CN106153944A - BARD1 isoform in lung cancer and colorectal cancer, its detection method and application thereof - Google Patents

BARD1 isoform in lung cancer and colorectal cancer, its detection method and application thereof Download PDF

Info

Publication number
CN106153944A
CN106153944A CN201610347489.9A CN201610347489A CN106153944A CN 106153944 A CN106153944 A CN 106153944A CN 201610347489 A CN201610347489 A CN 201610347489A CN 106153944 A CN106153944 A CN 106153944A
Authority
CN
China
Prior art keywords
isoform
bard1
seq
antibody
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201610347489.9A
Other languages
Chinese (zh)
Other versions
CN106153944B (en
Inventor
I·艾尔明格-菲格尔
张永强
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universite de Geneve
Hopitaux Universitaires De Geneve
Original Assignee
Universite de Geneve
Hopitaux Universitaires De Geneve
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universite de Geneve, Hopitaux Universitaires De Geneve filed Critical Universite de Geneve
Publication of CN106153944A publication Critical patent/CN106153944A/en
Application granted granted Critical
Publication of CN106153944B publication Critical patent/CN106153944B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57423—Specifically defined cancers of lung
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854—Immunoglobulins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/02—Aminoacyltransferases (2.3.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y603/00—Ligases forming carbon-nitrogen bonds (6.3)
    • C12Y603/02—Acid—amino-acid ligases (peptide synthases)(6.3.2)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/564—Immunoassay; Biospecific binding assay; Materials therefor for pre-existing immune complex or autoimmune disease, i.e. systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, rheumatoid factors or complement components C1-C9
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57419—Specifically defined cancers of colon
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6884—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids from lung
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
    • G01N2333/4701—Details
    • G01N2333/4703—Regulators; Modulating activity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/91—Transferases (2.)
    • G01N2333/91045—Acyltransferases (2.3)
    • G01N2333/91074—Aminoacyltransferases (general) (2.3.2)
    • G01N2333/9108—Aminoacyltransferases (general) (2.3.2) with definite EC number (2.3.2.-)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Hematology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Plant Pathology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Rheumatology (AREA)

Abstract

The present invention relates to there is lung cancer and colorectal cancer specific novel B ARD1 isoform, its detection method/for treating and/or preventing the method for lung cancer and colorectal cancer and kit and related polypeptide, siRNA molecule, conditioning agent.

