CN106167830A - General PCR primer, method and the detection kit thereof of the secondary poultry bacillus of detection - Google Patents
General PCR primer, method and the detection kit thereof of the secondary poultry bacillus of detection Download PDFInfo
- Publication number
- CN106167830A CN106167830A CN201610796413.4A CN201610796413A CN106167830A CN 106167830 A CN106167830 A CN 106167830A CN 201610796413 A CN201610796413 A CN 201610796413A CN 106167830 A CN106167830 A CN 106167830A
- Authority
- CN
- China
- Prior art keywords
- sample
- primer
- pcr
- detection
- disease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of general PCR primer, method and detection kit thereof detecting secondary poultry bacillus.This PCR primer includes forward primer 5 ' GCGTCAGTAGCACAAGCT 3 ' and downstream primer 5 ' TTTAACTGAGATTTCTACACG 3 ', and this detection kit contains above-mentioned PCR primer.The Integral Thought of the present invention is: the extraction of sample STb gene, use universal primer amplification target fragment, gel electrophoresis analysis, result judge.Test proves that the application is applicable to secondary poultry bacillus and quickly detects, and has easy and simple to handle, and versatility is good, and high specificity is highly sensitive, low cost, can carry out the feature of high-volume sample analysis simultaneously.
Description
Technical field
The present invention relates to biological technical field, be specifically related to a kind of employing Polymerase chain reaction formula reaction (PCR) technology to pair
The general PCR primer that poultry bacillus is used for quickly detecting, general PCR method and detection kit.
Background technology
Infectious coryza of chicken (Infectous Coryza, IC) is by secondary poultry bacillus (Haemophilus
Paragallinarum, Hpg) a kind of acute upper respiratory tract infectious disease of chicken of causing.Primary disease can cause Egg Production of Laying Hens after occurring
Amount declines, and Growing Chicken growth promoter is obstructed and mortality increases, and meat quality of table poultry declines, and causes the biggest economic loss.Hpg is one
The gram negative bacilli that tiny, form is relatively regular, size about 3 × 0.4-0.8um, atrichia, it is formed without spore.Virulent strain
Often there is pod membrane, but easily lose when this ability passes in vitro.Bacteria on clinical pathological material of disease and solid medium
Volume morphing is relatively regular, in obvious little shaft-like, and in liquid medium within or aged culture, it may occur that modal variation.
Traditional classifying method is the flat board agglutination of Page, and pair poultry bacillus is divided into tri-kinds of serotypes of A, B, C, but still
Have some to separate strain cannot shape.In recent years, the secondary poultry bacillus of non-tri-kinds of serotypes of A, B, C is constantly had to be separated.Blood
Solidifying element (haemagglutinin, HA) is composition important in secondary poultry bacteroides antigen, is also the protective antigen of a lot of bacterial strain
Composition.Traditional secondary poultry bacillus antibody detection method includes plate agglutination test (SPA), agar gel diffusion test (AGP), blood clotting
Inhibition tests (HI) etc., antigen detection method is then mainly bacteria distribution and cultivates.Method is simple for SPA Yu AGP, but SPA resists
Former there is self-solidifying and solidifying problem.HI method detects the rising situation of antibody titer after being usually used in IC immunity, evaluate with this
Immune effect of vaccine and chicken group's safe condition, be also used for the follow-up investigation infected, but the specific antigen being currently mainly used be only
There are two serotypes of A and C.Make a definite diagnosis to typically require and carry out bacteria distribution, be sometimes also performed to increasingly complex animal and return experiment.
Although traditional pathogen separation method is effective, play an important role in clinical diagnosis, but there is also make a definite diagnosis the longest
Substantially limitation.
