawings
The V κ of sequence, J κ, intron and RS.
Detailed description of the invention
1, with MRL.FASlpr、B6.FASlprIt is experiment material with C3H mouse bone marrow single cell suspension, utilizes fluidic cell
Sorting technology obtains the bone marrow bone-marrow-derived lymphocyte of different developmental phases.
Preparation mouse bone marrow cells single cell suspension, according to the cell category in mouse bone marrow cells single cell suspension and specificity table thereof
Face antigen, and the specific surface antigen of each stage of development of B cell, designerantibodies dyeing strategy, thus sorting obtains open country
Raw type mice (C3H) and lupus erythematosus mice (B6.FASlpr, MRL.FASlpr) pro-B (B220+CD43+IGM-IGD-),
small pre-B(B220+CD43-IGM-IGD-) and immature-B (B220+CD43-IGM+IGD-) cell.
2, pro-B, small pre-B and immature-B cell genomic dna extract to sorting obtain pro-B,
Small pre-B, immature-B cell carries out the extraction of genomic DNA, owing to the cell quantity that obtains of sorting is less and
Lm-pcr afterwards is higher to the purity requirement of template DNA, uses the QIAamp DNAMicro kit of Qiagen company.
3, the preparation of linker is carried out according to the condition preparing Linker described in foregoing invention content, by prepare
Linker respectively with the genomic DNA of pro-B, small pre-B and immature-B cell according to institute in foregoing invention content
The reaction system stated is attached reaction.
4, connecting the genomic DNA of pro-B, small pre-B and immature-B cell having linker it is respectively
Template, V κ out and J κ BW-LCH are the amplified reaction that primer carries out lm-pcr1, and reaction system is: ligated genomic
DNA100-200ng、Vκout 1.5μl、JκBW-LCH 1.5μl、GoTaqG2HotStartPolymerase 0.125μl、5×
Buffer5μl、2.5mM dNTP Mix 2μl、MgCL22 μ l and ddH2O 11 μ l, total system is 25 μ l；PCR program is set to:
95 DEG C of 2min, 95 DEG C of 3min, 95 DEG C of 45s, 68 DEG C of 3min, circulate 12 times, 72 DEG C of 10min, 4 DEG C of forever.
5, with the amplified production of lm-pcr1 as template, it is anti-that V κ in and J κ BW-LCH is that primer carries out the amplification of lm-pcr2
Should, reaction system is: lm-pcr1products 4 μ l, V κ in 3 μ l, J κ BW-LCH 3 μ l,
GoTaqG2HotStartPolymerase0.25μl、5×Buffer 10μl、2.5mM dNTP Mix 4μl、MgCL24 μ l and
ddH2O 22 μ l, total system is 50 μ l；PCR program is set to: 95 DEG C of 2min, 95 DEG C of 3min, 95 DEG C of 45s, 68 DEG C of 3min, circulation
36 times, 72 DEG C of 10min, 4 DEG C of forever.
6, lm-pcr amplified production is separated by the agarose gel electrophoresis of 1.5%, is taken pictures by agarose gel imager,
Purpose band is between 400-500bp, shown in result figure such as accompanying drawing 2 (A), accompanying drawing 2 (B) and accompanying drawing 2 (C), thin at pro-B
Born of the same parents do not occur Ig kappa gene secondary reset, so there is no band between 400-500bp, at small pre-B and
Immature-B cell all occur Ig kappa gene secondary reset, so there being purpose band between 400-500bp；Accompanying drawing 2 (A)
It is with MRL.FASlprPro-B, smallpre-B and immature-B cell genomic dna of mice is template, respectively with V κ
12out/in, V κ RFout/in and V κ 4Cout/in is as forward primer, and J κ BW-LCH is as the amplification of downstream primer；Attached
Fig. 2 (B) is with B6.FASlprPro-B, small pre-B and immature-B cell genomic dna of mice is template, respectively
Tie as the amplification of downstream primer using V κ 12out/in, V κ RFout/in and V κ 4Cout/in as forward primer, J κ BW-LCH
Really；Accompanying drawing 2 (C) is with pro-B, small pre-B and immature-B cell genomic dna of C3H mouse as template, respectively
Using V κ 4Aout/in, V κ 19Aout/in and V κ 23Aout/in as forward primer, J κ BW-LCH is as the amplification of downstream primer
Result.Accompanying drawing 2 (D) be pro-B, small pre-B and immature-B cell genomic dna of above sorting be template, with
CD14 primer by conventional PCR method amplification gene group CD14 as internal reference, it was demonstrated that genome is intact.