Description

BARD1 isoform in lung cancer and colorectal cancer, its detection method and application thereof
The application is divisional application, and the international application no of its original application is PCT/IB2011/053635, and international filing date is On 08 17th, 2011, China national Application No. 201180044183.1, the entrance day entering National Phase in China was 2013 03 month 14 days year, invention entitled " the BARD1 isoform in lung cancer and colorectal cancer and application thereof ".
Technical field
The present invention relates to there is lung cancer and colorectal cancer specific novel B ARD1 isoform, its detection method and use Method in treatment and/or prevention lung cancer and colorectal cancer.
Background technology
Lung cancer is the main cause of whole world cancer mortality.Treatment method outside operation be not highly effective and Resistance can be caused.Therefore, in the urgent need to understanding the teiology of lung cancer and development thereof.Colorectal cancer is another of cancer related mortality Main cause, is global the fourth-largest common cancer.Tumor stage during diagnosis is depended in the survival of colorectal cancer patients and prognosis. Colorectal cancer can be cured in early days.Unfortunately, when diagnosis, this disease of patient more than 57% is regional expands Dissipate or distal spread.Although carried out investment in managing cancer and achieved development, but for advanced colorectal cancer For patient, five-year survival rate is only 15%.
Recently, many seminar by comparing and proposing the albumen in tumour, RNA and microRNA with health tissues Drive the mechanism of lung cancer.In addition to TP53 (gene the most often lacking in lung cancer or suddenling change), it is believed that the group of p53-ARF approach Divide also disappearance, sudden change or modified in epigenetics.For colorectal cancer, challenge is to understand molecular basis, and determines Cause formation (development) and drive the factor of development.Relate to the molecular events that colorectal cancer occurs and metastatic develops Only partly classified.Nearest research has been discovered that the molecule in colorectal cancer and biochemical marker after prediction chemotherapy Fruit and to the potential application in the reaction of chemotherapy, such as MLH1, MSH2, beta-catenin and p53.
Molecule spectrogram occurs as prediction and the prognostic parameter of non-small cell lung cancer (NSCLC), including DNA damage reparation In the gene that relates to, such as ERCC1, RRM1 and BRCA1.Propose the up-regulated expression of breast cancer tumor susceptibility gene BRCA1 as right The prognosis of the reaction of NSCLC treatment and predicting marker.With regard to colorectal cancer, the research of BRCA1 is primarily limited to colorectal cancer Risk and BRCA1 sudden change.Several research attempting by BRCA1 sudden change associate with Risk of Colorectal Cancer, but do not have any clearly Conclusion.Based on currently limited available evidence, it should think that BRCA carriers of mutation has higher rate colorectal cancer wind Danger.But the concrete effect that in colorectal cancer, BRCA1 expresses is unclear.
BRCA1 expresses in many hyperplastic tissues and serves as tumour in DNA repairs approach and the cell cycle controls and presses down Preparation.BRCA1 protein stability and function depend on its phase interaction to BARD1 (the related RING domain protein 1 of BRCA1) With.BRCA1-BARD1 heterodimer has E3 ubiquitin ligase activity, from there through stablizing of the ubiquitination crucial target protein of control Property.BARD1 also participates in p53-dependence apoptosis, and in most of lung cancer, p53-dependence apoptosis is defective.BARD1 is stable P53 and its phosphorylation of promotion, p53 plays, in the signal causing apoptosis conducts, the expression that correct function needs BARD1.Therefore, BARD1 serves a dual purpose in tumor suppression, simultaneously the binding partners for BRCA1 and p53.Several researchs are it has been shown that BARD1 Raise during mitosis, carry out transcribing by E2F and carry out posttranslational modification by phosphorylation, and it is essential that It is important for mitosis.According to other research, BRCA1 and BARD1 shows (generally non-with heredity with hMSH2 The related gene of polyp characteristic of disease colorectal cancer (HNPCC)) interact, the sudden change of hMSH2 seem to account for HNPCC about 30～ 40%.The defect of BRCA1-hMSH2 signal conductive process causes increasing swollen neoplastic neurological susceptibility.
WO98/12327 (Board of Regents, University of Texas's system) disclose based on breast cancer proteins The Several gene identifying in the selective mechanisms that BRCA1 combines.One in these genes is referred to as BARD1, is mutual with BRCA1 The RING albumen of effect, and contemplates its application in various cancer dependent diagnostics and treatment method, particularly with breast cancer, Application in the oophoroma diagnosis related with the cancer of the uterus and treatment method.
WO2008/119802 (University of Geneva) discloses in gynecological cancer, and the BARD1 isoform with disappearance crosses table Reach, navigate to cytoplasm singularly, and their expression is related to the prognosis mala of breast cancer and oophoroma.These isoforms Structural analysis shows, they lack and BRCA1 interaction or apoptosis-induced region.These isoforms have for gynecological cancer Have specific, be named as α, β, η, γ, ε,δ and θ.
Seriousness and the property of can not be cured due to lung cancer and colorectal cancer, it is still desirable to exploitation can differentiate having of these cancers Effect detection method, and need effective ways and the composition developed treatment further or prevent these cancers.Subject matter is, Not yet develop effective ways or the strategy solving this problem up to now.
Content of the invention
The present invention provide a kind of for detection available from the biological sample of study subject, spy is had to lung cancer and colorectal cancer The method of existence of the BARD1 isoform of the opposite sex, described method includes detecting in described sample and has lung cancer and colorectal cancer The step of specific at least one BARD1 isoform, described at least one BARD1 isoform is selected from and comprises as follows drum Group:
Isoform π, isoform π comprise SEQ ID NO:1, its bioactive fragment or have at least with SEQ ID NO:1 The sequence of 95% homology, and
Isoform κ, isoform κ comprise SEQ ID NO:2, its bioactive fragment or have at least with SEQ ID NO:2 The sequence of 95% homology,
Wherein, described in the sample available from described study subject, specific BARD1 is had to lung cancer and colorectal cancer The existence of isoform is that described study subject suffers from lung cancer and/or colorectal cancer, the risk increasing suffering from lung cancer and/or colorectal cancer There is after adding and/or treat lung cancer and/or colorectal cancer the mark of the risk of recurrence.
The present invention also provides a kind of separation being used as biomarker in the method described in claim 1～6 and/or pure Change polypeptide, the polypeptide of described separation and/or purifying comprise SEQ ID NO:1, its bioactive fragment or with SEQ ID NO:1 There is the sequence of at least 95% homology；It a kind of in the method described in claim 1～6, is used as biomarker with providing Separate and/or purify polypeptide, the polypeptide of described separation and/or purifying comprise SEQ ID NO:2, its bioactive fragment or with SEQ ID NO:2 has the sequence of at least 95% homology.
The present invention another object is that the peptide in the group comprising SEQ ID NO:13～80, and described peptide is for the present invention's The method of the existence of detection BARD1 isoform.
It is another object of the present invention to available from the sample of study subject, spy is had to lung cancer and colorectal cancer for detection The kit of the existence of the BARD1 isoform of the opposite sex, described kit comprises:
At least one polynucleotide primers or probe, wherein said polynucleotide primers or probe at least one institute to coding The polynucleotides stating BARD1 isoform have specifically, described BARD1 isoform comprise selected from comprise SEQ ID NO:1-7, 105-106, its bioactive fragment and/or there is the sequence of at least 95% homology with SEQ ID NO:1-7,105-106 Amino acid sequence in group, and/or
The antibody combining from the different epitope specificity of at least one described BARD1 isoform or the combination of its fragment, institute State BARD1 isoform comprise selected from comprise SEQ ID NO:1-7,105-106, its bioactive fragment or with SEQ ID NO:1- 7th, the amino acid sequence in the group of the sequence that 105-106 has at least 95% homology, and/or
At least one peptide selected from the group comprising SEQ ID NO:13～80.
The invention still further relates to a kind of method distinguishing lung cancer with colorectal cancer with gynecological cancer mutually, described method includes inspection Survey available from the step to lung cancer and colorectal cancer with specific BARD1 isoform at least one in the biological sample of study subject Suddenly, described BARD1 isoform is selected from the group comprising as follows drum:
The isoform π that comprises SEQ ID NO:1, its bioactive fragment or with SEQ ID NO:1 have at least 95% with The sequence of source property, and
The isoform κ that comprises SEQ ID NO:2, its bioactive fragment or with SEQ ID NO:2 have at least 95% with The sequence of source property,
The wherein said existence to lung cancer and colorectal cancer with specific BARD1 isoform is lung cancer and/or knot is straight The mark of intestinal cancer.
Moreover, it relates to the antibody using in the method for the treatment of and/or prevention lung cancer and colorectal cancer, restructuring The biologically active conditioning agent of the BARD1 isoform of siRNA and the present invention.
Brief description
Fig. 1 shows that the BARD1 in NSCLC expresses.With BARD1 antibody N19, C20, PVC, WFS and BRCA1 to 100 NSCLC case carries out immunohistochemical analysis.(A) there is above-mentioned protein motif and refer to that (RING), ankyrin repeat as RING And the schematically showing of BARD1 extron (1-11) of BRCT domain (ANK).Indicate epi-position general of various antibody recognition Position (N19, PVC, WFS, C20).(B-D) example of the immunohistochemical staining of use BARD1 antibody and BRCA1 antibody. BARD1 N19 and C20 demonstrates that cytoplasmic granule shape dyes, and is sometimes positioned at identical cell or region altogether.BARD1 PVC and WFS dyeing is cytoplasmic dyeing or diffusivity nucleus and the cytoplasmic dyeing of diffusivity.BRCA1 dyeing and BARD1 N19 dyeing positioning (B) altogether.Show not by or the example that almost do not dyeed by PVC and WFS (C) and dyeed (D) by N19 and C20 Negligible example.Designate engineer's scale (upper figure=200 μm；Figure below=100 μm).(E) observe with all four The dyeing of 73 in 100 NSCLC cases of N19, PVC, WFS and C20 detection."+", represents positive staining, and "-" represents cloudy Property dyeing.The positive staining with all four antibody is frequency expression pattern the highest.(F) BARD1 N19, PVC, WFS and C20 dyeing in contrast relatively.BARD1 N19 and C20 and PVC and WFS strong correlation.Between N19 and PVC, N19 and WFS it Between, between C20 and PVC, observe between C20 and WFS weak related or uncorrelated.
Fig. 2 show comparison that BARD1 in tumor tissues and peritumoral tissues expresses and with Clinical symptoms Correlation.(A) BARD1 in the tumor tissues of 20 (10 male sex and 10 women) NSCLC patients and peritumoral tissues The comparison of N19, BARD1 C20 and BRCA1 dyeing.Compared with " normally " tissue, the dyeing of all antibody in tumor tissues increases. (B) test b ARD1 N19, BARD1 C20 and BRCA1 dye in the tumor tissues of 10 women and 10 male sex NSCLC patients Look.Compared with male patient, the dyeing of all antibody in the tumour of female patient increases.(C) in 100 NSCLC cases BARD antibody staining and the comparison of tumor type.Positive staining is in non-gland cancer (AC) (including squamous cell carcinoma and large cell carcinoma) Middle higher than at gland cancer medium frequency.PVC and WFS dyeing increase has significance,statistical.(D-E) BARD1 expresses and deposits with patient The correlation lived.(D) combination according to the dyeing of 4 kinds of antibody positives and less than 4 kinds of antibody positives dyeing as defined in Fig. 1 E The Kaplan-Meyer of the anosis survival (DFS) that combination is carried out analyzes.(E) according to 4 kinds of antibody positive dyes as defined in Fig. 1 E The combination of look and the Kaplan-Meyer analysis of the total survival (OS) carrying out less than the combination of 4 kinds of antibody positive dyeing.
Fig. 3 shows the time course that BARD1 isoform is expressed in the experimental mouse model induction of lung cancer.(A) warp BARD1 in the normal lung tissue of the morphology (normally) of the animal that urethane (urethane) is processed expresses.When 16 weeks (wk) BARD1 PVC and WFS epi-position detect in some II type alveolar epithelial cells, but do not detect in I type alveolar epithelial cells Go out.When 24 weeks and 32 weeks, all epi-positions were all expressed in II type and I type alveolar epithelial cells, and within thoughtful 32 weeks, expressed from 24 Raise.C20 dyeing was contrary with other: dyeed by force when 16 weeks, the weak dyeing when 24 weeks, was almost feminine gender when 32 weeks.(B) BARD1 in tumour expresses.In tumor area, from 16 thoughtful 32 weeks BARD1 PVC, particularly WFS up-regulateds, and thoughtful from 16 32 weeks C20 express and lower.(C-D) expression of the BARD1 epi-position in normal (C) tissue and tumour (D) tissue of three mouse Pattern.Marked dyeing fraction, (0 represents that negative staining, 1～4 expression have the cell of positive staining to positive cell percentage Intensity and quantity increase).
Fig. 4 shows that human lung cancer organizes and the expression of BARD1 transcript in peritumoral tissues and structure.(A-D) use The primer expanding whole BARD1 code area (one or more) carries out RT-PCR, and this code area comprises exons 1-4 or 1-6.Expand Increase GAPDH as comparison RT-PCR.Molecular dimension mark (M) is shown in left side.The FL BARD1 of presumption is same with different montages Drum is shown in right side.(A) BARD1RNA in normal lung tissue expresses.To the individual lung bioplsy tissue with optimum lung disease RT-PCR (seeing method part) the display BARD1 carrying out expresses not to be existed in most samples, and 5 in 8 cases The amplification of each isoform (γ, δ, η) of individual middle display.(B) use the forward primer in exons 1, at extron 11 or extron 4 In reverse primer amplification that FL BARD1 and the isoform truncating are carried out.For the tissue from masculinity and femininity patient, Show the example of (N) tissue and tumour (T) tissue around paired normal tumour.The FL BARD1 of presumption and different montages Isoform is shown in right side.Normal structure and the isoform of expression of tumor tissue model identical.(C) exons 1～6 are expanded To distinguish FL BARD1, β and novel isoform κ and π.Isoform π is specific expressed in tumour, and not table in the normal tissue Reach or weak expression.(D) in majority of cases, it is found that the expression of the estrogen receptor alpha being determined by RT-PCR.The male sex and female The normal specimens of property with tumor sample finds similar expression.(E) the specifically new shape of known BARD1 isoform and lung cancer The structure of isoform κ and π of formula.. indicate schematic extron (1～11) structure of FL BARD1 and protein specificity (RING, ANK, BRCT) and nuclear localization signal (NLS), and the position of primer.Lower section illustrates the schematically supposition egg of isoform with grey White structure, illustrates non coding exon with white, and illustrates selective opening reading frame (β, γ and η) with light gray point (point). Showing novel isoform κ, the translation starting point (ATG) that its exon 3 lacks and estimates is in extron 4.By novel same work Type π is appointed as having the disappearance in extron 4, it is indicated that navigate to the known BARD1 sudden change in this region and polymorphism.Same work The appointment title of type is shown in left side, and size (amino acid) and molecular weight (MW) are shown in right side.
Fig. 5 show in the normal peritumoral tissues of the morphology (left side) of women and male sex NSCLC patient and The comparison that BARD1, BRCA1 and Aurora B in tumor tissues (right side) expresses.Utilize BARD1 (N19 and C20) and C end End antibody p8, BRCA1 and Aurora B antibody staining carries out immunohistochemical analysis.Symbol n=nuclear targeting.
Fig. 6 show extron 4 in alternative splicing and/or transcription initiation.(A) with extron (Ex) the 4th, extron 5 The BARD1's expanding with the forward primer (be positioned at left side) in exon 6 and the reverse primer in exons 11 (on the right side of being positioned at) The figure of various fragments.The expected size of the position of primer and amplified band is indicated in parentheses (bp).(B) show with shown in A Primer is to around human lung cancer's tissue (T) and neighbouring normal tumour of male sex's (left figure) and women (right figure) NSCLC patient The amplification that BARD1 transcript in tissue (N) is carried out.Note the amplification carrying out with the primer in extron 4 in different samples It is variable, but all samples can be expanded by the primer in extron 5 or exon 6.BARD1 mRNA and albumen The change expressed may be owing to the alternative splicing of this region transcription or different initial.
Fig. 7 shows BARD1 in the tumor tissues (tumour) and peritumoral tissues (normally) of women and male patient The comparison of mRNA isoform expression and correlation.To tissue sample normal on 20 pairs of tumour/morphology (include 10 male sex and 10 women) FL BARD1 and BARD1 isoform carry out marking and being illustrated.With ImageJ software, expression is carried out quantitatively (seeing method part).Result is shown in FIG as the mean value ± SE (standard error) of value.(A) peritumoral tissues and tumour The comparison of FL BARD1 and isoform in tissue.In addition to isoform β and κ, all isoforms raise in tumour, have system Conspicuousness learned by meter.(B-C) in the male sex (B) and women (C), FL BARD1 and BARD1 isoform all ratios in tumor tissues exist In peritumoral tissues more rich.(D/E) tumor tissues (D) neutralizes BARD1 expression between masculinity and femininity in normal structure (E) Comparison.In tumor tissues and peritumoral tissues, BARD1 isoform β and κ in the tissue from the male sex than from women Tissue in express more.This has significance,statistical.In tumor tissues and peritumoral tissues, FL BARD1 and BARD1 isoform γ, ε and η may be more more than expressing in the tissue from the male sex in the tissue from women, but this does not has Significance,statistical.(F) in young (<60 years old) and 60 years old old age (>) comparison of FL BARD1 and isoform in patient's group.FL BARD1 and isoform γ raises in young (< 60 years old) patient.This has significance,statistical.
Fig. 8 shows the example of the immunohistochemical analysis that BARD1 and BRCA1 expresses in colorectal cancer.Pass through BARD1 Antibody N19, C20, PVC, WFS and BRCA1 sample to 148 colorectal cancer cases has carried out immunohistochemical analysis.Will All samples is expressed as micro-array tissue, and each case is quadruplicate.After Immunohistochemical detection 145 samples for point Analysis is qualified.
(A) frequency of positive staining case of BRCA1 antibody for BARD1.The positive of each in four antibody Rate of dyeing is variable.BARD1 N19 and C20 dyeing and BRCA1 dyeing frequency are relatively low.Most colorectal cancer cases are seen Observe BARD1 PVC and WFS positive staining.(B) the BARD1 expression pattern in colorectal cancer.Based on each case the positive (+) Dyeing and negative (-) dyeing, with 4 kinds of BARD1 antibody acquisition expression patterns.PVC and WFS positive staining, but N19 and C20 is negative Dyeing is frequency expression pattern the highest, and secondly, N19 is negative but PVC, WFS and C20 are positive in " all four antibody positive " dyeing Dyeing is the high expression pattern of frequency the 3rd observed.(C-F) immuning tissue's dye of BARD1 antibody and BRCA1 antibody is used The example of look.BARD1 N19 and C20 demonstrates that cytoplasmic granule shape dyes, and is positioned at identical cell and region altogether. BARD1 PVC and WFS dyeing is that diffusivity is cytoplasmic.BRCA1 dyeing is all graininess in cytoplasm and nucleus.Illustrate Following instance: use the positive staining (C) of BARD1 antibody and BRCA1 antibody, use that N-19's and C20 (D) is negligible Dyeing (D), use all four BARD1 antibody positive staining (E) and use N19 (F) negative staining.Designate ratio Chi (upper figure=200 μm；Figure below=50 μm).
Fig. 9 shows the correlation between for the different antibodies dyeing of BARD1 and BRCA1 in colorectal cancer.(A) The correlation of BARD1 N19, PVC, WFS and C20 dyeing.BARD1 N19 and C20 dyes strong correlation, PVC and WFS, PVC and C20 And WFS and C20 is weak related.Do not observe related between N19 and PVC and between N19 and WFS.(B) BRCA1 and BARD1 The correlation of antibody staining.BRCA1 dyeing is not related to any dyeing of four kinds of BARD1 antibody.
Figure 10 shows that the different epi-position of BARD1 and BRCA1 expresses the correlation with the clinical variable in colorectal cancer. BARD1 N19 positive staining is at women medium frequency higher (P=0.014) (A).Different antibodies BARD1 and BRCA1 dyeing with Tumor tissue pathology's rank (rank) (B), tumor size or neighbouring tissue infiltration (tumour) (C), lymph node involvement (knot) (D), correlation is not found between far-end transfer (transfer) (E) and tumor stage (stage) (F).Obtain P value by chi-square criterion.
Figure 11 shows expression and the knot of BARD1 transcript in Colorectal Carcinoma (T) and normal peritumoral tissues (N) Structure.(A) reverse primer in the forward primer in exons 1 and exons 11 (Ex 1-11) or extron 4 (Ex 1-4) is used The amplification that FL BARD1 and/or the isoform truncating are carried out.As an example, 5 male patients and 5 female patients are shown Paired peritumoral tissues and tumor tissues.Identical sample is illustrated that glyceraldehyde 3 phosphate dehydrogenase is expressed as mark Quasi-thing.Molecular marker is shown in left side (M).The FL BARD1 of presumption and the isoform truncating are shown in right side.Peritumoral tissues Isoform with expression of tumor tissue different mode: peritumoral tissues is lower than the expression frequency in tumor tissues.Also at NSCLC In two kinds of novel isoforms identifying, κ and π, express in colorectal cancer.(B) estrogen receptor alpha (ER α) in same sample Amplification, use MCF-7 as positive control (right side).In colorectal carcinoma, no matter all in the tumour of the male sex or women Enclose in sample or tumor sample does not all observe ER alpha expression.
Figure 12 (just shows around the tumor tissues (tumour) and tumour of the masculinity and femininity patient suffering from colorectal cancer Often) the comparison that the BARD1 mRNA isoform in tissue is expressed.20 pairs of tumor tissues/peritumoral tissues sample to colorectal cancer The FL BARD1 of product (including 10 male sex and 10 women) and BARD1 isoform carry out marking and being illustrated.Based on each Presence or absence of in sample or tumor sample (A) around tumour, and the existence or not of the expression of each isoform (B, C, D) Exist, expression is carried out quantitatively.(A) based on the existence of any type of BARD1 with do not exist, to peritumoral tissues and tumour Tissue (includes in male sample, women sample and in associating sample) comparison that BARD1 expresses.No matter at women (P= 0.0010), in or in the male sex (P=0.0679), BARD1 expresses in the tissue from tumour than around tumour Tissue in more rich and frequency higher (P=0.0003).(B) the FL BARD1 in peritumoral tissues and tumor tissues and with The comparison that drum is expressed.In tumour, form of ownership all raises, and has significance,statistical (for form of ownership P < 0.05).(C/ D) comparison that the FL BARD1 in the colorectal carcinoma from masculinity and femininity and isoform are expressed.No matter group around tumour Knitting in (C) or in tumor tissues (D), FL BARD1 is similar with expressing in the tissue from masculinity and femininity of isoform (for form of ownership P < 0.05).Obtain P value by chi-square criterion.
Figure 13 shows the correlation of FL BARD1 and isoform mrna expression and the clinicopathological variables in colorectal cancer. (A) young (<60 years old) and old (>60 years old) comparison of FL BARD1 and isoform expression in patient.FL BARD1 and except with All isoforms outside drum β, raise more in gerontal patient than in young patient.Specifically, isoformδ and The expression of π and gerontal patient's significant correlation (P < 0.01).(B-E) primary tumo(u)r and lymph node status and tumor stage are passed through And rank, compare FL BARD1 and isoform is expressed.BARD1 isoform κ expresses tumour or neighbouring tissue with large-size Infiltration (B), lymph node accumulation (C) and late period (III phase and IV phase) (D) significant correlation.Express and swollen at BARD1 isoform Correlation (E) is not found between tumor tissue pathology rank.Obtain P value by chi-square criterion.The comparison of not shown P > 0.05.