Biotechnology develop rapidly the development greatly having promoted life sciences every field, the diagnosis of disease, cause of disease
Detection from cellular level enter molecular level.Polymerase chain reaction (PCR) is a kind of amplification in vitro specific gene sheet
The technology of section, the context of detection in disease has broad application prospects, and has been widely used.Polymerase chain reaction formula is reacted
(PCR) optionally genome specificity short-movie section can be amplified more than 100,000 times, significantly enhance detection
Sensitivity.1996, the pungent high labelling DNA fragment specific of Chen little Ling land used, and drawn by two couples of PCR of design on this basis
Thing establishes two kinds of PCR method.1998, Song Cheng discovery PCR diagnosed IC, after infection sampling relatively other method in 1-2 week
More sensitive, accurate, and carried out inquiring into it was confirmed ERIC-PCR cannot be carried out the typing of pathogen in terms of PCR typing.This
Outward, the most also there is the report of the multiple test methods such as DNA restriction endonuclease analysis (REA).The experimental results proves, utilizes
Specific primer carries out PCR and expands one detection method fast and accurately of can yet be regarded as IC.
The information being disclosed in this background section is merely intended to increase the understanding of the general background to the present invention, and should not
When being considered to recognize or imply in any form this information structure prior art well known to persons skilled in the art.
Summary of the invention
It is an object of the invention to provide a kind of general PCR primer detecting secondary poultry bacillus, and employ this primer
Pcr amplification reaction system, PCR detection method and detection kit, this pcr amplification reaction system, PCR detection method and detection
Test kit is easy and simple to handle, and versatility is good, and high specificity is highly sensitive, low cost, can carry out high-volume sample analysis simultaneously.
In order to realize the object of the invention, the invention provides the PCR primer of a pair detection pair poultry bacillus, draw including upstream
Thing 5 '-GCGTCAGTAGCACAAGCT-3 ' (as shown in sequence table SEQ ID No.1) and downstream primer 5 '-
TTTAACTGAGATTTCTACACG-3 ' (as shown in sequence table SEQ ID No.2).
Present invention also offers one comprise forward primer 5 '-GCGTCAGTAGCACAAGCT-3 ' and downstream primer 5 '-
The detection kit of TTTAACTGAGATTTCTACACG-3 '.
Present invention also offers the reaction system of a kind of PCR amplification detecting secondary poultry bacillus, including following components:
Wherein: forward primer is 5 '-GCGTCAGTAGCACAAGCT-3 ', downstream primer be 5 '-
TTTAACTGAGATTTCTACACG-3’.The upstream and downstream primer of 20 μMs refers to the concentration of primer self, rather than it is in PCR amplification
Final concentration in reaction system.
In the implementation of above-mentioned reaction system another possibility, described reaction system carries out the reaction of PCR amplification
Program is: 94 DEG C of 5min of denaturation；30 circulations, each circulation is 94 DEG C of 45s, 52 DEG C of 45s, 72 DEG C of 60s；After loop ends 72
DEG C extend 10min.
In the implementation of above-mentioned reaction system another possibility, bacteria suspension to be measured taken from by described sample or birds faces
Bed pathological material of disease, such as: the clinical pathological material of disease of the clinical pathological material of disease of duck, goose or chicken, preferably chicken.
In the implementation of above-mentioned reaction system another possibility, when birds clinic pathological material of disease taken from by sample, sample
Also including the step of sample preprocessing before total DNA extraction, the mode of described sample preprocessing is: take cloacal swab sample, mouth
Throat swab sample or organs and tissues sample, grind sample in sterile saline uniformly and suspendible, centrifuging and taking supernatant.
Present invention also offers a kind of PCR method detecting secondary poultry bacillus, comprise the steps:
1) extraction of sample STb gene；
2) utilize forward primer 5 '-GCGTCAGTAGCACAAGCT-3 ' and downstream primer 5 '-
TTTAACTGAGATTTCTACACG-3 ', to step 1) DNA of gained carries out PCR amplification；
3) analytical procedure 2) gained PCR primer, if amplified production comprises the fragment of 969bp, then sample is secondary poultry bar
The bacterium detection positive, otherwise for detection feminine gender.That is: need PCR primer is carried out agarose gel electrophoresis analysis, according to electrophoresis result
Can determine and amplify purpose band in sample, purpose band be the fragment of 969bp.