7, under uviol lamp, purpose band is cut and be placed in clean EP pipe, utilize DNA to reclaim test kit and reclaim it
In DNA, be connected to the DNA of recovery convert also on cloning vehicle PMD19-Tvector and to E. coli competent
Carry out liquid culture, the escherichia coli of incubated overnight are carried out the extraction of plasmid, plasmid is sent to order-checking.
8, after obtaining sequencing sequence, Vector-NTI software is utilized to find Insert Fragment, by international immunogenetics
Information system IMGT/V-QUEST and IMGT/JunctionAnalysis Insert Fragment is analyzed (http:// www.imgt.org/), finding out the V κ corresponding to target fragment, J κ, intron and RS, Fig. 3 is derived from MRL.FASlprMice
One target sequence of immature-B cell, is labelled with the V κ of this sequence, J κ, intron and RS in the drawings.
Claims (9)
1. analyzing the method that Ig kappa gene secondary resets intermediate product, the method uses lm-pcr method to capture at Ig kappa gene
The first rearrangement fragment V κ J κ-intron-RS that secondary is replaced in resetting, the method includes: the streaming of bone marrow bone-marrow-derived lymphocyte
The coupled reaction of sorting, the extraction of bone-marrow-derived lymphocyte genomic DNA, the preparation of linker, genomic DNA and linker, lm-pcr
Amplification, agarose gel electrophoresis also reclaims target fragment, cloning and sequencing checking target fragment.
Method the most according to claim 1, it is characterised in that the template of described lm-pcr is the gene connecting and having linker
Group DNA, linker are prepared from by oligodeoxynucleotide chain BW-1 and BW-2 of synthetic, the preparation condition of linker
Be: take respectively 2nmoles BW-1 and BW-2 in pH value be 7.7, concentration be 250mM Tris solution in, constant volume is 100ul, will
Mixture is placed in PCR instrument, 90 DEG C of 5min, 60 DEG C of 5min, and room temperature cools down ,-20 DEG C of Refrigerator stores.
Method the most according to claim 2, it is characterised in that described connection has the genomic DNA of linker to be by from B
Extracting the genomic DNA obtained in lymphocyte to be attached reacting gained with the linker prepared, reaction system is: gene
Group DNA 30 μ l, linker 2 μ l, 10 × ligase Buffer 4 μ l, T4DNAligase 1.5 μ l, ddH2O 2.5 μ l, altogether
40μl；Above-mentioned reaction system is at 4 DEG C of reaction overnight ,-20 DEG C of Refrigerator stores.
Method the most according to claim 1, it is characterised in that described lm-pcr can sensitive and specifically capture V κ J κ-
Intron-RS genetic fragment.
Method the most according to claim 4, it is characterised in that specific amplification downstream primer J κ BW-LCH in lm-pcr
3 ' ends are containing six bases of TSACAC, and these six bases are complementary with the conserved sequence in recombination signal sequence RS, enhance lm-
The susceptiveness of pcr and specificity；Downstream primer J κ BW-LCH sequence is: J κ BW-LCH actgacgtgg aatcgccaga
ccacast；Wherein annexing base is: S=G/C.
Method the most according to claim 5, it is characterised in that in lm-pcr specific amplification forward primer include V κ out and
V κ in, V κ out and V κ in is all complementary with the framework region 2 of V kappa gene fragment, and the complementary region of V κ out is positioned at the outside of V κ in, both
It is degenerate primer, it is possible to combine from the different V kappa gene fragments in same V kappa gene family and expand, thus improve
The susceptiveness of lm-pcr reaction and specificity；Forward primer sequence is:
Vκ4Aout caacctggct tctggagtcc c；Vκ4Ain gctcgcttca gtggcagtgg；
Vκ4C out ytggctyctg gagtccc；Vκ4C in tcgcttcagt ggcagtggg；
Vκ19Aout tggagtccct gatcgcttca c；Vκ19Ain ggcagtggat ctgggrcagat；
Vκ23Aout ctctgggatc ccctccagg；Vκ23Ain tggcagtggatcagggacag；
Vκ12out tctcctcagc tcctgrtctat；Vκ12in aggttcagtg gcagtggatc；
VκRF out ggatccactt tgcaatctgg aattcc；VκRF in tcaaggttca gtggcagtgg atc；
Wherein annexing base is: Y=C/T.