Figure 14 shows the reality for the ELISA test to the BARD1 isoform detection of specific antibody in blood or serum Example.
Figure 15 shows with being positioned at ATG same with what the primer at disappearance connection (deletion junction) place in π was carried out The amplification of drum π.Identify and exon 2 additionally lacked the second isoform causing, π '.
Figure 16 shows the Western blotting carrying out HeLa, MCF7, RPE1 and NLF cell with anti-Bard1 antibody.Ab Bethyl BL518 (BL) identifies the epi-position of coding in middle part extron 4.For by the β-specific selective in exons 1 The epi-position of ORF coding produces Ab PGP.Identify BARD1 isoform β and BARD1 isoform β-d-5 (β ') and BARD1 isoform η。
Figure 17 shows the siRNA suppression of BARD1 isoform.A) position of siRNA target sequence.Use two in extron 4 Individual siRNA, K401 and K423.K401 is positioned at the disappearance of isoform π, and K423 is in the upstream of disappearance.B-C) K401 ratio K423 pair The effect of growth is little.B) siRNA expresses to express with GFP and combines.Many positive cells grow in the cell of expressing K 401, few Amount grows in the cell of expressing K 423.C) growth curve confirms, K423 Cell growth inhibition owns with the targeting reported before The K78 of the BARD1 of form is equally effective.
Figure 18 shows that microRNA affects BARD1 and BARD1 isoform and expresses.RT-PCR display form of ownership BARD1 all by MiR-203 slightly suppresses.Western blotting shows the strong inhibition to FL, β and π for the miR-203 process LAN.
Detailed description of the invention
Although can will be used for practice or the test of the present invention with similar or equivalent method described herein and material, but properly Method and material be described as follows.It is expressly incorporated herein by reference all publications, patent application, patent and other references mentioned The full content of document.Before providing publication as herein described and application to be only used to the submission day being disclosed in the application Content.Must not be construed as an admission that owing to invention before causes the present invention to be not eligible for early than this type of publication herein.Additionally, Material, method and example are merely illustrative, and are not intended to limit.
It in the case of contradiction, is as the criterion with this specification (including definition).
Unless otherwise defined, all scientific and technical terminologies used herein have usual with theme those skilled in the art herein The identical implication of implication understanding.As used herein, defined below for the ease of understanding that the present invention provides.
Term "comprising" generally uses with the meaning including, say, that allow there is one or more features or composition.
As used by description and claims, " a ", " an " and " the " of singulative includes multiple referents, unless Context is clearly made that different regulation.Such as BARD1 isoform refers at least one BARD1 isoform.
Term " isoform " as used herein is the one in several multi-forms of same albumen, such as the present invention BARD1 albumen.The multi-form of the albumen such as BARD1, can produce from related gene, or can be by same gene by choosing The montage of selecting property and produce.A large amount of isoforms can be by SNP or SNP (less between the allele of same gene Genetic differences) cause.These occur in the specific individual nucleotide positions of gene.
Term " study subject " as used herein or " patient " are to it is known in the art that and herein for referring to lactation Animal, most preferably people.In some embodiments, described study subject is to need the study subject for the treatment of or suffer from lung cancer And/or the study subject of colorectal cancer.But, in other embodiments, described study subject can be not yet to develop lung The normal study subject of cancer and/or colorectal cancer symptom or carried out the tested of the treatment for lung cancer and/or colorectal cancer Object.This term does not indicate specific age or sex.Growing up or study subject childhood therefore, it is intended that cover, no matter the male sex goes back It is women.
As used herein, term " peptide ", " albumen ", " polypeptide " and " (peptidic) of peptide " can mutually alternatively make With referring to that the peptide bond between the alpha-amido by adjacent residues and carboxyl is connected to a series of amino acid of other amino acid residual Base.
Contrary with desired, applicant astoundingly from 100 case non-small cell lung cancers (NSCLC) and Each sample of the patient group of 165 case colorectal cancers identifies except known isoform α, β, η, γ, ε,Outside δ and θ Two other new BARD1 isoforms.Another wonderful feature is that isoform α is from 100 cases NSCLC and 165 cases Each sample of the patient group of colorectal cancer does not exists.By named κ and π of these novel isoforms.Actually BARD1 Isoform expresses similar pattern in NSCLC with the tumor tissues of colorectal cancer, and they all express two kinds of novel isoform κ And π, isoform κ and π is different from the BARD1 isoform (WO2008/119802) identifying in gynecological cancer.This discovery shows The unconventionality expression of BARD1 is probably difference in female sex hormone dependent tumors tissue and non-female sex hormone dependent tumors tissue 's.
Novel isoform κ, with the disappearance of exon 3, translates from exon 2 in being not frame extron 4, but Translation can start in extron 4.The antibody response of the protein product of gained is similar to isoform β.
The disappearance of the 408bp with coding the 301st～436 amino acids in extron 4 for the novel isoform π.Same work The translation of type π can produce reacts with antibody PVC and WFS but lacks the albumen (Fig. 4 C, E and Fig. 6) of important NLS.Isoform π Being derived from new splicing mechanism, this splicing mechanism produces the excalation of extron 4, but retains exons 1-3 and extron 4 Beginning, therefore retains BRCA1 associativity RING finger domain.Isoform π retains opening of exons 1-3 and extron 4 Initial portion, therefore remains the epi-position being identified by PVC and WFS, and described epi-position is the table not found in any other isoform The combination of position.Isoform π can be with antibody PVC and WFS detection, and these antibody demonstrate that in mouse lung neoplasm in late period dyeing increases Add.Therefore, isoform π can be the carcinogenic driving thing of tumor development in NSCLC.The excalation of isoform π Exon 4 can Can be important region, because it has several types of cancers related mutation and NLS (Fig. 4 E), this possible explanation PVC and WFS dyeing Cytoplasm positions.Abnormal inner cellular localization may affect protein modified, such as phosphorylation and protein-protein interaction.
Isoform π seems particular importance for lung cancer, this is because its be unique notable in tumor tissues on be in harmonious proportion Peritumoral tissues lacks or the isoform of only weak expression, and all other BARD1 isoform is in tumor tissues and tumour Surrounding tissue is all similarly expressed (Fig. 4 B；Fig. 7).The excalation of extron 4 causes the forfeiture of NLS important on BARD1, This possible explanation cytoplasm positions.
The other isoform π ' being caused by the disappearance of exon 2, with isoform π table altogether in lung cancer and colorectal cancer Reach.
Applicant proves, FLBARD1 (total length BARD1) and montage isoform table in tumor tissues and peritumoral tissues Reach, and tumour may be facilitated to occur and development.But, isoform π is specific expressed in tumour, may participate in carcinogenic Exhibition.FL BARD1 expresses in mRNA level in-site, but there is not the protein translation of FL BARD1.Therefore on protein level, BARD1 Isoform, rather than FL BARD1, table in each sample from 100 NSCLC and 165 colorectal cancer patients groups Reach.Isoform is expressed and positioning is uncorrelated to BRCA1, shows that the E3 ubiquitin ligase function of BRCA1-BARD1 heterodimer exists In two kinds of cancer impaired.The stability of BRCA1 albumen and positioning depend heavily on BARD1.Cause BRCA1-BARD1 The disappearance lacking the FL BARD1 that tumor suppression function is lost causes genomic instability and the resistance to apoptosis.Except FL Outside this effect of the forfeiture of BARD1, the otherness montage BARD1 isoform of process LAN is probably swollen neoplastic driving Thing.
Alternative splicing is the phenomenon that it is frequently observed that in lung cancer, and is all verified for many control albumen. Montage isoform can translate into the paraprotein isoform with antagonism function.For two kinds of BARD1 splice variants, BARD1 β With BARD1 δ, this has been verified, and BARD1 β and BARD1 δ is respectively by stable Aurora B with act on Er α to FL BARD1 function plays antagonism.Therefore, the BARD1 isoform in NSCLC is expressed and may be not only onlooker, it is also possible to swollen Neoplastic driver.In fact, respectively by antibody PVC and WFS identify navigate to exon 3 and 4 the expression of epi-position exist Induction of lung cancer mouse model lung neoplasm the invasion and attack stage in increase.
The isoform of discovery in gynecological cancer also expressed by all of neoplasmic tissue sample and peritumoral tissues sample；Tool It is isoform δ for body.BARD1 isoform δ combines and stablizes ER α, contrary with the function of BRCA1-BARD1 heterodimer.By In ER α also in all samples express, BARD1 isoform may be raised by estrogen and be participated in lung cancer female swash Element signal conduction.Therefore, several BARD1 isoforms seem to be formed related to cancer.
Owing to cancer cell needs BARD1 or BARD1 isoform to breed, the BARD1 isoform in NSCLC and colorectal cancer Onlooker is not only in expression, it is also possible to swell neoplastic driver.Particularly expression and localization is to the epi-position of exon 3 and 4 Isoform, it appears that all related to the shorter survival in NSCLC and colorectal cancer.These epi-positions are in the aggressive of mice lung cancer model Tumour raises.The BARD1 isoform expressed in NSCLC and colorectal cancer is derived from alternative splicing.For example, montage isoform energy Enough translate into the paraprotein isoform with antagonism function.
ER α and isoform δ all expressed by all of lung neoplasm sample and peritumoral tissues sample.But, straight at series knot Intestinal cancer case does not exist ER α mrna expression, and does not finds differences between the expression of BARD1 isoform and sex.
But, it is therefore of interest to the female gender significant correlation (P of high-frequency N19 positive staining and colorectal cancer =0.014), and the expression of this discovery BARD1 N end epi-position related to female gender with in NSCLC consistent (statistics shows Work property is critical, P=0.051).In NSCLC, women observes the high mRNA level in-site of BARD1 isoform γ, ε and η Express, and in the male sex isoform β and κ process LAN.Isoform γ and ε is expressed and can be detected by BARD1 N19, and isoform β, κ and η can not.Therefore, the protein level that BARD1 isoform is expressed is consistent with mRNA level in-site, shows sex-specific BARD1 isoform is expressed in these cancers.
BARD1 isoform NSCLC and colorectal cancer tumor tissues from peritumoral tissues shows different tables Expression patterns.In NSCLC, all isoforms in addition to isoform π are expressed and in tumor tissues in peritumoral tissues Only slightly increase, but in the control tissue available from optimum lung disease, observe that any type of BARD1 expresses less or not table Reach.On the contrary, in colorectal cancer, the frequency that BARD1 isoform is expressed in tumor tissues is higher, but in peritumoral tissues Do not express or express less.This result can by according to different cell types to outside stimulus or some pathological conditions and/ Or between lung tissue and colorectal carcinoma the response of the difference of ER alpha expression and diversity regulation alternative splicing is explained.
Reduce related with PVC antibody or WFS antibody or the two positive staining obtaining to the survival of NSCLC patient.But, The positive staining pattern of four kinds of antibody and the longer significant correlation of survival in colorectal cancer, for N19 positive staining situation be also So；And PVC and WFS positive staining pattern, rather than the positive staining of each of which, the shorter strong correlation with survival.It is true that Different expression patterns not only reflects the expression of different BARD1 isoform, also reflects the expression of the combination of isoform.According to The correlation of the different epi-positions that BARD1 expresses, it appears that observe the N end in several BARD1 isoform: NSCLC and colorectal cancer Other forms lost with N end in C end clipped form and internal deletions, and colorectal cancer.Four kinds of antibody positive dyes The expression pattern of look does not shows the expression of isoform π, but expresses while may reflect the different isoform of BARD1.
It is true that expressing of BARD1 isoform π is consistent with the epi-position being identified by PVC and WFS, described epi-position is not in office The combination of the epi-position what finding in its isoform.In fact, PVC and WFS dyeing is cytoplasmic dyeing.The table of PVC and WFS Reaching substantially related to the poor prognosis of NSCLC and colorectal cancer, PVC and WFS dyeing is also sent out with the cancer in mice lung cancer model Exhibition is related.
The strongly expressed of PVC and WFS reactivity epi-position, adds that the weak expression of N end and C end epi-position can be shown that these epi-position quilts Steric configuration and/or protein-protein interaction are closed.Regulate or otherness after FL BARD1 and the translation of BARD1 isoform Protein stability may also illustrate not existing of on protein level FL BARD1, and it exists in mRNA level in-site.
Applicant proves that the expression of BARD1 isoform is common in NSCLC and colorectal cancer.The table of these isoforms Reach prognosis (poor prognosis or the good prognosis) significant correlation with NSCLC and colorectal cancer, strongly suggest that BARD1 isoform is joined With tumour formation, development and lethal.Therefore, BARD1 and isoform thereof can be promising diagnosis and prognostic marker, It is applied not only to identify the possible individuality of poor prognosis is had to more invasive treatment, also for searching effectively molecular targeted controlling Treatment specifies new direction.For example, the BARD1 isoforms such as κ and π can be lung cancer and the target for the treatment of of colorectal cancer New Policy Mark.
Detection specific isoforms κ and π contributes to identifying before or after potential curative surgical operation therapy Have the most high risk study subject dying from NSCLC and colorectal cancer, this is because its to be selection adjuvant chemotherapy carried out with The committed step of the study subject of rear treatment.
The invention provides a kind of for detection available from the biological sample of study subject, lung cancer and colorectal cancer are had The method of the existence of specific BARD1 isoform, described method includes detecting in described sample to lung cancer and colorectal cancer tool Having the step of specific at least one BARD1 isoform, described at least one BARD1 isoform is selected from and comprises as follows drum Group:
Isoform π, it comprises SEQ ID NO:1, its bioactive fragment or has at least 95% together with SEQ ID NO:1 The sequence of source property, and
Isoform κ, it comprises SEQ ID NO:2, its bioactive fragment or has at least 95% together with SEQ ID NO:2 The sequence of source property,
Wherein, described in the sample available from described study subject, lung cancer and colorectal cancer are had specific described The existence of BARD1 isoform be described study subject suffer from lung cancer and/or colorectal cancer, there is rising suffer from lung cancer and/or knot There is after the risk of the carcinoma of the rectum and/or treatment lung cancer and/or colorectal cancer the mark of the risk of recurrence.
Preferably, described detecting step includes detecting BARD1 isoform π and BARD1 isoform κ, BARD1 isoform π Comprising SEQ ID NO:1, its bioactive fragment or the sequence with SEQ ID NO:1 with at least 95% homology, BARD1 is same Drum κ comprises SEQ ID NO:2, its bioactive fragment or the sequence with SEQ ID NO:2 with at least 95% homology.
It is also preferred that the method for the present invention includes detecting the BARD1 being made up of in described biological sample SEQ ID NO:1 Isoform π and the step of the BARD1 isoform κ being made up of SEQ ID NO:2.
The method of the present invention also includes detecting at least being selected from described biological sample in the group comprising as follows drum Kind BARD1 isoform:
Isoform π ', isoform π ' comprise SEQ ID NO:105, its bioactive fragment or have with SEQ ID NO:105 There is the sequence of at least 95% homology,
Isoform β, isoform β comprise SEQ ID NO:5, its bioactive fragment or have at least with SEQ ID NO:5 The sequence of 95% homology,
Isoform δ, isoform δ comprise SEQ ID NO:6, its bioactive fragment or have at least with SEQ ID NO:6 The sequence of 95% homology, and
Isoform γ, isoform γ comprise SEQ ID NO:7, its bioactive fragment or with SEQ ID NO:7 have to The sequence of few 95% homology,
Isoform β ', isoform β ' comprise SEQ ID NO:106, its bioactive fragment or have with SEQ ID NO:106 There is the sequence of at least 95% homology.
Preferably, the method for the present invention also includes detecting in described biological sample in the group comprising as follows drum At least one BARD1 isoform:
Isoform π ', isoform π ' comprise SEQ ID NO:105, its bioactive fragment or have with SEQ ID NO:105 There is the sequence of at least 95% homology,
Isoform β, isoform β comprise SEQ ID NO:5, its bioactive fragment or have at least with SEQ ID NO:5 The sequence of 95% homology,
Isoform β ', isoform β ' comprise SEQ ID NO:106, its bioactive fragment or have with SEQ ID NO:106 There is the sequence of at least 95% homology.
It is also preferred that the method for the present invention includes detecting the BARD1 being made up of in described biological sample SEQ ID NO:1 The step of isoform π, the BARD1 isoform κ being made up of SEQ ID NO:2 and the BARD1 isoform β being made up of SEQ ID NO:5 Suddenly.
In the context of the present invention, " bioactive fragment " refers to the region of the BARD1 isoform of the present invention, its for It is necessary for the normal function of BARD1 isoform, such as antagonism function.Bioactive fragment includes comprising and SEQ ID NO:1～7, the amino acid sequence of 105～106 have enough homologys or are derived from SEQ ID NO:1～7, the amino of 105～106 The amino acid sequence of acid sequence, its amino acid comprising is fewer than total length BARD1 isoform, and shows that at least one antagonism is lived Property.Generally, bioactive fragment comprises domain or the motif with at least one antagonistic activity.The same work of BARD1 of the present invention The bioactive fragment of type can be the polypeptide of a length of such as 10,25,50,100 or more amino acid residues. Additionally, other bioactive fragments wherein lacking other regions can be prepared by recombinant technique, and to it with regard to the present invention's One or more functional activities of natural B ARD1 isoform are evaluated.
For example, a kind of bioactive fragment of isoform π can be made up of SEQ ID NO:3, and isoform κ's is a kind of biological Active fragment can be made up of SEQ ID NO:4, and a kind of bioactive fragment of isoform β can be made up of SEQ ID NO:4.
In other embodiment, the BARD1 isoform of the present invention is following polypeptide, and described polypeptide comprises and comprises SEQ ID NO:1～7, the amino acid sequence of 105～106 have at least 70%, the 80%th, the 90%th, 95% or 99%, be preferably The amino acid sequence of 95% homology, and keep comprising SEQ ID NO:1～7, the work of BARD1 isoform of 105～106 Property.
In order to determine the percent homology of two amino acid sequences, in order to most preferably omparison purpose, sequence is compared (for example, in order to carry out optimal comparison with the second amino acid sequence, room can be introduced in the first amino acid sequence).Then than The relatively amino acid residue at corresponding amino acid position.When the position in First ray by with the relevant position in the second sequence When identical amino acid residue occupies, then molecule is homology in this position.Comparison and Percent homology can use ability Any suitable software known to territory, such as CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F.M.Ausubel Deng (eds) 1987, Supplement 30, the 7.7.18 trifle) described in software determine.Preferred program includes GCG Pileup program, FASTA (Pearson etc. (1988) Proc.Natl, Acad.Sci USA 85:2444-2448) and BLAST (BLAST Manual, Altschul etc., Natl.Cent.Biotechnol.Inf., Natl Lib.Med. (NCIB NLM NIH), Bethesda, Md., and Altschul etc., (1997) NAR 25:3389-3402).Another preferred alignment programs is ALIGN Plus (Scientific and Educational Software, PA), is preferably used default parameters.It is found to have use Another sequence software program be obtainable TFASTA in Sequence Software Package Version 6.0 Data Searching Program(Genetics Computer Group,University of Wisconsin, Madison,Wis.)。
Fragment is the sequence of the amino acid that each sequence of the BARD1 isoform with the present invention has at least 40% in length Row.These sequences can be used, as long as they represent the biological property identical with the native sequences that they are derived from, for example short of money Resistant activity.Preferably, these sequences and its each sequence being derived from are total special more than the 70%th, preferably greater than 80% in length More than 90% and most preferably 95% amino acid.These fragments can be by various methods known in the art and technology Prepared by (such as chemical synthesis).
Present invention additionally comprises the variant of BARD1 isoform.Variant is such peptide or polypeptide, the amino acid sequence that they have Being listed in peptide or the polypeptide being different from native sequences to a certain extent, they are to be replaced by conservative amino acid and be different from natural The amino acid sequence of sequence, thus one or more amino acid are had same characteristic features and the other amino acid of conformation effect takes Generation.Amino acid sequence variation some position in the amino acid sequence of natural acid sequence has replacement, disappearance, side chain Modify and/or insert.The exchange in one group being herein defined as conservative amino acid replacement in following five groups:
The residue of I. little aliphatic nonpolar or slight polarity: Ala, Ser, Thr, Pro, Gly
II. the residue of the positively charged of polarity: His, Arg, Lys
III. the electronegative residue of polarity and acid amides thereof: Asp, Asn, Glu, Gln
IV. big aromatic residue: Phe, Tyr, Trp
V. big aliphatic non-polar residue: Met, Leu, Ile, Val, Cys.
It should be understood that the suitable substituent of amino acid that some unconventional amino acid also can be naturally-occurring.For example, Lys residue can be by ornithine, homoarginine, nor-Lys, N-methyl-Lys, N, N-dimethyl-Lys and N, and N, N-trimethyl- Lys replaces.The basic amino acid that Lys residue can also be synthesized replaces, and described basic amino acid includes, but not limited to N-1- (2-pyrazolinyl)-Arg, 2-(4-piperidyl)-Gly, 2-(4-piperidyl)-Ala, 2-[3-(2S) pyrrolinyl]-Gly and 2- [3-(2S) pyrrolinyl]-Ala.Tyr residue can by 4-methoxyl group tyrosine (MeY), m-Tyr, o-Tyr, nor-Tyr, 1251-Tyr, single halogen-Tyr, two halogen-Tyr, O-sulphur-Tyr, O-phosphorus-Tyr and nitro-Tyr replace.
Tyr residue can also be by 3-hydroxyl or 2-hydroxyl isomer (respectively m-Tyr or o-Tyr) and corresponding O- Sulphur-and O-phosphorus derivant replace.Tyr residue can also be synthesized containing the 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor of hydroxyl, synthesis contain hydroxyl Amino acid include but is not limited to 4-hydroxymethyl-Phe, 4-hydroxy phenyl-Gly, 2,6-dimethyl-Tyr and 5-amino-Tyr. Aliphatic amino acid can be replaced by the synthesis of derivatives with non-natural aliphatic side chain or straight chain side chain CnH2n+2, CnH2n In+2, n is from 1 to most 8 and the numerical value including 8.The example suitably being replaced by unconventional conservation of amino acids is at WO02/ Be given in 064740.
Insertion includes adding one or more naturally occurring or unconventional amino acid residue.Disappearance includes one or many The disappearance of individual amino acid residue.