The guarantor of the detection different genotype pair poultry bacillus DNA polymerase gene that the present invention logs in reference to GenBank
Defending zone sequential design and screening specific detection primer, with ncbi database Plays bacterial strain Hpg-Modesto, (GenBank steps on
Record number be AF491827) hagA gene order as reference, by novel primer, expand the conserved region in Hpg hagA gene
The nucleotide sequence of sequence length about 969bp, between forward primer is corresponding to the 46bp-63bp of Hpg hagA gene, downstream is drawn
Between thing is corresponding to the 994bp-1014bp of HpghagA gene.Integral Thought is: after extracting sample DNA, utilize the application primer
Carry out polymerase chain reaction (PCR), use following response procedures: 94 DEG C of 5min of denaturation, and 30 circulations (94 DEG C of 45s, 52.2
DEG C 45s, 72 DEG C of 60s), eventually pass 72 DEG C of 10min and extend, PCR primer is carried out agarose gel electrophoresis analysis, utilizes ultraviolet
Gel imaging instrument testing goal band, if amplifying purpose band, proves the Hpg detection positive, otherwise for detection feminine gender.
Compared with prior art, there is advantages that
1) the purpose fragment expanded is positioned at the relative conserved region of the hagA gene of Hpg, and nucleotides sequence is classified as 969bp, because of
And sensitivity is good, easy to operate, all have preferably detection to the Hpg of different genotype, i.e. versatility is good；
2) use pcr amplification reaction system, PCR detection method and the detection kit of primer in the application common to other
Fowl diseases cause of disease, as bird flu virus, Avian pneumo-encephalitis virus, infectious bronchitis virus, infectious bursa of Fabricius virus, fowl exhale intestinal lonely
The testing result of virus, aviadenovirus and avian infectioun laryngo-tracheitis virus is all feminine gender, does not has cross reaction, shows to use this
In application, pcr amplification reaction system, PCR detection method and the detection kit of primer also have good specificity；
3) pcr amplification reaction system, PCR detection method and the detection kit of primer in the application is used to be applicable to support fowl
Production carries out the detection of Hpg, there is the feature of high specific, high sensitivity, high efficiency, low cost, overcome bacteria distribution
Time-consuming the longest Deng traditional detection method, and not being widely used to separating strain Serotype Identification, be unfavorable for quick diagnosis and
Determine the shortcoming separating strain serotype.This method amplifiable serum A, B, c-type and non-serum A, B, the Hpg of c-type, this primer simultaneously
Can be used in the sequencing of Hpg, understand its genotype by order-checking, to domestic separation strain from the level of hemagglutinin gene
Analyzed.Owing to domestic infective rhinitis's case has the trend increased, therefore the heaviest to the Rapid&Early diagnosis of Hpg
, the method provides technological means for the Molecule Epidemiology Investigation research carrying out nationwide Hpg, can be the inspection of hagA gene
Surveying and sequencing, the relation of the hagA genotype and serotype of analyzing IC further lays the foundation.
Accompanying drawing explanation
Fig. 1 is the electrophoresis result detecting different genotype pair poultry bacillus.Point sample order is M:DNA Maker
III；P: positive control；N: negative control；1: serum A type；2: serum Type B；3: change of serum C type；4: non-serum ABC type.
Fig. 2 is the electrophoresis result detecting other common fowl diseases cause of disease.Wherein M:DNA MakerIII；P: positive right
According to；N: negative control；1:H5 subtype avian influenza virus；2:H7 subtype avian influenza virus；3:H9 subtype avian influenza virus；4: new city
Epidemic disease poison (NDV)；5: infectious bursa of Fabricius virus (IBDV)；6: Avianreovirus (REOV)；7: aviadenovirus (FadV)；8:
Avian infectioun laryngo-tracheitis virus (ILTV).
Detailed description of the invention
Below in conjunction with the accompanying drawings, the detailed description of the invention of the present invention is described in detail, it is to be understood that the guarantor of the present invention
Scope of protecting is not limited by detailed description of the invention.
Experimental technique conventional in the following example, sees the molecular cloning that Sambrook etc. writes.The use ginseng of instrument
Illustrate according to instrumentation.In the application, each strain used in embodiment and bacterial strain are by China Agricultural University's livestock and poultry pestilence
Diagnostic center preserves and provides.