Method the most according to claim 6, it is characterised in that have the Ig contained in the genomic DNA of linker owing to connecting
It is fewer that kappa gene secondary resets intermediate product amount, and lm-pcr includes twice amplification i.e. lm-pcr1 and lm-pcr2, lm-pcr1's
Template is the genomic DNA connecting and having linker, and upstream and downstream primer is respectively V κ out and J κ BW-LCH, and the template of lm-pcr2 is
The amplified production of lm-pcr1, upstream and downstream primer is respectively V κ in and J κ BW-LCH, and lm-pcr1 is to the template amount in genome
Expanding, lm-pcr2 is to ensure that specificity to hold concurrently in a large number and expands Ig kappa gene secondary rearrangement intermediate product.
Method the most according to claim 7, it is characterised in that lm-pcr1 and lm-pcr2 all uses thermal starting enzyme, and adopts
Two one-step circulation methods, lm-pcr1 reaction system are used to be: ligated genomic DNA 100-200ng, V κ out 1.5 μ l, J κ
BW-LCH 1.5μl、GoTaqG2HotStartPolymerase 0.125μl、5×Buffer 5μl、2.5mM dNTP Mix 2
μl、MgCL22 μ l and ddH2O 11 μ l, total system is 25 μ l；PCR program is set to: 95 DEG C of 2min, 95 DEG C of 3min, 95 DEG C of 45s,
66 DEG C or 68 DEG C of 3min, circulate 12 15 times, 72 DEG C of 10min, 4 DEG C of forever；
Lm-pcr2 reaction system is: lm-pcr1products 4 μ l, V κ in 3 μ l, J κ BW-LCH 3 μ l,
GoTaqG2HotStartPolymerase 0.25μl、5×Buffer 10μl、2.5mM dNTPMix 4μl、MgCL24 μ l and
ddH2O 22 μ l, total system is 50 μ l；PCR program is set to: 95 DEG C of 2min, 95 DEG C of 3min, 95 DEG C of 45s, 66 DEG C or 68 DEG C
3min, circulates 35 38 times, 72 DEG C of 10min, 4 DEG C of forever.
9. analyzing Ig kappa gene secondary and reset a test kit for intermediate product, this test kit comprises the widow prepared needed for linker
Nucleotide chain BW-1 and BW-2, its sequence is as shown in SEQ ID NO 1 and SEQ ID NO 2；The forward primer of lm-pcr: V κ
4Aout、Vκ4Ain、Vκ4C out、Vκ4C in、Vκ19Aout、Vκ19Ain、Vκ23Aout、Vκ23Ain、Vκ12out、Vκ
12in, V κ RF out and V κ RF in, its sequence is as shown in SEQ ID NO 4-15；The downstream primer J κ BW-LCH of lm-pcr, its
Sequence is as shown in SEQ ID NO 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610571502.9A CN106191262A (en) | 2016-07-18 | 2016-07-18 | A kind of Ig kappa gene secondary of analyzing resets method and the test kit of intermediate product |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610571502.9A CN106191262A (en) | 2016-07-18 | 2016-07-18 | A kind of Ig kappa gene secondary of analyzing resets method and the test kit of intermediate product |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106191262A true CN106191262A (en) | 2016-12-07 |
Family
ID=57493519
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610571502.9A Pending CN106191262A (en) | 2016-07-18 | 2016-07-18 | A kind of Ig kappa gene secondary of analyzing resets method and the test kit of intermediate product |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106191262A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110564723A (en) * | 2018-10-23 | 2019-12-13 | 程晓东 | Amplification primer for obtaining antibody sequence and method for obtaining antibody sequence |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005054506A2 (en) * | 2003-12-02 | 2005-06-16 | Babraham Institute | Methods for detecting vdj recombination |
| CN1965089A (en) * | 2002-10-11 | 2007-05-16 | 鹿特丹伊拉兹马斯大学 | Nucleic acid amplification primers for PCR-based clonality studies |
| WO2009091879A1 (en) * | 2008-01-18 | 2009-07-23 | University Of Rochester | Chromosomal rearrangement |
-
2016
- 2016-07-18 CN CN201610571502.9A patent/CN106191262A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1965089A (en) * | 2002-10-11 | 2007-05-16 | 鹿特丹伊拉兹马斯大学 | Nucleic acid amplification primers for PCR-based clonality studies |