Further, since the intrinsic problem of native peptides (being L-type) is by natural enzyme degradation, can be by the physiologically active of the present invention Albumen is prepared as including the D type of described peptide and/or " converse isomers (retro-inverso isomers) ".Preferably, make The converse isomers of the shorter part of standby physiologically active protein of the present invention, variant or combination.For example as Sela and Zisman is going out Version is in FASEB J.1997 May；It described in the summary of 11 (6): 449-56, is that the peptide of known array prepares converse peptide." converse Isomers " refers to the isomers of linear peptides, and wherein the chiral inversion of the amino acid residue in opposite direction and each of sequence, therefore may be used Complementary there is not end group.
Present invention additionally comprises wherein one or more peptide bonds by alternative types be not susceptible to peptide cleavage impact The analog (" peptide mimics ") that covalent bond replaces.After injecting study subject, the proteolytic degradation of peptide becomes the feelings of problem Under condition, especially sensitive peptide bond replaces with the peptide mimics that can not cut can make the peptide of gained more stable, therefore as activity Material is more useful.This type of analogies and the method introducing them into peptide are well known in the art.
Preferably, described biological sample is selected from comprising the group of following sample: biopsy samples, histological sample, Lung liquid, freezing tissue sample, neoplasmic tissue sample, fecal specimens, celiolymph (CSF), circulating tumor cell (CTC) and blood Sample, more preferably study subject are the mankind.Most preferably biological sample is derived from the blood sample available from study subject Serum.
The existence of the BARD1 isoform of the detection present invention may be carried out by conventional means, such as protein immunization dyeing, egg White immunoprecipitation, immunoelectrophoresis, Western blotting, BCA test for protein, Western blotting, AAS.BARD1 isoform Existence can also utilize conventional method to detect via the existence of its corresponding mRNA, described conventional method such as RNA trace, core Acid enzyme protection inspection (NPA), in situ hybridization and RT-polymerase chain reaction (RT-PCR).Preferably, thin at circulating tumor The expression of detection BARD1 isoform specific RNA in born of the same parents (CTC).
In embodiments of the present invention, the existence of BARD1 isoform is by using the tool of the BARD1 isoform to the present invention Specific antibody is had to detect.Preferably, described antibody is many gram specific binding with at least one BARD1 isoform Grand antibody or monoclonal antibody or their fragment, described BARD1 isoform comprises selected from comprising SEQ ID NO:1-7,105- 106th, the ammonia in the group of its bioactive fragment or the sequence that there is at least 95% homology with SEQ ID NO:1-7,105-106 Base acid sequence.It is also preferred that described antibody is the antibody that the different epitope specificity from least one BARD1 isoform combines Or the combination of its fragment, described BARD1 isoform comprises selected from comprising SEQ ID NO:1-7,105-106, its biologically active piece Amino acid sequence in the group of section or the sequence that there is at least 95% homology with SEQ ID NO:1-7,105-106.Preferably It is that described epi-position is exon 3 and 4.
Preferably, the described combination of described polyclonal antibody or monoclonal antibody or antibody is same with at least one BARD1 Drum is specific binding, described BARD1 isoform comprise selected from comprise SEQ ID NO:1 and the 2nd, its bioactive fragment or with Amino acid sequence in the group of the sequence that SEQ ID NO:1-2 has at least 95% homology.
For example, it is allowed to the antibody of the BARD1 isoform of the detection present invention is following antibody:
-N19, C20 and H300 (Santa Cruz Biotechnology, Santa Cruz, CA),
-generation PVC and WSF (beginning of extron 4) as described above application (Irminger-Finger I etc., Mol Cell 8:1255-66,2001；Feki A etc., Oncogene 24:3726-36,2005；Hayami R etc., Cancer Res 65:6-10,2005；Li L etc., Int J Biochem Cell Biol 39:1659-72,2007；Redente EF etc., Anticancer Res 29:5095-101,2009；Fabbro M etc., J Biol Chem 277:21315-24,2002),
-BL(Bethy Laboratories),
-JH2 and JH3 (the Cancer Rsearch such as Gautier, 2000),
-PGP (Ryser etc., Cancer Research, 2000),
-ELS and KPD, is produced by Applicants
-MIQ (Irminger-Finger etc., JCB 1998)
Described detection can be carried out by immunohistochemical analysis, and is summarized in table 1:
N19 (or PVC or MIQ) should be added by-BARD1 isoform π or BL (or WFS) is the positive, and to JH2 is Negative.In order to distinguish isoform π and π ' (π-d-2), can be completed by the size (size) in Western blotting.
-BARD1 isoform κ should be the positive to BL (or WFS), and is feminine gender to N19 (or PVC or MIQ).
-BARD1 isoform β should to PGP, and or WFS or BL for the positive.In order to distinguish isoform β and β ' (β-d- 5), isoform β is the positive to ELS.
-BARD1 isoform δ should be the positive to N19, is negative and be feminine gender to BL (or WFS) to PVC (or MIQ).
-BARD1 isoform γ should be the positive to N19 and arbitrary PVC (or MIQ), but is feminine gender to C20 (or KPD).
β-D-5 is the another name of isoform β ', and pi-D-5 is the another name of isoform π '.
In another embodiment of the present invention, the existence of described BARD1 isoform is by detection coding at least one The level (expression) of the mRNA of BARD1 isoform detects, described BARD1 isoform comprise selected from comprise SEQ ID NO:1-7, In the group of 105-106, its bioactive fragment or the sequence that there is at least 95% homology with SEQ ID NO:1-7,105-106 Amino acid sequence.Preferably, at least one BARD1 isoform of described mRNA coding, described BARD1 isoform comprises to be selected from Comprise SEQ ID NO:1 and the 2nd, its bioactive fragment or there is the sequence of at least 95% homology with SEQ ID NO:1-2 Amino acid sequence in group.The expression of described mRNA is preferably in vitro in the circulating tumor cell (CTC) available from study subject Carry out.
In another embodiment of the present invention, by detection available from the blood sample of study subject, preferably in serum BARD1 isoform to the present invention has the existence of specific autoimmune antibody, detects depositing of described BARD1 isoform ?.Preferably, described autoimmune antibody is to have specific antibody to BARD1 isoform π and κ.
In the context of the present invention, " autoimmune antibody " or " autoantibody " refers to that the BARD1 for the present invention is same The naturally occurring antibody of drum, even if these BARD1 isoforms are actually to be derived from this study subject, the immunity of study subject System is also construed as foreign protein.Therefore these BARD1 isoforms cause immune response.Preferably, described BARD1 is same Drum is isoform π and κ.
Autoimmune antibody can be detected by routine immunization well known in the art, for example different ELISA skills Art (using fixing antibody over the surface of the panel or the fixing antigen over the surface of the panel of use to capture antibody), radioimmunoassay Deng (see Immunoassay, E.Diamandis and T.Christopoulus, Academic Press, Inc., San Diego, CA,；1996).The immunity inspection of the antibody for detection with specific immunological specificity needs to use to the antibody tested Show the reagent (antigen) having specific immunoreactivity.Depending on the form of described inspection, this antigen can be fixed on solid On support.Make to want the sample (such as blood sample) of the existence of test antibody and this antigen contact, and if required immunity Specific antibody is present in this sample, and they can react with this antigen immune, thus can be detected after being formed or be determined Measure fixed Antibody-antigen complex.
Therefore according to the embodiment of the present invention, by detection available from the blood sample of described study subject to described BARD1 isoform has the existence of specific autoimmune antibody, detects the existence of BARD1 isoform, wherein uses choosing At least one antigen (peptide) in the group of self-contained SEQ ID NO:13 80, preferably at least four kinds antigens (peptide) are to detect to institute State BARD1 isoform and there is specific described autoimmune antibody.Described BARD1 isoform selected from comprise isoform α, β, β’、η、γ、ε、δ, θ, π, π ' and the group of κ.Preferably, described BARD1 isoform is selected from comprising isoform β, β ', δ, γ, π, π ' and the group of κ.It is further preferred that described BARD1 isoform is selected from the group comprising isoform β, π and κ.Most preferably, institute State BARD1 isoform selected from the group comprising isoform π and κ.The detection of autoimmune antibody is preferably in vitro to available from tested right The blood sample of elephant, preferred serum are carried out.
It is further preferred that BARD1 isoform is to have specific isoform π and κ to lung cancer and colorectal cancer, antigen selects The group of self-contained SEQ ID NO:16, the 17th, the 18th, the 23rd, 59-67, the 68th, the 69th, the 74th, the 75th, 76-80.Most preferably, antigen is selected from bag The NO:16 of ID containing SEQ, the 17th, the 18th, the 23rd, the 68th, the 69th, 74 and 75 group.
In one embodiment, the present invention provides the peptide in the group comprising SEQ ID NO:13～80 for inspection The method surveying the existence of the BARD1 isoform of the present invention.
It has been discovered by the applicants that the antigen in the group comprising SEQ ID NO:13～80 also can be by detection to choosing Self-contained isoform α, β, β ', η, γ, ε,δ, θ, π, π ' and the group of κ in BARD1 isoform there is specific self exempting from The existence of epidemic disease antibody, and for detection selected from breast cancer, oophoroma, prostate cancer, neuroblastoma and other cancers leukemic Disease.For example, the antigen in the group comprising SEQ ID NO:13, the 14th, the 15th, the 23rd, 59-67, the 69th, the 70th, 75-80 can be used for detecting Breast cancer, oophoroma and prostate cancer.
Therefore in another embodiment, the present invention provides the peptide in the group comprising SEQ ID NO:13～80, institute The method stating peptide existence of BARD1 isoform in detection is available from the biological sample of study subject is used as antigen, wherein passes through The existence that detection has specific autoimmune antibody to described BARD1 isoform detects depositing of described BARD1 isoform , and the existence that wherein said BARD1 isoform is in described sample is the mark of described patients's cancer.Described BARD1 isoform is selected from comprising isoform α, β, β ', η, γ, ε,δ, θ, π, π ' and the group of κ.
At least one antigen should be used for detection to BARD1 isoform, to there is specific autoimmune antibody and deposit ?.At least 4 kind antigens are preferably used, more preferably use 4～10 kinds of antigens, most preferably with 4～6 kinds antigens.
The antigen of the present invention can also be contacted to obtain baseline with negative control sample (normal healthy controls blood sample), this Contribute to distinguishing cancer study subject (to see anti-BARD1 in embodiment blood of patients with lung cancer self to exempt from healthy study subject The detection of epidemic disease antibody).Optionally, can also be by the antigen of the present invention and positive control sample (confirmed cancer blood sample Product) contact to obtain clear and definite positive findings.
In another embodiment, can be by (excellent from the blood sample of study subject and the BARD1 isoform of the present invention Select isoform π and κ) or the contact of its fragment.That then can detect between autoimmune antibody and described BARD1 isoform is special Property combine, thus based on the specific binding amount between autoimmune antibody and described BARD1 isoform determine lung cancer and/or Colorectal cancer presence or absence of.The detection of autoimmune antibody preferably in vitro to available from study subject blood sample, Preferably serum is carried out.
Alternately, according to the embodiment of the present invention, the existence of the BARD1 isoform of the present invention is by with lower section Formula detects:
The level of the mRNA of at least one BARD1 isoform of detection coding, described BARD1 isoform comprises to be selected from and comprises SEQ ID NO:1-7,105-106, its bioactive fragment or there is at least 95% homology with SEQ ID NO:1-7,105-106 Amino acid sequence in the group of the sequence of property, and
Detection has specific autoimmunity available from the blood sample of described study subject to described BARD1 isoform The existence of antibody, and wherein use at least four antigen being selected from the group comprising SEQ ID NO:13 80 to detect to institute State BARD1 isoform and there is specific described autoimmune antibody.
Present invention also offers a kind of separation being used as biomarker in the method for the invention and/or purifying is many Peptide, the polypeptide of described separation and/or purifying comprise SEQ ID NO:1, its bioactive fragment or with SEQ ID NO:1 have to The sequence of few 95% homology；A kind of separation of biomarker and/or purifying of being used as in the method for the invention is also provided Polypeptide, the polypeptide of described separation and/or purifying comprises SEQ ID NO:2, its bioactive fragment or has with SEQ ID NO:2 The sequence of at least 95% homology.
The present invention also provides a kind of antibody or its fragment, described antibody or its fragment and the SEQ ID on BARD1 isoform π Epi-position shown in NO:143 (DTKSRNEVVTPIKGDIPSVEYLLQNGS) combines.Preferably, the present invention provides a kind of antibody Or its fragment, described antibody or its fragment are combined with the epi-position shown in SEQ ID NO:144 (NEVVTPIKGDIPSVEY).
The present invention also provide a kind of in the method for treating and/or preventing lung cancer and colorectal cancer use antibody or Its fragment, described antibody or its fragment are combined with the epi-position shown in SEQ ID NO:143.Preferably, the present invention provides one The antibody using in the method for treating and/or preventing lung cancer and colorectal cancer or its fragment, described antibody or its fragment Be combined with the epi-position shown in SEQ ID NO:144.
Present invention additionally comprises in the method for treating and/or preventing lung cancer and colorectal cancer use and at least one Plant the specific binding polyclonal antibody of BARD1 isoform or monoclonal antibody or their fragment, described BARD1 isoform bag Containing selected from comprise SEQ ID NO:1-7,105-106, its bioactive fragment or with SEQ ID NO:1-7,105-106 have to Amino acid sequence in the group of the sequence of few 95% homology, and wherein do not include following antibody: N19, C20, H300, PVC, WSF、BL、JH2、JH3、PGP、ELS、KPD、MIQ。
Present invention additionally comprises in the method for treating and/or preventing lung cancer and colorectal cancer use and at least one Antibody that the different epitope specificity of kind of BARD1 isoform combines or or the combination of its fragment, described BARD1 isoform comprises to select Self-contained SEQ ID NO:1-7,105-106, its bioactive fragment or have at least with SEQ ID NO:1-7,105-106 Amino acid sequence in the group of the sequence of 95% homology, and wherein do not include following antibody: N19, C20, H300, PVC, WSF、BL、JH2、JH3、PGP、ELS、KPD、MIQ。
The antibody of the present invention can be additionally used in the tissue sample of detection study subject, the body fluid of study subject or study subject BARD1 isoform in circulating cells in blood, described BARD1 isoform comprises selected from comprising SEQ ID NO:1-7,105- 106th, the ammonia in the group of its bioactive fragment or the sequence that there is at least 95% homology with SEQ ID NO:1-7,105-106 Base acid sequence.
Preferably, the described combination of described polyclonal antibody or monoclonal antibody or antibody is same with at least one BARD1 Drum is specific binding, described BARD1 isoform comprise selected from comprise SEQ ID NO:1 and the 2nd, its bioactive fragment or with Amino acid sequence in the group of the sequence that SEQ ID NO:1-2 has at least 95% homology.
As used herein, term " antibody " refers to the immunoglobulin molecules with ad hoc structure, its only be used for synthesizing The antigen of this antibody (the BARD1 isoform of the such as present invention) or with the AI (that is, combine) closely related with it. Additionally, antibody can be the fragment of antibody or modified antibody, if its one or more eggs with marker gene codes Combine in vain.For example, antibody fragment can be Fab, F (ab') the 2nd, Fv or scFv (scFv), wherein from heavy chain and light chain Fv fragment by suitable joint connect (Huston J.S. etc., (1988) Proc.Natl.Acad.Sci.U.S.A.85: 5879-83.).More specifically, antibody fragment can be by processing antibody with enzyme (including papain or pepsin) Produce.Alternately, the gene of Encoding Antibody Fragment can be built, be inserted in expression vector and suitable host Cell is expressed and (see, e.g. Co M.S. etc., (1994) J.Immunol.152:2968-76；Better M. and Horwitz A.H. (1989) Methods Enzymol.178:476-96.；Pluckthun A.and Skerra A.(1989)Methods Enzymol.178:497-515.；Lamoyi E. (1986) Methods Enzymol.121:652-63.；Rousseaux J. Deng (1986) Methods Enzymol.121:663-9.；Bird R.E. and Walker B.W. (1991) Trends Biotechnol.9:132-7.).
Antibody can by with various molecules, such as polyethylene glycol (PEG) is puted together and is modified.Antagonist can be passed through It is chemically modified and obtain modified antibody.This type of method of modifying is conventional in this area.
Alternately, antibody can include chimeric antibody or humanized antibody, and described chimeric antibody has from non- The variable region of human antibodies and the constant region from human antibodies, described humanized antibody comprises the complementation from non-human antibody Determine district (CDR), from the frame work district (FR) of human antibodies and constant region.This antibody-like can be by using known technology Preparation.Humanization can be carried out by the corresponding sequence replacing human antibodies by rodentine one or more CDR sequences See, e.g. Verhoeyen etc., (1988) Science 239:1534-6).Therefore, this type of humanized antibody is inosculating antibody Body, wherein substantially less than complete people's variable domains is by the corresponding sequence replacing from non-human species.All right Use the total length people's antibody comprising the human variable region in addition to human framework district and constant region.This antibody-like can use ability Various technology known to territory produce.For example, in-vitro method includes the restructuring literary composition using the people's antibody fragment shown on bacteriophage Storehouse (for example, Hoogenboom&Winter, (1992) J.MoI.Biol.227:381-8).Similarly, people's antibody can be by inciting somebody to action Human immunoglobulin gene's seat introduces the transgenic animals that wherein endogenous immunoglobulin genes has partially or completely inactivated (such as mouse) manufactures.The method is for example described in United States Patent (USP) the 6,150,584th, the 5,545,807th, the 5,545,806th, 5, 569,825th, the 5,625,126th, the 5,633,425th, in 5,661,016.This antibody-like can be prepared by using known technology.
The present invention also provides a kind of restructuring using in the method for treating and/or preventing lung cancer and colorectal cancer SiRNA molecule, described restructuring siRNA molecule is combined with strand or double stranded rna molecule, wherein said strand or double stranded rna molecule Comprise the mRNA encoding at least one BARD1 isoform, described BARD1 isoform comprise selected from comprise SEQ ID NO:1-7, In the group of 105-106, its bioactive fragment or the sequence that there is at least 95% homology with SEQ ID NO:1-7,105-106 Amino acid sequence, the thus expression of described BARD1 isoform is suppressed.
Preferably, at least one BARD1 isoform of described mRNA coding, described BARD1 isoform comprises to be selected from and comprises In the group of SEQ ID NO:1 and the 2nd, its bioactive fragment or the sequence that there is at least 95% homology with SEQ ID NO:1-2 Amino acid sequence.
In the context of the present invention, siRNA (RNA interference or siRNA) suppression or the table reducing BARD1 isoform Reach.Preferably, described isoform is π, π ', κ, β, β ', δ and γ, more preferably π, κ, β, most preferably π and κ.Herein, term " siRNA " refers to stop the double-stranded RNA of the translation of said target mrna.Generally, siRNA includes for one or more BARD1 isoforms The sense nucleic acid sequence of expression and anti sense nucleotide sequence, described BARD1 isoform comprise selected from comprise SEQ ID NO:1-7, In the group of 105-106, its bioactive fragment or the sequence that there is at least 95% homology with SEQ ID NO:1-7,105-106 Amino acid sequence.
Generally, siRNA can be to separate." separation " siRNA is the siRNA taking out from its initiation environment.For example, If siRNA is cloned into be not natural surroundings a part of carrier in when, then it is assumed that this siRNA be separate.
SiRNA can be built by synthesis and be made up of two complementary single stranded RNAs completely, or is come by biosynthesis Build.SiRNA is built into the Sense sequences having concurrently from target gene (for example single with a transcript of complementary antisense sequences Hairpin RNA or shRNA).The standard technique that siRNA is imported cell can be used, including wherein using DNA as transcribing RNA's The technology of template.
Generally, siRNA is combined with single strand RNA molecule, and wherein said single strand RNA molecule comprises to encode at least one BARD1 The mRNA of isoform, described BARD1 isoform comprises selected from comprising SEQ ID NO:1-7,105-106, its bioactive fragment Or the amino acid sequence in the group of the sequence that there is at least 95% homology with SEQ ID NO:1-7,105-106, this siRNA leads to Cross and be combined with normal strand mRNA transcript, thus interfere with the translation of BARD1 isoform and and then disturb it to express.Therefore, The siRNA molecule of the present invention can be by mRNA or the cDNA specific hybrid of their at least one BARD1 isoforms with coding Ability define, described BARD1 isoform comprises selected from comprising SEQ ID NO:1-7,105-106, its bioactive fragment Or the amino acid sequence in the group of the sequence that there is at least 95% homology with SEQ ID NO:1-7,105-106.
In the context of the present invention, the length of siRNA is preferably smaller than 500 nucleotides, preferably smaller than 200 nucleosides Acid, more preferably less than 100 nucleotides, even more preferably less than 50 nucleotides, or more preferably less than 25 nucleotides.More preferably , the length of siRNA is about 19～about 25 nucleotides.In order to strengthen the inhibitory activity of siRNA, can anti-to target sequence The 3' end of justice chain adds one or more uridylate (" u ").The quantity of " u " to be added is at least 2, usually 2～ 10, preferably 2～5.Form strand at the 3' end of the antisense strand at siRNA for " u " adding.
The siRNA of the present invention can be introduced directly in cell with the form can being combined with mRNA transcript.Real at these Execute in mode, as it is known in the art, generally the siRNA molecule of the present invention is modified.Other modifications are also feasible, for example The siRNA of cholesterol-put together has shown that the pharmacological property of improvement.Song etc., Nature Med.9:347-51 (2003).Alternately, the DNA encoding siRNA can carry in the carrier.
Several useful siRNA are identified.Such as siRNA (referring to Figure 1A and Fig. 4 E) in extron 9 is to have Effect, and cause proliferative block.In another example, the siRNA in use extron 4 is important for BARD1 isoform π (seeing Figure 17).Some useful siRNA are:
K34:CATTCTGAGAGAGCCTGTG (SEQ ID NO.107)
K423:GTGCTCAGCAAGACTCATA (SEQ ID NO.108)
K401:AAGTCTCTTTACCATTGGCTG (SEQ ID NO.109)
K78:AAGTGTATGCTTGGGATTCTC (SEQ ID NO.110)
The present invention also provides a kind of BARD1 using in the method for treating and/or preventing lung cancer and colorectal cancer The bioactive conditioning agent of isoform, described BARD1 isoform comprise selected from comprise SEQ ID NO:1-7,105-106, its Amino acid sequence in the group of bioactive fragment or the sequence that there is at least 95% homology with SEQ ID NO:1-7,105-106 Row.Preferably, described BARD1 isoform comprises selected from comprising SEQ ID NO:1 and the 2nd, its bioactive fragment or and SEQ Amino acid sequence in the group of the sequence that ID NO:1-2 has at least 95% homology.