The pretreatment of embodiment 1 birds clinic pathological material of disease sample
1, experiment reagent and key instrument
Main agents: sterile saline
Key instrument: LEGEND MICRO 17R low temperature desk centrifuge, for Thermo Products；VS-1 vortex oscillation
Device is purchased from Ding Hao source Science and Technology Ltd.；TL-2010S tissue grinder oscillator is purchased from Ding Hao source Science and Technology Ltd..
2, experimental procedure
Tissue samples processes: take cloacal swab sample, oropharynx swab sample or organs and tissues sample 100mg, by sample
Being ground suspendible with dismembyator in 0.5ml sterile saline, tissue suspension 3000rpm takes supernatant and uses after being centrifuged 30min
In detection.
The extraction of embodiment 2 sample STb gene
1, experiment reagent and key instrument
Main agents: extract reagent with DNA (Vzol), for prestige lattice Lars biotechnology (Beijing) company limited product, purchase
From prestige lattice Lars biotechnology (Beijing) company limited；Dehydrated alcohol and 75% ethanol are purchased from Beijing magnificent intelligence Boke limited public affairs of skill
Department；The centrifuge tube of Rnase-free and rifle head Beijing are purchased from ocean Science and Technology Ltd. of China.
Key instrument: LEGEND MICRO 17R low temperature desk centrifuge, for Thermo Products；1300SEVIES
A2 Biohazard Safety Equipment, for Thermo Products.
2, experimental procedure
(1) Example 1 pretreatment gained birds clinic pathological material of disease sample suspensions 250 μ l, adds 800 μ lDNA Vzol, top
Falling to mix, pyrolysis product should be in the clear viscous liquids of clarification.
(2) adding dehydrated alcohol amount is 400 μ l, gently reverse mixing 5-8 time, and room temperature places 2-3min.Visible DNA is at liquid
Stroke lumps precipitation in body, room temperature 5000g is centrifuged 5min, to collect DNA, discards remaining liq.
(3) adding 1ml 75% ethanol in centrifuge tube, reverse for several times with resuspended DNA, room temperature 2000g is centrifuged 3-5min,
Absorb cleaning mixture.Repeat and washed once.
(4) carefully suck residue ethanol, do not dry DNA completely, add 100 μ l water or TE buffer, make DNA precipitation molten
Solve.Available suction nozzle slowly blows and beats hydrotropy or its self-dissolving is overnight treated in placement 4 DEG C.Deposit in 4 DEG C or-20 DEG C.
The PCR amplification of the fragment of embodiment 3 mesh
1, experiment reagent and key instrument
Main agents: DNA solution；2 × Taq PCR master mix, limited purchased from middle Ke Ruitai (Beijing) biotechnology
Company；dd H2O；Specific primer (forward primer 5 '-GCGTCAGTAGCACAAGCT-3 '；Downstream primer 5 '-
TTTAACTGAGATTTCTACACG-3’)；Marker III DNA Ladder is limited purchased from middle Ke Ruitai (Beijing) biotechnology
Company.
Key instrument: Veriti 96-Well Thermal Cycler PCR amplification instrument is Applied Biosystems
Products, purchased from the most luxuriant industrial development in science and technology company limited in Beijing；MINI-Smart small desk centrifuge is HERO company
Product；DYY-8C electrophresis apparatus is purchased from Beijing Liuyi Instrument Factory；α gel imaging instrument is purchased from Ding Hao source Science and Technology Ltd..
2, experimental procedure
Addition following ingredients in 0.2ml centrifuge tube:
Gently after mixing, react as follows: 94 DEG C of denaturations 5min；94 DEG C of 45s, 52.2 DEG C of 45s, 72 DEG C of 60s, carried out
30 circulations；Loop ends 72 DEG C extends 10min.
After PCR reaction terminates, prepare 1% agarose gel and according to being mixed into glimmering with reference to ratio with 1 × TAE electrophoretic buffer
Photoinitiator dye Gelsafe.Take 7 μ l PCR primer to add in gel pore, select suitable voltage (4V/cm-10V/cm) to carry out electrophoresis,
Electrophoresis time is 20-30min, and gel piece is placed on gel imaging instrument after terminating and observes and take pictures, according to electrophoresis result by electrophoresis
Determining and can sample amplify purpose band, if amplifying purpose band, proving the secondary poultry bacillus detection positive, no
Then for detection feminine gender.