| WO2005054506A2 (en) * | 2003-12-02 | 2005-06-16 | Babraham Institute | Methods for detecting vdj recombination |
| WO2009091879A1 (en) * | 2008-01-18 | 2009-07-23 | University Of Rochester | Chromosomal rearrangement |
Non-Patent Citations (6)
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110564723A (en) * | 2018-10-23 | 2019-12-13 | 程晓东 | Amplification primer for obtaining antibody sequence and method for obtaining antibody sequence |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110894217B (en) | Bovine coronavirus chimeric antigen and colloidal gold immunochromatography test paper card for detecting bovine coronavirus antibody | |
| CN108761076A (en) | PEDV immune detections chromatograph test strip and its preparation method and application in milk | |
| CN104558108B (en) | The linear epitope minimum motif peptide of PPR virus N protein | |
| CN110194797A (en) | One breeder MLP protein polyclone antibody and the preparation method and application thereof | |
| CN111474367A (en) | Kit for screening and detecting African swine fever virus P30 protein monoclonal antibody and preparation method thereof | |
| CN106191262A (en) | A kind of Ig kappa gene secondary of analyzing resets method and the test kit of intermediate product | |
| CN114957454A (en) | Nano antibody and fusion protein for resisting CSFV E2 protein, and preparation method and application thereof | |
| CN112111006B (en) | Antibody for resisting bovine sarcoidosis virus, detection test paper and kit | |
| CN106706921A (en) | Nasopharyngeal carcinoma EB virus serum antibody tag detection chip and kit thereof | |
| CN107286250A (en) | A kind of brucella fusion protein, its preparation method and application | |
| Kim et al. | Development of a novel reverse transcription PCR and its application to field sample testing for feline calicivirus prevalence in healthy stray cats in Korea | |
| CN108059684A (en) | A kind of bovine viral diarrhoea recombinant protein, its preparation method and application | |
| Muir et al. | Optimisation of ex vivo memory B cell expansion/differentiation for interrogation of rare peripheral memory B cell subset responses | |
| CN103255128A (en) | Methods for preparing monoclonal antibody and hybridoma cell strain thereof by multiple antigens in immune high-flux manner | |
| CN103740649B (en) | The B cell epi-position of anti-blue tongue virus serum 16 type VP2 protein monoclonal antibody BTV16-2B4 and identification thereof and application | |
| CN106755545A (en) | The LAMP detection primer group of pat gene, kit and detection method in genetically modified crops | |
| CN101654671B (en) | Elution separation method of nucleic acid hybridization molecules | |
| CN108226491B (en) | Preparation and primary application of Listeria monocytogenes LLO colloidal gold | |
| CN114163521B (en) | Monoclonal antibody for identifying hog cholera virus 2.1 subtype virulent strain and antibody thereof | |
| CN109929936A (en) | It is a kind of detect human Y-chromosome rapid mutation str locus seat fluorescence labeling composite amplification kit and application | |
| CN108179210A (en) | For detecting the specific primer of staphylococcus aureus and probe and real-time fluorescence quantitative PCR kit | |
| CN114002426A (en) | Hog cholera virus E0 protein antibody ELISA detection kit | |
| CN104164442B (en) | Pig SAMHD1 genes, albumen, monoclonal antibody and its application | |
| CN107058226A (en) | The method of accurate fast Acquisition circulating tumor cell | |
| CN107163108B (en) | Preparation and application of antigen epitope and antibody of pseudorabies virus gE protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20161207 |