The bioactive conditioning agent of BARD1 isoform can be competitor.Preferably, described competitor is to disturb The disorderly compound of the interaction between described BARD1 isoform and its acceptor.For example, described competitor can also is that inhibitor Or antagonist.Term " inhibitor " or " antagonist " refer to the function by being combined suppression albumen or polypeptide with albumen or polypeptide Molecule.The competitor such as inhibitor or antagonist, can directly suppress BARD1 isoform and its native ligand of the present invention And/or the interaction between acceptor, cause the biochemistry of acceptor or biological function to be upset.Reverse transcriptase is wherein inhibitor Suppression form in conjunction with the combination (vice versa) preventing part.In Reverse transcriptase, inhibitor is combined with native ligand Identical avtive spot, and without causing reaction.When inhibitor is at avtive spot, ligand molecular can not enter avtive spot, and And inhibitor can not enter this site when part is in this site.It is thin that " biologically active or the function " of albumen refers to carry out diversity Born of the same parents' function or the ability of other molecules of specifically combining closely.
Equally in the context of the present invention, the bioactive conditioning agent of the BARD1 isoform of the present invention is preferably permissible It is the microRNA (miRNA) that regulatory gene is expressed.It is found by the applicant that BARD1 can be the target of many microRNAs.Specific microRNA Exogenous expression suppress BARD1 express (seeing Figure 18).It is further preferred that in the context of the present invention, microRNA is selected from bag Group containing following microRNA: hsa-mir-10a MI0000266:(SEQ ID NO.111)；hsa-mir-10b MI0000267 (SEQ ID NO.112)；hsa-mir-130a MI0000448(SEQ ID NO.113)；hsa-mir-130b MI0000748 (SEQ ID NO.114)；hsa-mir-134 MI0000474(SEQ ID NO.115)；hsa-mir-144 MI0000460 (SEQ ID NO.116)；hsa-mir-148a MI0000253(SEQ ID NO.117)；hsa-mir-148b MI0000811 (SEQ ID NO.118)；hsa-mir-152 MI0000462(SEQ ID NO.119)；hsa-mir-181a-2 MI0000269 (SEQ ID NO.120)；hsa-mir-181a-1 MI0000289(SEQ ID NO.121)；hsa-mir-181b-1 MI0000270(SEQ ID NO.122)；hsa-mir-181b-2 MI0000683(SEQ ID NO.123)；hsa-mir-19a MI0000073(SEQ ID NO.124)；hsa-mir-19b-1 MI0000074(SEQ ID NO.125)；hsa-mir-19b-2 MI0000075(SEQ ID NO.126)；hsa-mir-203 MI0000283(SEQ ID NO.127)；hsa-mir-301a MI0000745(SEQ ID NO.128)；hsa-mir-301b MI0005568(SEQ ID NO.129)；hsa-mir-452 MI0001733(SEQ ID NO.130)；hsa-mir-454 MI0003820(SEQ ID NO.131)；hsa-mir-517a MI0003161(SEQ ID NO.132)；hsa-mir-517c MI0003174(SEQ ID NO.133)；hsa-mir-553 MI0003558(SEQ ID NO.134)；hsa-mir-570 MI0003577(SEQ ID NO.135)；hsa-mir-576 MI0003583(SEQ ID NO.136)；hsa-mir-579 MI0003586(SEQ ID NO.137)；hsa-mir-580 MI0003587(SEQ ID NO.138)；hsa-mir-613 MI0003626(SEQ ID NO.139)；hsa-mir-618 MI0003632(SEQ ID NO.140)。
Usual microRNA is short ribonucleic acid (RNA) molecule, has at least about 22 nucleotides, preferably from about 60～about 100 Individual nucleotides, it complementary series on target messenger RNA transcript (mRNA) can be combined, generally causes Translational repression or target Degraded and gene silencing.
Present invention additionally comprises a kind of method distinguishing lung cancer and colorectal cancer with gynecological cancer, described method includes detection Available from the step to lung cancer and colorectal cancer with specific BARD1 isoform at least one in the biological sample of study subject Suddenly, described BARD1 isoform is selected from the group comprising as follows drum:
Isoform π, isoform π comprise SEQID NO:1, its bioactive fragment or have at least with SEQ ID NO:1 The sequence of 95% homology, and
Isoform κ, isoform κ comprise SEQ ID NO:2, its bioactive fragment or have at least with SEQ ID NO:2 The sequence of 95% homology,
Wherein, the described existence to lung cancer and colorectal cancer with specific BARD1 isoform is lung cancer and/or knot is straight The mark of intestinal cancer.
For being that BARD1 isoform α is at lung cancer and knot by another feature of lung cancer and colorectal cancer and gynecological cancer differentiation The carcinoma of the rectum does not exists.Amino acid sequence from PCT/EP2008/053881 known BARD1 isoform α.Therefore optionally, Described method also include detecting BARD1 isoform α in described sample, its bioactive fragment or with BARD1 isoform α have to The sequence of few 95% homology, wherein said BARD1 isoform α do not exist be described study subject stomach do not suffer from lung cancer and/ Or the mark of colorectal cancer.
Preferably, gynecological cancer is a different set of malignant tumour of female reproductive system.The gynaecology of most common type Malignant tumour is cervix cancer, oophoroma and endometrium (uterus) cancer.There is also other more uncommon gynecologic malignant tumors, Including carcinoma of vagina, carcinoma of vulva, gestational trophoblastic tumor and carcinoma of fallopian tube.In the context of the present invention, breast cancer is also included within In gynecological cancer.
The present invention also provide a kind of for detection available from the sample of study subject, lung cancer and colorectal cancer are had special The kit of the existence of the BARD1 isoform of property, described kit comprises:
At least one polynucleotide primers or probe, wherein said polynucleotide primers or probe are to coding at least one The polynucleotides of BARD1 isoform have specifically, and described BARD1 isoform comprises selected from comprising SEQ ID NO:1-7,105- 106th, in the group of its bioactive fragment and/or the sequence that there is at least 95% homology with SEQ ID NO:1-7,105-106 Amino acid sequence, and/or
The antibody combining from the different epitope specificity of at least one described BARD1 isoform or the combination of its fragment, institute State BARD1 isoform comprise selected from comprise SEQ ID NO:1-7,105-106, its bioactive fragment or with SEQ ID NO:1- 7th, the amino acid sequence in the group of the sequence that 105-106 has at least 95% homology, and/or
At least one peptide in the group comprising SEQ ID NO:13～80.
Preferably, described BARD1 isoform comprise selected from comprise SEQ ID NO:1-22, its bioactive fragment or with Amino acid sequence in the group of the sequence that SEQ ID NO:1-2 has at least 95% homology.
The polynucleotides encoding at least one BARD1 isoform are the polynucleotides comprising following nucleotide sequence: selected from bag The NO:8 of ID containing SEQ (isoform π), SEQ ID NO:9 (isoform κ), SEQ ID NO:10 (isoform β), SEQ ID NO: 11 (isoform δ), SEQ ID NO:12 (isoform γ), SEQ ID NO:141 (isoform π '), SEQ ID NO:142 (same to work Type β ') group in nucleotide sequence；The preferably nucleotide sequence in the group comprising SEQ ID NO:8 and 9.
Primer, probe and/or antibody can be packed together with the detection reagent that other need with the form of kit.Example As, they can be packaged in container separately, such as nucleic acid or antibody (be combined with solid matrix or with for they are tied The reagent being bonded to described matrix separates packaging), contrast agents (positive and/or negative) and/or detectable label.In kit also The explanation (for example, in writing form, tape, VCR, CD-ROM etc.) for carrying out described detection can be included.
Present invention additionally comprises vaccine and immunization method.For example, the tested of lung cancer and/or colorectal cancer is suffered from treatment or prevention The method of the lung cancer in object and/or colorectal cancer can include applying vaccine combination, described composition bag to study subject Contain:
One or more BARD1 isoforms or its immunoreactive fragments, described BARD1 isoform comprises selected from comprising SEQ ID NO:1-7,105-106, its bioactive fragment and SEQ ID NO:1-7,105-106 have at least 95% homology Amino acid sequence in the group of sequence,
Or one or more peptides (antigen) in the group comprising SEQ ID NO:13～80.
Preferably, described BARD1 isoform comprise selected from comprise SEQ ID NO:1-2, its bioactive fragment and Amino acid sequence in the group of the sequence that SEQ ID NO:1-2 has at least 95% homology, and described peptide is selected from comprising SEQ In the group of ID NO:16, the 17th, the 18th, the 23rd, 59-67, the 68th, the 69th, the 74th, the 75th, 76-80.
In the context of the present invention, immunoreactive fragments is polypeptide shorter than naturally occurring full-length proteins in length, One of such as BARD1 isoform, its induction immune response similar with the immune response that full-length proteins is induced.For example, immunity Active fragment should be at least 8 residues in length, and can immune stimulatory cell, such as T cell or B cell.Immunity Cytositimulation can be detected by the generation of detection cell proliferation, the details of cell factor (such as IL-2) or antibody.See, Such as Harlow and Lane, Using Antibodies:A Laboratory Manual, 1998, Cold Spring Harbor Laboratory Press；And Coligan, etc. Current Protocols in Immunology, 1991-2006, John Wiley&Sons。
Present invention additionally comprises a kind of for treatment or prevent to suffer from the lung cancer in the study subject of lung cancer and/or colorectal cancer And/or the pharmaceutical composition of colorectal cancer, wherein said composition comprises the antibody of the present invention of pharmaceutical effective amount.
Present invention additionally comprises a kind of for treatment or prevent to suffer from the lung cancer in the study subject of lung cancer and/or colorectal cancer And/or the pharmaceutical composition of colorectal cancer, wherein said composition comprises the siRNA of the present invention of pharmaceutical effective amount.
Present invention additionally comprises a kind of for treatment or prevent to suffer from the lung cancer in the study subject of lung cancer and/or colorectal cancer And/or the pharmaceutical composition of colorectal cancer, wherein said composition comprises the conditioning agent of the present invention of pharmaceutical effective amount.Preferably , described conditioning agent is microRNA, and its regulatory gene is expressed.
" treatment " refers to therapeutic treatment and preventative or preventing property measure.The object needing treatment includes having suffered from disease Disease, such as the object of lung cancer and/or colorectal cancer, and to prevent the object of described disease.Therefore, lactation to be treated herein is moved Thing, the preferably mankind can be diagnosed as having described disease and or can tend to suffer from and have described disease or easy to described disease Sense, described disease such as lung cancer and/or colorectal cancer.
" prevent " to refer to apply conditioning agent of the present invention, siRNA and/or antibody as used herein thus reduce right Lung cancer and/or colorectal cancer have high risk study subject really to develop into possibility or the probability of described cancer in the future.
" pharmacy effective dose " refers to active component (for example chemical or biological material when applying the mankind or animal organism Material) induce detectable pharmacology and/or physiological effect.
Each pharmacy effective dose can depend on concrete study subject to be treated, depends on disease to be treated and depend on Application process.Treatment generally includes repeatedly administration pharmaceutical composition, is typically separated about a few hours, a couple of days or several weeks.Such as antibody, The pharmacy effective dose of the dosage unit of the active component of the present invention such as siRNA or conditioning agent, usually 0.001ng～100mg is every The body weight of kilogram study subject to be treated.It should be understood that the suitable dose of inventive compound will depend upon which the year of recipient The character of age, sex, health and body weight, the species (if any) of simultaneous treatment and desired effect.
For systemic administration, therapeutically effective amount or dosage can initially be assessed by tested in vitro.For example, it is possible at animal mould Type is prepared medicament to reach the circulation composition scope including IC50 determined by cultivating such as cell.This type of information can be used for Determine the useful dosage in the mankind more accurately.
Predose can also use technology well known in the art to assess from intra-body data (such as animal model).This area Those of ordinary skill easily can be optimized to the administration of the mankind based on animal data, and certainly can depend on waiting to control The study subject treated, the judgement depending on subject body weight, disease severity, method of application and prescriber.
When for the present invention, " administration " refers to pharmaceutical composition and study subject, preferably human contact.
Pharmaceutical composition can be dissolved in or be scattered in and well known to a person skilled in the art pharmaceutically acceptable carrier In, for carrying out parenteral administration, for example, pass through intravenous injection, hypodermic injection or intramuscular injection or pass through intravenous Note carries out parenteral administration.
Pharmaceutical composition for parenteral administration, it is possible to use any conventional additives, such as excipient, adjuvant, viscous Mixture, disintegrant, dispersant, lubricant, diluent, absorption enhancer, buffer, surfactant, solubilizer, preservative, Emulsifying agent, isotonic agent, stabilizer, injection solubilizer, pH adjusting agent etc..
The acceptable carrier, diluent and the assistant that contribute to being machined to reactive compound preparation that pharmaceutically can use Agent is nontoxic when dosage used and concentration to recipient, and includes buffer, such as phosphate, citrate and its Its organic acid；Antioxidant, including ascorbic acid and methionine；Preservative (such as stearyl dimethyl benzyl ammonium chloride； Hexamethonium chloride；Benzalkonium chloride, benzethonium chloride；Phenol, adjacent butyl benzyl alcohol (butyl orbenzyl alcohol)；Alkyl P-hydroxybenzoate, such as methyl parabens or propyl para-hydroxybenzoate；Catechol；Resorcinol；Ring Hexanol；3-amylalcohol；And metacresol)；The polypeptide of low-molecular-weight (less than about 10 residues)；Albumen, such as seralbumin, gelatin Or immunoglobulin (Ig)；Hydrophilic polymer, such as polyvinylpyrrolidone；Amino acid, such as glycine, glutamine, asparagus fern acyl Amine, histidine, arginine or lysine；Monose, disaccharides and other carbohydrates, including glucose, mannose or dextrin；Chelating agent, Such as EDTA；Sugar, such as sucrose, mannitol, trehalose or D-sorbite；Become salt gegenion (counter-ion), for example Sodium；Metal composite (for example, Zn-albumen composition)；And/or nonionic surfactant, for exampleOr polyethylene glycol (PEG).
The administration form of pharmaceutical composition can be whole body or local.For example, the administration of this type of pharmaceutical composition can To be various parental routes, for example subcutaneous, intravenous, intracutaneous, intramuscular, intraperitoneal, intranasal, transdermal, oral cavity route or warp By implanted device, and also can be delivered by vermiculator.
The pharmaceutical composition of the active component comprising the present invention can also be introduced or be impregnated into the matrix of biological absorbable In, described matrix is applied with the form of substrate suspension, gel or solid carrier.Additionally, matrix can also be by biopolymer Composition.
Sustained release preparation can be prepared.The suitable example of sustained release preparation includes half of the solid hydrophobic polymers containing antibody Permeable matrices, this matrix is the form of moulded products, such as film or microcapsules.The example of sustained-release matrix includes polyester, water-setting Glue (for example, poly-(methacrylic acid 2-hydroxyethyl ester) or poly-(vinyl alcohol)), polyactide (U.S. Patent No. 3,773,919 Number), the copolymer of Pidolidone and [γ] ethyl-L-glutamate ester, nondegradation ethane-acetic acid ethyenyl ester, such as LUPRON The degradability lactic acid-glycolic such as DEPOT (TM) (Injectable microspheres being made up of lactic acid-ethanol copolymer and leuprorelin acetate) Acid copolymer and poly-D-(-)-3-hydroxybutyrate.
Preparation for internal administration must be aseptic.This is easily achieved, for example, carried out by aseptic filter membrane Filter and realize.
One skilled in the art will recognize that, invention described herein is easily carried out in addition to concrete described those Change or modification.It should be understood that the present invention include all this type of change or modification and without departing from its spirit or essential attributes.This The institute that invention also includes pointing out in specification or indicate in steps, feature, composition and compound, either individually or complete Body, and arbitrarily two or more any combination of described step or feature and all combinations.It is taken as that present disclosure It is cited all aspects, rather than restricted, the scope of the present invention is indicated by claims, and contains in equivalence In all changes in justice and scope are intended to be included within.
Descriptions above will be more fully appreciated with reference to following example.But, this type of embodiment is to implement the present invention The example of method, rather than be intended to limit the scope of the present invention.
Embodiment
I-patient's lung cancer
At two central collection from the tumor tissues (table 1) of 100 NSCLC patients.All patients are from local ethics The committee obtains informed consent.(5 male sex and 3 women, the age is from 24～66 to use 8 cases with optimum lung disease Year (median ages, 38 years old))；5 emphysema cases, remaining is pulmonary tuberculosis and carcinoid dysplasia (carcinoid Dysplasia)) the control sample expressed as BARD1.
From Napoli obtain 60 patients 48 follow up a case by regular visits to record, follow up a case by regular visits to from 1 month～69 months；In peri-operation period two Name death, and have 10 patients not obtain data.48 have in the patient following up a case by regular visits to record, and only 17 are passed through surgery hand Art is treated, and at surgery used after operation chemotherapeutic treatment, treats at surgery used after operation chemotherapy and radiation for one, 7 patientizations for 4 Treat and radiotherapy in the treatment, only use chemotherapeutic treatment for 4, only use radiotherapy in the treatment for 1, remaining 14 to following up a case by regular visits to for the last time or death is Only treat.In this 48 patients, 35 death, 13 follow up a case by regular visits to the last time period still survive.
Follow up a case by regular visits to record for 17 in 40 patients of Cagliari；Follow up a case by regular visits to from 5 months～95 months；11 patients Following up a case by regular visits to period (in March, 2010) the last time still survives, and 6 deaths.From operation, start chemotherapy or put To following up a case by regular visits to for the last time or calculate total survival death from the day for the treatment of, or the diagnosis of the patient treating.
Table 1. patient characteristic lung cancer
Patient characteristic colorectal cancer
Based on WHO standard, experienced virologist is carried out pathological diagnosis, and combine committee according to american cancer by stages Member can be carried out by stages.All patients know the inside story and comply with, and obtain the approval of local Ethics Committee.
Checked 168 cases with colorectal cancer altogether, comprise 20 cases from Cagliari and 148 From German case (table 2).20 cases from Cagliari (are included neoplasmic tissue sample and the morphology around them Normal tissue (around tumour) sample) for reverse transcriptase PCR detection.From German 148, will there is colorectal cancer Case is for the immunohistochemical analysis of tissue array.This 168 cases are made up of 106 colon cancers and 62 carcinoma of the rectum, They are all gland cancer.Patient is 93 male sex and 75 women, age during diagnosis be 33 years old～78 years old (median ages, 61 Year).21 patients have I phase disease, and 34 have the II phase, and 50 have the III phase, and 23 have the IV phase；Remaining 40 trouble Person for unknown by stages because can not be to primary tumo(u)r or/and regional lymph nodes be or/and far-end transfer is estimated.10 Patient has the good tumour breaking up (G1), and 116 tumours with medium differentiation (G2), 38 have bad differentiation (G3) Tumour；Remaining 2 patients are not classified (GX).
Section for immunochemistry dyeing is micro-array tissue, and each case is quadruplicate.In 148 cases 75 Have and follow up a case by regular visits to record, follow up a case by regular visits to from 1 month～72 months, and remaining 73 patients do not have survival data.Have and follow up a case by regular visits to record This 75 patients in, 22 death, 48 missing, 5 the last time follow-up period still survive.
The patient characteristic of table 2. colorectal cancer
Immunohistochemistry
Antibody with the not same district for BARD1 and the antibody for BRCA1 carry out immuning tissue to adjacent section Credit is analysed.
Not same district (i.e. N19 (exons 1) (sc-7373) and C20 (exons 1 1) (sc-for BARD1 used 7372) antibody) is purchased from Santa Cruz (Santa Cruz Biotechnology, Santa Cruz, CA), as described above Produce and apply PVC (exon 3) and WSF (beginning of extron 4) (Irminger-Finger I etc., Mol Cell 8:1255-66,2001；Feki A etc., Oncogene 24:3726-36,2005；Hayami R etc., Cancer Res 65:6- 10,2005；Li L etc., Int J Biochem Cell Biol 39:1659-72,2007；Redente EF etc., Anticancer Res 29:5095-101,2009；Fabbro M etc., J Biol Chem 277:21315-24,2002).Pin To the antibody of BRCA1 from Santa Cruz (D16；Santa Cruz Biotechnology,Santa Cruz,CA).Pass through Use the SA (goat antirabbit or the anti-goat of rabbit) being conjugated with HRP, at room temperature apply 1 hour with 1:100 dilution, will Dyeing visualization.DAB dyeing at room temperature carries out 2 minutes～15 minutes.With haematine to slide before dehydration and mounting Carry out counterstain.In order to determine that sensitivity, with specifically, carries out immunohistochemical analysis, first saving in comparison section resists Body.In order to the expression of BARD1 or BRCA1 is quantitative, 4 different districts are selected for each tumor biopsy；By positive cell hundred Proportion by subtraction and staining power combination calculate the average mark of each sample.Three people without any clinical data knowledge are carried out independently This is quantitative.
For the immunohistochemical analysis carrying out on the mouse of lung cancer with induction, located after the 16th, 24 and 32 weeks Mouse extremely through treating and the untreated mouse of age-matched, and by using the immune group of antibody PVC, WFS and C20 Weave chemistry analysis carries out tumour dissection and analysis to two control mice and three tumor-bearing mices.As described in human sample It is analyzed and quantitatively.
Formalin is fixed and paraffin-embedded 5 μm of histotomies take off paraffin in dimethylbenzene, and passed by concentration The ethanol (100% alcohol, 95% alcohol, 70% alcohol, dH2O) subtracting carries out rehydration.Section is made to seethe with excitement 5 minutes to resist in microwave Former reparation, and endogenous peroxydase is closed.After non-specific epitopes is carried out BSA (bovine serum albumin(BSA)) closing With first antibody, slide is incubated overnight at 4 DEG C in humidifying chamber.First antibody for BARD1 detection is N19 (sc- 7373, Santa Cruz Biotechnology) (1:25 dilution), PVC (1:100 dilution), WFS (1:100 dilution) and C20 (sc-7372, Santa Cruz, CA) (1:20 dilution), they identify exons 1, the 3rd, the epi-position in 4 and 11 respectively；BRCA1 resists Body is C20 (sc-642, Santa Cruz Biotechnology) (1:100 dilution), identifies BRCA1 C-end epi-position.To put together SA (goat antirabbit or the anti-goat of rabbit) the at room temperature dilution with 1:100 having horseradish peroxidase (HRP) is answered With 1 hour.Then diaminobenzidine (DAB) dyeing is at room temperature made to carry out maximum 15 minutes.Used before dehydration and mounting Haematine is to slide counterstain.In order to determine that sensitivity, with specifically, carries out immunohistochemical analysis, save comparison section On first antibody.
Semi-quantitatively measure the expression of BARD1 and BRCA1.The intensity of use Staining of Tumor cell and percentage are to dye Look is marked.The value of staining power and positive cell percentage is multiplied to obtain final dyeing fraction.Total dye of each antibody Look fraction is 0～100, and the dyeing fraction of less than 25 is clear and definite negative staining ("-"), is clear and definite positive staining more than 25 ("+"), and according to total dyeing fraction more than 25～50, be more than 50～75 and divide into more than 75 "+", " ++ " and " +++ ". For statistical analysis, only consider positive events and negative situation, except using the related of the different antibodies dyeing dyeing fraction Outside property.4 different districts have selected for each tumor biopsy, and by do not have clinical data knowledge three observers (Y, Z；L, L and J, W) mark independently.
RNA/RT-PCR analyzes