Utilize said method secondary to different genotype (serum A type, serum Type B, change of serum C type and non-serum ABC type) respectively
Bacillus detects poultry, and result all has preferably detection, as it is shown in figure 1, show that this method has good versatility.
Embodiment 4 specific detection
1, experiment reagent and key instrument
Main agents: DNA solution；2 × Taq PCR master mix, limited purchased from middle Ke Ruitai (Beijing) biotechnology
Company；dd H2O；Specific primer (forward primer 5 '-GCGTCAGTAGCACAAGCT-3 '；Downstream primer 5 '-
TTTAACTGAGATTTCTACACG-3’)；Marker III DNA Ladder is limited purchased from middle Ke Ruitai (Beijing) biotechnology
Company.
Key instrument: Veriti 96-Well Thermal Cycler PCR amplification instrument is Applied Biosystems
Products, purchased from the most luxuriant industrial development in science and technology company limited in Beijing；MINI-Smart small desk centrifuge is HERO company
Product；DYY-8C electrophresis apparatus is purchased from Beijing Liuyi Instrument Factory；α gel imaging instrument is purchased from Ding Hao source Science and Technology Ltd..
2, experimental procedure
Addition following ingredients in 0.2ml centrifuge tube:
Gently after mixing, react as follows: 94 DEG C of denaturations 5min；94 DEG C of 45s, 52.2 DEG C of 45s, 72 DEG C of 60s, carried out
30 circulations；Loop ends 72 DEG C extends 10min.
After PCR reaction terminates, prepare 1% agarose gel and according to being mixed into glimmering with reference to ratio with 1 × TAE electrophoretic buffer
Photoinitiator dye Gelsafe.Take 7 μ l PCR primer to add in gel pore, select suitable voltage (4V/cm-10V/cm) to carry out electrophoresis,
Electrophoresis time is 20-30min, and gel piece is placed on gel imaging instrument after terminating and observes and take pictures, according to electrophoresis result by electrophoresis
Determining and can sample amplify purpose band, if amplifying purpose band, proving the secondary poultry bacillus detection positive, no
Then negative.
Utilize said method to other common fowl diseases cause of disease, such as bird flu virus, Avian pneumo-encephalitis virus, infectious bronchitis
Scorching virus, infectious bursa of Fabricius virus, Avianreovirus, aviadenovirus and avian infectioun laryngo-tracheitis virus detect,
Its result, as in figure 2 it is shown, result is all feminine gender, shows that this method has good specificity.
The embodiment 5 detection to clinical sample
The application to clinical pathological material of disease detection of the table 1PCR detection method
As can be seen from Table 1, the application sets up the PCR method for detecting secondary poultry bacillus and virus purification result or survey
Sequence result all meets, and accuracy is high, is suitable for the pathological material of disease sample standard deviation from different sampling stages and place simultaneously.
The aforementioned description to the specific illustrative embodiment of the present invention illustrates that and the purpose of illustration.These describe
It is not wishing to limit the invention to disclosed precise forms, and it will be apparent that according to above-mentioned teaching, can much change
And change.The purpose selected exemplary embodiment and describe is to explain that the certain principles of the present invention and reality thereof should
With so that those skilled in the art be capable of and utilize the present invention various different exemplary and
Various different selections and change.The scope of the present invention is intended to be limited by claims and equivalents thereof.
Claims (10)
1. the PCR primer of a pair detection pair poultry bacillus, it is characterised in that including:
Forward primer 5 '-GCGTCAGTAGCACAAGCT-3 '；And
Downstream primer 5 '-TTTAACTGAGATTTCTACACG-3 '.
2. the detection kit comprising PCR primer described in claim 1.
3. the reaction system of PCR amplification, it is characterised in that include following components:
Reaction system the most according to claim 3, it is characterised in that described reaction system carries out the reaction interval of PCR amplification
Sequence is: 94 DEG C of 5min of denaturation；30 circulations, each circulation is 94 DEG C of 45s, 52.2 DEG C of 45s, 72 DEG C of 60s；After loop ends 72
DEG C extend 10min.
Reaction system the most according to claim 3, it is characterised in that described sample takes from bacteria suspension to be measured or birds clinical disease
Material, the preferably clinical pathological material of disease of chicken, duck or goose.
Reaction system the most according to claim 3, it is characterised in that when birds clinic pathological material of disease taken from by sample, sample STb gene
Also including the step of sample preprocessing before extraction, the mode of described sample preprocessing is: take cloacal swab sample, oropharynx swab
Sample or organs and tissues sample, grind sample in sterile saline uniformly and suspendible, centrifuging and taking supernatant.
7. the general PCR method detecting secondary poultry bacillus, it is characterised in that comprise the steps:
1) bacteria suspension to be measured or the extraction of birds clinic pathological material of disease sample STb gene；
2) primer described in claim 1 is utilized, to step 1) gained DNA carries out PCR amplification；
3) analytical procedure 2) gained PCR primer, if amplified production comprises the fragment of 969bp, then sample is secondary poultry bacillus inspection
Survey the positive, otherwise for detection feminine gender.
General PCR method the most according to claim 7, it is characterised in that when sample is from birds clinic pathological material of disease, sample
Also including the step of sample preprocessing before total DNA extraction, the mode of described sample preprocessing is: take cloacal swab sample, mouth
Throat swab sample or organs and tissues sample, grind sample in sterile saline uniformly and suspendible, centrifuging and taking supernatant.
General PCR method the most according to claim 7, it is characterised in that step 2) PCR amplification reaction system be:
General PCR method the most according to claim 7, it is characterised in that step 2) response procedures of PCR amplification is: pre-
94 DEG C of 5min of degeneration；30 circulations, each circulation is 94 DEG C of 45s, 52.2 DEG C of 45s, 72 DEG C of 60s；72 DEG C of extensions after loop ends
10min。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610796413.4A CN106167830A (en) | 2016-08-31 | 2016-08-31 | General PCR primer, method and the detection kit thereof of the secondary poultry bacillus of detection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610796413.4A CN106167830A (en) | 2016-08-31 | 2016-08-31 | General PCR primer, method and the detection kit thereof of the secondary poultry bacillus of detection |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106167830A true CN106167830A (en) | 2016-11-30 |
Family
ID=57376957
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610796413.4A Pending CN106167830A (en) | 2016-08-31 | 2016-08-31 | General PCR primer, method and the detection kit thereof of the secondary poultry bacillus of detection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106167830A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115029456A (en) * | 2021-09-23 | 2022-09-09 | 北京市农林科学院 | Transverse flow detection reagent and method for rapidly and sensitively detecting avibacterium paragallinarum nucleic acid |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102899424A (en) * | 2012-10-23 | 2013-01-30 | 广西壮族自治区兽医研究所 | GeXP rapid detection kit capable of simultaneously identifying nine pathogens of chicken respiratory tract diseases |
| CN103667511A (en) * | 2013-12-30 | 2014-03-26 | 山东滨州博莱威生物技术有限公司 | Kit for PCR (Polymerase Chain Reaction) detection of haemophilus paragallinarum |
| CN105002284A (en) * | 2015-07-30 | 2015-10-28 | 山东省滨州畜牧兽医研究院 | Haemophilus paragallinarum fluorogenic quantitative PCR detection method |
| CN105695579A (en) * | 2016-03-09 | 2016-06-22 | 北京市农林科学院 | Kit for rapidly detecting Avibacterium paragallinarum |
-
2016
- 2016-08-31 CN CN201610796413.4A patent/CN106167830A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102899424A (en) * | 2012-10-23 | 2013-01-30 | 广西壮族自治区兽医研究所 | GeXP rapid detection kit capable of simultaneously identifying nine pathogens of chicken respiratory tract diseases |