Carry out RT-PCR to determine the expression of different isoform quantitatively and to study its structure.Use Trizol reagent from cold Freeze separation RNA in histotomy.Add chloroform (0.1ml) and at 14,000g, sample centrifuged 15 minutes to separate respectively at 4 DEG C Phase.Aqueous phase is transferred to the Eppendorf pipe without RNase, adds isopyknic isopropanol to carry out RNA precipitate.With 75% Ethanol washing RNA pelletizing, and be dissolved in 20 μ l without RNase water in.Measure concentration so that it is determined that D260/D280 ratio It is at least 1.8.
For reverse transcription, 21 μ l contain the few dT of 1 μ l dNTPs (10mM), 1 μ l, 2 μ l DTT (0.1M), 4 μ l first mark The reverse transcriptase buffer of quasi-buffer solution and 1 μ l Superscript II uses the RNA of 1 μ g.65 DEG C of reactions 5 minutes, so After 42 DEG C react 2 minutes, 42 DEG C react 50 minutes, and 70 DEG C react 15 minutes.Use 2 μ l cDNA as use not Template with the PCR of primer.
Use primer 5 '-ACAAGCGCCAGAGAGATGAT-3 ' (SEQ ID NO:81) and 5 '- GATGTGGGAGAGGATGAGGA-3 ' (SEQ ID NO:82) uses the annealing temperature of 56 DEG C and the extension of time of 1 minute by female Hormone receptor α (ER α) expands.Use primer 5 '-AGCCACATCGCTCAGACACC-3 ' (SEQ ID NO:83) and 5 '- GTATCTAGCGCCAGCATCG-3 ' (SEQ ID NO:84) expands glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as inside Comparison.It (is 0.8% for FL at the agarose/TBE gel containing 0.1 μ g/ml ethidium bromide (EtBr), for other is 1%) the upper PCR primer using same volume, with analyze formed objects fragment BARD1 (be 20 μ l for exons 1-11, right It is 10 μ l in exons 1-4, be 5 μ l for other) and visualize under ultraviolet light.
PCR primer (10 μ l) is analyzed and in ultraviolet by the 1% agarose/TAE gel be supplemented with ethidium bromide It is made to visualize under light.Complete list for primer and condition refers to table 3.
QIAEX II kit (Qiagen, Hombrechtikon, Switzerland) is purified for DNA.Draw with internal BARD1 Thing checks order.
The graphical analysis of PCR
By ImageJ, based on Java image processing software (National Institutes of Health,Http:// rsbweb.nih.gov/ij/) process image.PCR primer is entered row agarose gel electrophoresis, uses ethidium bromide staining Visualize and take pictures.Image is saved as JPG file before changing into analysis gray scale.Image is opened in ImageJ, Before measuring calibration function is set as by unregulated OD for each image.The rectangle tool is used to draw region identical to measure The PCR band of size.Based on the area adjusting rectangle, use identical chi in the DNA ladder degree being closely sized in the sample with purpose band Very little bringing obtains relatively accurate value in different gels.Sketch out the area at (outlined) peak.Will be as total under curve The peak area ratio of the percentage of area is used for statistical analysis.
Total RNAs extraction, reverse transcription and PCR
Carry out RT-PCR to show the expression of different isoform quantitatively and to determine its structure.Separate code according to RNA Trizol reagent is used to separate RNA from frozen tissue section.Add chloroform (0.1ml) and at 14,000g, sample centrifuged at 4 DEG C 15 minutes to separate each phase.Aqueous phase is transferred to the Eppendorf pipe without RNase, adds isopyknic isopropanol to carry out RNA precipitate.Ethanol with 75% washs RNA pelletizing, and is dissolved in 20 μ l without in the water of RNase.Measure concentration thus Determine that D260/D280 ratio is at least 1.8.
For reverse transcription, with containing the few dT (500 μ g/ml) of M-MLV RT 5x reaction buffer 5 μ l, 2 μ l, 1.5 μ l 10mM dNTP ' s, the M-MLV reverse transcriptase of Recombinant RNasin ribonuclease inhibitor 1 μ l (25u/ μ l) and 1 μ l The 25 μ l final volume of (200u/ μ l) use the RNA of 1.5 μ g.Incubation reaction: at 70 DEG C 5 minutes, then at 42 DEG C 60 minutes, With 70 DEG C at 10 minutes.Use 3 μ l cDNA as FL BARD1 amplification template, 2 μ l cDNA are used for various of BARD1 The amplification of section.Taq polymerase is utilized to enter performing PCR with the final volume of 50 μ l.All PCR are reacted, and initial denaturation (94 DEG C, 2 points Clock) and final to extend (72 DEG C, 10 minutes) all identical.According to the length of different primers and expected BARD1 product, annealing temperature It is variable (table 3) with extension of time.
Use primer 5 '-ACAAGCGCCAGAGAGATGAT-3 ' (SEQ ID NO:81) and 5 '- GATGTGGGAGAGGATGAGGA-3 ' (SEQ ID NO:82) uses the annealing temperature of 56 DEG C and the extension of time of 1 minute by female Hormone receptor α (ER α) expands.Use primer 5 '-AGCCACATCGCTCAGACACC-3 ' (SEQ ID NO:83) and 5 '- GTATCTAGCGCCAGCATCG-3 ' (SEQ ID NO:84) expands glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as inside Comparison.It is (right to be loaded into the PCR primer of same volume at the agarose/TBE gel containing 0.1 μ g/ml ethidium bromide (EtBr) Be 0.8% in FL, be 1% for other) on, with under ultraviolet light by the fragment of BARD1 (be 20 μ l for exons 1-11, It is 10 μ l for exons 1-4, be 5 μ l for other) visualization.
Illustrate to use QIAEX II kit (Qiagen, Hombrechtikon, Switzerland) to carry out RT-PCR according to manufacturer The DNA of product purifies, and then uses for other primers in the forward primer of PCR and reverse primer or fragment (if do not produced Raw overlap) check order.
Mouse model
Such as Redente EF, Dwyer-Nield LD, Barrett BS, wait (Lung tumor growth is Stimulated in IFN-gamma-/-mice and inhibited in IL-4Ralpha-/-mice, Anticancer Res 29:5095-101,2009) described chemical induction lung neoplasm in BALB/c mouse.By every gram of body weight of 1mg urethane to 6 weeks The male mice of～8 week old carries out intraperitoneal injection, once in a week, week for 7 weeks.16th, within 24 and 32 weeks, mouse is put to death after process.Solve Cut open lung tissue and tumour, and carry out processing for immunochemistry analysis.Each time point analyzes the tissue from 3 mouse.
Statistical analysis
Administration Spearman's correlation coefficient ρ assesses the correlation between the expression of BARD1 and BRCA1 epi-position.Make Come comparison of tumor tissue and the percentage of the positives example of peritumoral tissues and the positive example of BARD1 expression and clinic with chi-square criterion The correlation of variable.T inspection is used to measure the correlation of BARD1 expression and clinical variable.For with survival associate, Patient is further divided into two groups according to its BARD1 expression.Kaplan Meier method is used to assess survival difference, and Compared by Log-Rank Test.For all calculating, inspection is two-way, and thinks that the value of P < 0.05 has statistics Learn conspicuousness.Use Statistical Package for the Social Sciences (SPSS) for Windows Version 13 (SPSS Inc, Chicago, IL) is analyzed.
II-result
Immunohistochemical analysis is carried out to tumor biopsy, including from dissimilar, the rank of 100 patients and stage (table 1).Using the antibody identifying 4 of BARD1 different epi-positions (navigate to exons 1, the 3rd, 4 and 11), it can produce in theory Raw 16 kinds of different staining pattern.It is surprising that only observe the pattern that minority is different, and observe in most tumors To the dyeing (Figure 1A-E) for all 4 kinds of antibody.The dyeing of contiguous slices shows, different epi-positions are in the not same district of tumor biopsy In and in different subcellular compartments express (Figure 1B-D), show that the different isoforms of BARD1 are expressed in single tumour. Generally, BARD1-N19 (exons 1) and C20 (exons 1 1) display cytoplasmic granule shape dyeing, and it is positioned tumour altogether Same zone.BARD1 PVC (exon 3) and WFS (extron 4) immunostaining is diffused and is positioned in cytoplasm.Dye These differences of the intensity of look and intracellular targeting show, the expression of all 4 kinds of epi-positions does not reflect the expression of wild type BARD1, But express while different isoform.
The expression of N19 and C20 strong correlation each other, as the situation of PVC and WFS (Fig. 1 F), but other antibody dye Look pattern is uncorrelated.Therefore can sum up N end and C end clipped form and there is the internal form lacking table in NSCLC Reach.Specifically, WFS (5 ' ends of extron 4) dyeing is raised, with oophoroma viewed epi-position table in many lung cancer Expression patterns (WFS dyes rareness) is contrary.
Have studied the coexpression (Figure 1B-D) of BRCA1 and BARD1 in adjacent tissue section.BRCA1 66.7% NSCLC Sample is expressed, but it is not related to the expression of any BARD1 epi-position.Due to BRCA1 not with BARD1 coexpression, these data Show that the function of BRCA1-BARD1 heterodimer is lost in NSCLC.
Observe that the BARD1 in tumor tissues and peritumoral tissues expresses, but the more (figures rising in tumour 2A；Fig. 5).Expressing generally higher than expressing in the tumour from male patient (Fig. 2 B) in the tumour from female patient.
The expression of specific b ARD1 epi-position in gland cancer than at non-gland cancer (including squamous cell carcinoma and large cell carcinoma) intermediate frequency Rate low (Fig. 2 C).But, do not find antibody staining and tumour rank and the correlation in stage (data are not shown).
Each epi-position and the expression pattern also BARD1 in 65 patients have follow up data expressed and anosis deposit Live (DFS) and total survival (OS) is evaluated.There is the patient than negative staining for the patient of independent PVC and WFS positive staining There is significantly shorter DFS and shorter OS.The more important thing is that there is patient and the tool of PVC and WFS positive staining pattern simultaneously The patient having various combination compares and demonstrates very short survival.Between N19, C20 and other staining pattern and DFS or OS not Observe correlation.
Carry out using univariate analysis and the multi-variables analysis of the Proportional hazards modesl of Cox, to evaluate analyzed mark Whether will thing has independent prognosis meaning.In univariate analysis, the pathology stage also show the prediction (table of DFS and OS 5).By the Prognostic Factors possible pathology stage and other two, organization type and Gender, in input multivariate model.Should Latter analysis shows, single PVC and WFS positive staining, PVC and WFS positive staining pattern and the pathology stage simultaneously DFS and OS is remained to independent prognosis meaning (table 5).
In another example of the present invention, it is shown that BARD1 isoform and the initial of lung cancer and the correlation developing, wherein Monitor that the BARD1 in the lung cancer through experiment induction expresses.By induction primary pulmonary in urethane multiple injection to BALB/c mouse Tumour, and develop into gland cancer.This process causes and caused macroscopic tumour at 16 weeks, and they are at 24 Zhou Bian great, and at 32 weeks The normal adjacent tissue of rear intrusion.Select normal structure and the tumor area in all stages, and antagonist dyeing carries out mark (Fig. 3). The expression of PVC and WFS is more weak all the time, and C20 is stronger all the time in control-animal.This pattern is similar in 16 weeks tumours.But, In 24 weeks tumours, the expression of PVC with WFS increase compared with C20, and at 32 weeks, tumour raises significantly.These experiments Prove to change at tumorigenic different phase BARD1 expression pattern, and show to navigate to the BARD1 of exon 3 and 4 Epi-position participates in tumor promotion and the development to the aggressive stage.
Use drawing of the amplifiable complete BARD1 code area from 10 female patients and the sample of 10 male patients Thing, is determined the structure of the different isoforms expressed in NSCLC by RT-PCR.From tumor tissues and around normal tumour group Knit middle extraction RNA.Obtain normal lung control tissue from the patient with benign airways disease.The expression of BARD1 is in normal lung In do not exist or very low；By RT-PCR (Fig. 4 A) with by immunohistochemical analysis (data are not shown) discovery comparison BARD1 only weak expression.From the RT-PCR of NSCLC patient show around most tumors and tumour in sample FL BARD1 and The expression of its several different isoform.As a rule, the specific expression pattern of FL BARD1 and isoform is normally Peritumoral tissues and tumor tissues are identical (Fig. 4 B).
In order to distinguish the isoform of identical molecular weight, use amplification exons 1 and 4, or the primer of 1 and 6 carries out RT-PCR. Discovery is in addition to FL BARD1, it is known that the expression of isoform β rather than α (WO 2008/119802), and two other The expression (Fig. 4 B, C, E, Fig. 6 and Fig. 7) of novel isoform κ and π.
Expression to the isoform being obtained by RT-PCR in women and male sex's case is carried out quantitatively.FL and isoform are swelling Tumor tissue and peritumoral tissues are all expressed similarly, with the contrary (figure of notable rise on protein level for the BARD1 isoform 1A and Fig. 5).Compared with women, (P < 0.05) is significantly raised in the expression of isoform BARD1 β and κ in the male sex；And with male sex's phase Ratio, the up-regulated (Fig. 7) of isoform BARD1 η, BARD1 γ and BARD1 ε in women.
In another example of the present invention, in all lung tissues from women and the male sex, no matter normal structure or Having had been found that ER alpha expression (Fig. 4 D) in peritumoral tissues, this shows that BARD1 isoform may be believed with the estrogen in NSCLC Number conduction is related.
III-result
Being studied the BARD1 expression in colorectal cancer by carrying out IHC to tumor biopsy, described tumor biopsy comes From the 148 of colorectal cancer paraffin-embedded tissues, exhibit tissue microarray, every example is quadruplicate.IHC inspection after 145 Example is qualified for analyzing, and is analyzed them in this study.The not same district for BARD1 is used (to be outer aobvious respectively Son the 1st, exon 3, extron 4 and exons 1 1) 4 kinds of antibody (N19, PVC, WFS and C20) distinguish and be positioned at adjacent tissue and cut Different BARD1 epi-positions (Figure 1A) on piece.Also use the BRCA1 C20 antibody research BRCA1 table of the C end epi-position for BRCA1 Reach.
In colorectal cancer, the positive staining of each of four kinds of antibody is variable (Fig. 9 A).Respectively in colorectal cancer In 36 (24.8%), 122 (84.1%), 129 (89%) and 61 (42.1%) individual cases, by BARD1 N19, PVC, WFS and C20 Dyeing classifies as the positive.Observe that 142 cases have the dyeing of at least one antibody positive, only do not find in 3 cases The expression (Fig. 9 B) of BARD1.In other words, the colorectal cancer case of 97.9% (142 cases in 145) expresses at least the one of BARD1 Plant epi-position.
Although may having 16 kinds of different combinations for 4 kinds of epi-positions of expression in principle, but only 3 kinds of main combination of discovery (being schemed 9B).In colorectal cancer, this 3 kinds of BARD1 expression patterns include: the expression of epi-position in the middle of only having is modal (38.6%) (figure 2B, D), for the dyeing secondly (18.6%) (Fig. 8 B, C, E) of all 4 kinds of antibody, the forfeiture of N-end epi-position is the 3rd common The expression pattern (17.9%) (Fig. 8 B, F) observed.
Express similar with the BARD1 in NSCLC tissue, find that all 4 kinds of antibody stainings are cytoplasmic, but be positioned at difference Region.BARD1 N19 and C20 demonstrates that graininess dyes, and PVC and WFS demonstrates that diffusivity dyes, and they are fixed altogether respectively It is positioned at identical cell or identical region (Fig. 8 C-F).In order to this is studied further, the expression mould that will obtain with each antibody The quantitative simultaneously comparative result of formula.Strong correlation (ρ=0.71 is observed between the expression of N19 and C20；P=0.000).Its It compares, such as PVC and WFS (ρ=0.39；P=0.000), PVC and C20 (ρ=0.36；And WFS and C20 P=0.000), (ρ=0.27；P=0.001) weak dependence is shown.At N19 and PVC, and do not find correlation between N19 and WFS dyeing (Figure 10 A).
From the expression of different epi-positions, intracellular targeting, the staining power of use different antibodies, different BARD1 table The expression pattern of the related or incoherent expression of position and 4 kinds of antibody for different BARD1 epi-positions for the use may infer that Go out, the form that N end and C end clipped form, N end lose and 4 kinds of tables containing the antibody used with this research with reactivity The form of position, expresses in colorectal cancer.
The non-coordinating of IV-BARD1 and BRCA1 is expressed
Different from BARD1, BRCA1 dyeing same intracellular demonstrate cytoplasm and nuclear particulate shape dyeing (figure 8C).Observe BRCA1 positive staining in the colorectal cancer case of 22.1% (32 cases in 145), and 24.8% (in 145 36 cases) case in observe N19 positive staining.Interestingly, in 61 cases of the N19 positive only 7 also It is that BRCA1 is positive.Additionally, do not find correlation (Figure 10 B) between the different epi-position that BARD1 expresses and BRCA1 are expressed.These Result proves, in colorectal cancer, BRCA1 expresses not harmonious with BARD1.
V-BARD1 protein expression and the correlation of clinical pathological characteristic and patient's prognosis
The frequency of N19 positive staining and female gender significant correlation (P=0.014) (Figure 11 A), this with in NSCLC BARD1 N19 is more consistent (Fig. 2 a-B) than the result too much expressed in the male sex in women.The different epi-position of BARD1 express and BRCA1 expresses and any other clinicopathologia variable, such as tumour rank, primary tumo(u)r, lymph node and far-end transfering state And tumor stage all uncorrelated (Fig. 4 B-F).Additionally, do not obtain aobvious between different expression patterns and clinicopathologia variable Write related (data are not shown).
Also in 75 colorectal cancer cases with follow up data by by difference BARD1 expression pattern (Fig. 9 B) and The expression of independent 4 kinds of epi-positions of BRCA1 and BARD1 and survival are compared to assess BARD1 and BRCA1 and express the phase with survival Guan Xing.It is found that (table 6), compared with the patient of negative staining, the patient with BARD1 N19 positive staining has higher 1 Year, 2 years and 3 annual survival rates, the patient with C20 positive staining has higher 1 year and 3 annual survival rates.From BARD1 PVC and Relatively drawing between WFS (negative staining case is not enough to analyze further), BRCA1 positive staining and negative staining and survival There is no difference.
When by expression pattern be used for compare when (table 7) discovery, with group in only in the middle of epi-position express expression pattern and other Expression pattern is compared, and the expression pattern of all 4 kinds of antibody positives dyeing is related to higher 1 year, 2 years and 3 annual survival rates.But It is that, compared with other expression patterns in group, and compared with all 4 kinds of antibody positive staining pattern, only middle epi-position is expressed Expression pattern (with PVC and WFS detection) related to relatively low 1 year, 2 years and 3 annual survival rates.In group, losing N end epi-position Expression pattern and other expression patterns (include all 4 kinds of antibody positive staining pattern expression pattern (remove 1 annual survival rate Outward)), only in the middle of epi-position express expression pattern and all other expression pattern between, do not find correlation.
Can summarize in colorectal cancer in a word, the BARD1 expression pattern of all 4 kinds of positive staining patterns and The expression of the N end epi-position of BARD1 is the Prognostic Factors in front；On the contrary, it is negative that two kinds of epi-positions in the middle of only are expressed simultaneously Prognostic Factors, but their single epi-positions are expressed and are not then.
The structure of the BARD1 isoform expressed in VI-colorectal cancer
In 20 tumor tissues and peritumoral tissues (including 10 male sex and 10 women cases), pass through RT-PCR Assessment BARD1 mrna expression level.Extract RNA from frozen tissue section.Use the forward primer in exons 1 and show outward Reverse primer in son 11 and extron 4 carries out RT-PCR, to expand BARD1 code area (exons 1～exons 11, and outward Aobvious son 1～extron 4), GAPDH is as comparison in amplification.Meanwhile, as done in NSCLC, also expand from the sample of this series ER α (Figure 11 A).
Different from NSCLC, BARD1 mrna expression pattern phase in human colorectal tumor tissues and peritumoral tissues Work as difference.FL BARD1 and isoform frequent earth's surface in most tumors sample (90%, 18 in 20 cases) reaches, but In peritumoral tissues, the expression not having BARD1 is frequently (65%, 13 in 20 cases), 7 cases (35%) Only express FL BARD1 and/or less isoform.This has significance,statistical (P=0.0003).As such, result exists In the male sex (respectively 8/10 and 4/10) (P=0.0679) and in women (respectively 10/10 and 3/10) (P=0.0010) also Observe (Figure 12 A).The all BARD1 isoforms expressed in NSCLC tissue, including have the novel of the disappearance of exon 3 The novel isoform π of the disappearance of isoform κ and the 408bp having in 3 ' ends of extron 4, also table in Colorectal Carcinoma Reach.For the sake of emphasizing, FL BARD1 and all BARD1 isoforms are frequently expressed in tumor tissues, but at peritumoral tissues Middle expression is less or does not expresses (for all P < 0.05) (Figure 12 B).
The similar BARD1 expression pattern that VII observes in the tissue from masculinity and femininity
BARD1 isoform β and κ significantly raises in the lung tissue from the male sex, and isoform η, γ and ε are from women's In lung tissue, height is expressed.Different from lung tissue, the frequency that FL BARD1 and isoform are expressed is at the knot from masculinity and femininity In rectal tissue, including peritumoral tissues (for all P > 0.05) (Figure 12 C) and tumor tissues (for all P > 0.05) similar in (Figure 12 D).
In the colorectal carcinoma of series of samples, including in the peritumoral tissues of masculinity and femininity and tumor tissues, Do not find ER alpha expression.This result can be explained at least in part: compared with expressing with the BARD1 in lung tissue, at colorectal carcinoma Middle BARD1 expresses does not has correlation with masculinity and femininity.
VIII-BARD1 isoform expresses the correlation with clinical variable
It is found that FL BARD1 and BARD1 isoform the age more than the patient of 60 years old in than patient below 60 for the age Middle expression is frequently.Specifically, BARD1 isoformThe frequency of δ and pi expression and gerontal patient's significant correlation (P < 0.01) (Figure 13 A).Additionally, BARD1 isoform κ expresses invades (T3 and T4) with bigger tumor size or adjacent tumour in frequency (P=0.0098), lymph node involvement (N1 and N2) (P=0.0422) and notable phase in late period (III phase and IV phase) (P=0.0422) Close (Fig. 6 B-D).Express at BARD1 and do not observe correlation (Figure 13 E) between tumor tissue pathology's rank.
The detection of anti-BARD1 autoimmune antibody in IX blood of patients with lung cancer
Method
The antigen (BARD1 peptide) using the present invention develops test based on immuno absorbence inspection, suffers from for capture lung cancer Autoimmune antibody in person's blood.The method of the test for being carried out is the test of improved standard ELISA antibody capture.Tool Application below scheme for body:
-be coated microtiter plate (96 hole) for the BARD1 peptide [10 micrograms/ml] diluting in PBS and incubated at 4 DEG C Night.
-replace phosphate buffered saline (PBS) with sealer (such as 5%BSA), hole is sealed under agitation in room temperature Close 1 hour.
-in hole, add the patients serum in the PBS being diluted in containing 1% sealer and comparison, and in room temperature under agitation Carry out incubating 2 hours.
-with PBS, hole is rinsed 3 times.
-in hole, add that be diluted in PBS and 1% sealer and HRP or Sulfo-Tag or equivalence detection reagent idol The anti-human SA of connection, and incubate 1 hour under agitation in room temperature.
-with PBS, hole is washed 3 times.
-by adding HRP substrate or reading, measurement reaction immediately for the substrate of equivalence detection method.
Test
To the blood serum sample from patients with lung cancer and following antigen is carried out to the control sample from healthy blood donor (peptide) is tested: SEQ ID NO:46, the 33rd, the 48th, the 20th, the 50th, the 19th, the 22nd, the 16th, the 32nd, 26.
Result
See Figure 14.Normal healthy controls is compared with patients with lung cancer.The value of measurement is arbitrary value.Value is usual in cancer patient Higher than in comparison.The combined value of several peptides produces significantly difference between comparison and cases of cancer: if using 11 kinds of peptides, Then sensitiveness is 100%, is specifically 95%.
Test description
The serum from patient for example can be used to detect the autoimmune antibody for BARD1 isoform.In comparison In sample (healthy blood donor), response value is substantially less than the value in cancer specimen.Each peptide may be given for a comparison Higher value, but the combination of use peptide eliminates false positive.