| CN103667511A (en) * | 2013-12-30 | 2014-03-26 | 山东滨州博莱威生物技术有限公司 | Kit for PCR (Polymerase Chain Reaction) detection of haemophilus paragallinarum |
| CN105002284A (en) * | 2015-07-30 | 2015-10-28 | 山东省滨州畜牧兽医研究院 | Haemophilus paragallinarum fluorogenic quantitative PCR detection method |
| CN105695579A (en) * | 2016-03-09 | 2016-06-22 | 北京市农林科学院 | Kit for rapidly detecting Avibacterium paragallinarum |
Non-Patent Citations (2)
| Title |
|---|
| 张欢等: "副鸡嗜血杆菌PCR检测方法的建立", 《广东畜牧兽医科技》 * |
| 梁玉荣等: "副鸡禽杆菌分子生物学研究进展", 《安徽农业科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115029456A (en) * | 2021-09-23 | 2022-09-09 | 北京市农林科学院 | Transverse flow detection reagent and method for rapidly and sensitively detecting avibacterium paragallinarum nucleic acid |
| CN115029456B (en) * | 2021-09-23 | 2023-04-07 | 北京市农林科学院 | Transverse flow detection reagent and method for rapidly and sensitively detecting avibacterium paragallinarum nucleic acid |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105734168B (en) | A kind of 12 kinds of Respirovirus nucleic acid multiple PCR detection kits | |
| CN112094948B (en) | Application of target gene combination in African swine fever virus detection and kit | |
| CN103509882B (en) | The fluorescence quantification PCR primer of Porcine epidemic diarrhea virus and probe | |
| CN107299155A (en) | A kind of primer and probe of goose astrovirus real-time fluorescence quantitative PCR detection | |
| CN102071259B (en) | Multiplex real-time fluorescence PCR (polymerase chain reaction) detection primer and method for porcine rabies virus, porcine parvovirus and porcine circovirus type 2 | |
| CN102337351B (en) | Typing detection kit for influenza virus | |
| CN104513865B (en) | Reverse transcription PCR detects test kit and the detection method thereof of Chikungunya virus | |
| CN106399585A (en) | Universal PCR primers and method for detecting group I aviadenovirus and detection kit | |
| CN101942525B (en) | One-tube method with multiplex detection for human Influenza A and B and new Influenza A H1N1 virus and kit | |
| Alvarado et al. | Molecular characterization of avian infectious bronchitis virus strains isolated in Colombia during 2003 | |
| Wang et al. | Rapid detection of foot-and-mouth disease virus using reverse transcription recombinase polymerase amplification combined with a lateral flow dipstick | |
| CN106978511A (en) | A kind of method for detecting feline herpetovirus | |
| Xu et al. | A one-tube rapid visual CRISPR assay for the field detection of Japanese encephalitis virus | |
| CN106350609B (en) | A kind of reagent, detection method and application for vesicular stomatitis virus detection | |
| CN108315488A (en) | Primer, RT-PCR detection kit and method, application for identifying avian infectious bronchitis virus strain type | |
| CN110343784A (en) | The composition and kit of quadruple influenza nucleic acids detection based on melting curve | |
| CN103993102B (en) | A kind of detect adenovirus hominis, people's mycoplasma pneumoniae, the method for human bocavirus and test kit simultaneously | |
| CN108611438A (en) | Differentiate H9 and H10 subtype avian influenza virus duplex RT-PCR detection primers group, kit and its application simultaneously | |
| CN108411014A (en) | Differentiate the primer and probe and detection method of A types and the dual real-time fluorescence quantitative PCR of Type B ox pasteurella multocida | |
| CN106435020B (en) | For detecting the universal kit of different genotype infectious bronchitis virus | |
| CN105525038B (en) | Newcastle disease virus is strong, weak malicious one-step method real-time fluorescent RT-PCR detection kit | |
| US11098380B2 (en) | Reagent and method for rapid detection of porcine adenovirus | |
| US20230250497A1 (en) | One-step nested pcr primers set and kit modified with locked nucleic acid for detecting african swine fever virus | |
| CN106086238A (en) | The PCR detection method of porcine circovirus 2 type, the primer and detection kit | |
| CN106167830A (en) | General PCR primer, method and the detection kit thereof of the secondary poultry bacillus of detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161130 |
|
| RJ01 | Rejection of invention patent application after publication |