Claims (22)

1. one kind for detection available from lung cancer and colorectal cancer are had by the biological sample of study subject specific BARD1 with The method of the existence of drum, described method include detecting in described sample lung cancer and colorectal cancer are had specific at least A kind of step of BARD1 isoform, described at least one BARD1 isoform is selected from the group comprising as follows drum:
Isoform π, isoform π comprise SEQ ID NO:1, its bioactive fragment or have at least 95% with SEQ ID NO:1 The sequence of homology, and
Isoform κ, isoform κ comprise SEQ ID NO:2, its bioactive fragment or have at least 95% with SEQ ID NO:2 The sequence of homology,
Wherein, there is described in the sample available from described study subject the same work of specific BARD1 to lung cancer and colorectal cancer The existence of type is that described study subject suffers from lung cancer and/or colorectal cancer, the risk suffering from lung cancer and/or colorectal cancer increases, with And/or person treat lung cancer and/or colorectal cancer after there is the mark of risk of recurrence.
2. the method for claim 1, wherein described method includes detecting in described biological sample by SEQ ID NO: The step of the BARD1 isoform π and the BARD1 isoform κ being made up of SEQ ID NO:2 of 1 composition.
3. method as claimed in claim 1 or 2, wherein, described method be additionally included in described sample detection selected from comprise with At least one BARD1 isoform in the group of lower isoform:
Isoform π ', isoform π ' comprise SEQ ID NO:105, its bioactive fragment or with SEQ ID NO:105 have to The sequence of few 95% homology,
Isoform β, isoform β comprise SEQ ID NO:5, its bioactive fragment or have at least 95% with SEQ ID NO:5 The sequence of homology,
Isoform δ, isoform δ comprise SEQ ID NO:6, its bioactive fragment or have at least 95% with SEQ ID NO:6 The sequence of homology, and
Isoform γ, isoform γ comprise SEQ ID NO:7, its bioactive fragment or have at least with SEQ ID NO:7 The sequence of 95% homology,
Isoform β ', isoform β ' comprise SEQ ID NO:106, its bioactive fragment or with SEQ ID NO:106 have to The sequence of few 95% homology.
4. method as claimed in claim 3, wherein, described method includes detecting in described biological sample by SEQ ID NO: BARD1 isoform π, the BARD1 isoform κ being made up of SEQ ID NO:2 of 1 composition and the BARD1 being made up of SEQ ID NO:5 Isoform β.
5. the method as according to any one of Claims 1 to 4, wherein, described biological sample is selected from the group comprising following sample: Biopsy samples, histological sample, lung liquid, freezing tissue sample, neoplasmic tissue sample, fecal specimens, celiolymph (CSF), circulating tumor cell (CTC) and blood sample.
6. the method as according to any one of Claims 1 to 5, wherein, described study subject is the mankind.
7. the method as according to any one of claim 1～6, wherein, the existence of described BARD1 isoform is by using to institute State BARD1 isoform there is specific antibody to detect.
8. method as claimed in claim 7, wherein, described antibody is that the different epi-position from least one BARD1 isoform is special Antibody that the opposite sex combines or the combination of its fragment, described at least one BARD1 isoform comprises selected from comprising SEQ ID NO:1- 7th, 105-106, its bioactive fragment or the group of sequence with SEQ ID NO:1-7,105-106 with at least 95% homology In amino acid sequence.
9. the method as according to any one of claim 1～6, wherein, the existence of described BARD1 isoform is encoded by detection The level of the mRNA of at least one BARD1 isoform detects, and described at least one BARD1 isoform comprises selected from comprising SEQ ID NO:1-7,105-106, its bioactive fragment or there is at least 95% homology with SEQ ID NO:1-7,105-106 Amino acid sequence in the group of sequence.
10. the method as according to any one of claim 1～6, wherein, the existence of described BARD1 isoform is obtained by detection The existence having specific autoimmune antibody to described BARD1 isoform in the blood sample of described study subject is examined Survey, and wherein use at least four antigen in the group comprising SEQ ID NO:13 80 same to detect to described BARD1 Drum has specific described autoimmune antibody.
11. methods as according to any one of claim 1～6, wherein, the existence of described BARD1 isoform is by with lower section Formula detects:
The level of the mRNA of at least one BARD1 isoform of detection coding, described at least one BARD1 isoform comprises selected from bag The NO:1-7 of ID containing SEQ, 105-106, its bioactive fragment or with SEQ ID NO:1-7,105-106 have at least 95% with Amino acid sequence in the group of the sequence of source property, and
Detection has specific autoimmune antibody available from the blood sample of described study subject to described BARD1 isoform Existence, and wherein use at least four antigen in the group comprising SEQ ID NO:13 80 to detect to described BARD1 isoform has specific described autoimmune antibody.
12. 1 kinds are used as the separation of biomarker and/or the polypeptide of purifying in the method described in claim 1～6, described The polypeptide separating and/or purifying comprises SEQ ID NO:1, its bioactive fragment or has at least 95% with SEQ ID NO:1 The sequence of homology.
13. 1 kinds are used as the separation of biomarker and/or the polypeptide of purifying in the method described in claim 1～6, described The polypeptide separating and/or purifying comprises SEQ ID NO:2, its bioactive fragment or has at least 95% with SEQ ID NO:2 The sequence of homology.
14. peptides in the group comprising SEQ ID NO:13～80, described peptide detects being used for described in claim 1～6 The method of the existence of BARD1 isoform uses.
15. 1 kinds for detection available from lung cancer and colorectal cancer are had the same work of specific BARD1 by the sample of study subject The kit of the existence of type, described kit comprises:
At least one polynucleotide primers or probe, wherein said polynucleotide primers or probe are at least one described to coding The polynucleotides of BARD1 isoform have specifically, and described at least one BARD1 isoform comprises selected from comprising SEQ ID NO: 1-7,105-106, its bioactive fragment and/or the sequence with SEQ ID NO:1-7,105-106 with at least 95% homology Amino acid sequence in the group of row, and/or
The antibody combining from the different epitope specificity of at least one described BARD1 isoform or the combination of its fragment, described extremely Few a kind of BARD1 isoform comprise selected from comprise SEQ ID NO:1-7,105-106, its bioactive fragment or with SEQ ID Amino acid sequence in the group of the sequence that NO:1-7,105-106 have at least 95% homology, and/or
At least one peptide in the group comprising SEQ ID NO:13～80.
16. 1 kinds of methods distinguishing lung cancer with colorectal cancer with gynecological cancer mutually, described method includes available from study subject Biological sample in detect at least one step to lung cancer and colorectal cancer with specific BARD1 isoform, described BARD1 isoform is selected from the group comprising as follows drum:
Isoform π, isoform π comprise SEQ ID NO:1, its bioactive fragment or have at least 95% with SEQ ID NO:1 The sequence of homology, and
Isoform κ, isoform κ comprise SEQ ID NO:2, its bioactive fragment or have at least 95% with SEQ ID NO:2 The sequence of homology,
Wherein, the described existence to lung cancer and colorectal cancer with specific BARD1 isoform is lung cancer and/or colorectal cancer Mark.
17. peptides in the group comprising SEQ ID NO:13～80, described peptide is detecting the biological sample available from study subject The method of the existence of middle BARD1 isoform is used as antigen, the existence of wherein said BARD1 isoform by detection to described The existence that BARD1 isoform has specific autoimmune antibody detects, and wherein said BARD1 isoform is described Existence in sample is the mark of described patients's cancer.
18. 1 kinds of antibody or its fragment, described antibody or its fragment are combined with the epi-position shown in SEQ ID NO:144.
19. 1 kinds treatment and/or prevention lung cancer and colorectal cancer method in use antibody or its fragment, described antibody or Its fragment is combined with the epi-position shown in SEQ ID NO:144.
20. 1 kinds of restructuring siRNA molecule using in the method for the treatment of and/or prevention lung cancer and colorectal cancer, described restructuring SiRNA molecule is combined with strand or double stranded rna molecule, and wherein said strand or double stranded rna molecule comprise coding at least one The mRNA of BARD1 isoform, described BARD1 isoform comprises selected from comprising SEQ ID NO:1-7,105-106, its biologically active Amino acid sequence in the group of fragment or the sequence that there is at least 95% homology with SEQ ID NO:1-7,105-106, thus The expression of described BARD1 isoform is suppressed.
21. 1 kinds of BARD1 isoforms bioactive using in the method for the treatment of and/or prevention lung cancer and colorectal cancer Conditioning agent, described BARD1 isoform comprises selected from comprising SEQ ID NO:1-7,105-106, its bioactive fragment or and SEQ Amino acid sequence in the group of the sequence that ID NO:1-7,105-106 have at least 95% homology.
The bioactive conditioning agent of 22. BARD1 isoforms as claimed in claim 20, wherein, described conditioning agent is to be selected from Comprise the microRNA in the group of SEQ ID NO.111～140.
CN201610347489.9A 2010-08-17 2011-08-17 BARD1 isoforms, its detection method in lung cancer and colorectal cancer and its application Expired - Fee Related CN106153944B (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US37437010P 2010-08-17 2010-08-17
US61/374,370 2010-08-17
CH6212011 2011-04-06
CH00621/11 2011-04-06
CN201180044183.1A CN103238069B (en) 2010-08-17 2011-08-17 BARD1 isoform in pulmonary carcinoma and colorectal cancer and application thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN201180044183.1A Division CN103238069B (en) 2010-08-17 2011-08-17 BARD1 isoform in pulmonary carcinoma and colorectal cancer and application thereof

Publications (2)

Publication Number Publication Date
CN106153944A true CN106153944A (en) 2016-11-23
CN106153944B CN106153944B (en) 2018-09-28

Family

ID=44651887

Family Applications (2)

Application Number Title Priority Date Filing Date
CN201610347489.9A Expired - Fee Related CN106153944B (en) 2010-08-17 2011-08-17 BARD1 isoforms, its detection method in lung cancer and colorectal cancer and its application
CN201180044183.1A Active CN103238069B (en) 2010-08-17 2011-08-17 BARD1 isoform in pulmonary carcinoma and colorectal cancer and application thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN201180044183.1A Active CN103238069B (en) 2010-08-17 2011-08-17 BARD1 isoform in pulmonary carcinoma and colorectal cancer and application thereof

Country Status (12)

Country Link
US (2) US9599624B2 (en)
EP (1) EP2606358B1 (en)
JP (2) JP5938406B2 (en)
CN (2) CN106153944B (en)
AU (1) AU2011292809B2 (en)
BR (1) BR112013003506B1 (en)
CA (1) CA2807104C (en)
ES (1) ES2716241T3 (en)
IL (1) IL224766A (en)
RU (1) RU2013104137A (en)
SG (2) SG10201506437PA (en)
WO (1) WO2012023112A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111253483A (en) * 2020-03-02 2020-06-09 江苏莱森生物科技研究院有限公司 anti-BRCA 1 monoclonal antibody and application thereof
CN114685641A (en) * 2022-02-25 2022-07-01 西安交通大学医学院第一附属医院 Polypeptide for inhibiting combination of BRCA1/BARD1 complex, application thereof and medicine for preventing and treating cancer

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2871480A1 (en) 2013-11-06 2015-05-13 Bard1Ag SA Lung Cancer Diagnosis
US12082893B2 (en) 2015-11-24 2024-09-10 Think Surgical, Inc. Robotic pin placement
KR20180075563A (en) 2015-11-24 2018-07-04 씽크 써지컬, 인크. Arrangement of active robot pins in total knee arthroplasty

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998012327A2 (en) * 1996-09-20 1998-03-26 Board Of Regents, The University Of Texas System Compositions and methods comprising bard1 and other brca1 binding proteins
US20040234959A1 (en) * 2000-09-01 2004-11-25 Fabien Gautier Truncated bard1 protein, and its diagnostic and therapeutic uses
WO2008119802A1 (en) * 2007-04-02 2008-10-09 Universite De Geneve Deletion bearing bard1 isoforms and use thereof
CN101292046A (en) * 2005-09-14 2008-10-22 人类遗传标记控股有限公司 Assay for a health state

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3773919A (en) 1969-10-23 1973-11-20 Du Pont Polylactide-drug mixtures
GB8823869D0 (en) 1988-10-12 1988-11-16 Medical Res Council Production of antibodies
US6150584A (en) 1990-01-12 2000-11-21 Abgenix, Inc. Human antibodies derived from immunized xenomice
US5661016A (en) 1990-08-29 1997-08-26 Genpharm International Inc. Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
US5625126A (en) 1990-08-29 1997-04-29 Genpharm International, Inc. Transgenic non-human animals for producing heterologous antibodies
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
CA2089661C (en) 1990-08-29 2007-04-03 Nils Lonberg Transgenic non-human animals capable of producing heterologous antibodies
US5633425A (en) 1990-08-29 1997-05-27 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US20030109670A1 (en) 2001-02-09 2003-06-12 University Of Utah Research Foundation Cone snail peptides
EP1321474A1 (en) 2001-12-18 2003-06-25 Universite De Geneve A method for inducing apoptosis
WO2005116204A1 (en) * 2004-05-11 2005-12-08 Rnai Co., Ltd. Polynucleotide causing rna interfere and method of regulating gene expression with the use of the same
EP2281889B1 (en) 2004-11-12 2014-07-30 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
JP2008048733A (en) * 2006-07-27 2008-03-06 Okayama Univ Method for forecasting crisis risk of cancer
KR101345374B1 (en) * 2006-12-21 2013-12-24 삼성전자주식회사 Marker for classifying substage of stage 1 lung cancer patient, kit comprising primer for the marker, microarray comprising the marker or antibody against the marker, and method for classifying substage of stage 1 lung cancer patient

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998012327A2 (en) * 1996-09-20 1998-03-26 Board Of Regents, The University Of Texas System Compositions and methods comprising bard1 and other brca1 binding proteins
US20040234959A1 (en) * 2000-09-01 2004-11-25 Fabien Gautier Truncated bard1 protein, and its diagnostic and therapeutic uses
CN101292046A (en) * 2005-09-14 2008-10-22 人类遗传标记控股有限公司 Assay for a health state
WO2008119802A1 (en) * 2007-04-02 2008-10-09 Universite De Geneve Deletion bearing bard1 isoforms and use thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LI,L等: "Oncogenic BARD1 isoforms expressed in gynecological cancers", 《CANCER RESEARCH》 *
胡长军等: "BARD1在新疆维吾尔族妇女乳腺癌中的表达及其临床意义", 《新疆医科大学学报》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111253483A (en) * 2020-03-02 2020-06-09 江苏莱森生物科技研究院有限公司 anti-BRCA 1 monoclonal antibody and application thereof
CN114685641A (en) * 2022-02-25 2022-07-01 西安交通大学医学院第一附属医院 Polypeptide for inhibiting combination of BRCA1/BARD1 complex, application thereof and medicine for preventing and treating cancer
CN114685641B (en) * 2022-02-25 2024-03-08 西安交通大学医学院第一附属医院 Polypeptide for inhibiting BRCA1/BARD1 complex binding, application thereof and medicament for preventing and treating cancer

Also Published As

Publication number Publication date
CN106153944B (en) 2018-09-28
EP2606358A2 (en) 2013-06-26
CA2807104C (en) 2020-03-10
EP2606358B1 (en) 2018-12-26
US20130149711A1 (en) 2013-06-13
JP2017006117A (en) 2017-01-12
ES2716241T3 (en) 2019-06-11
JP2013535696A (en) 2013-09-12
CN103238069A (en) 2013-08-07
CN103238069B (en) 2016-06-29
AU2011292809B2 (en) 2017-04-13
US9599624B2 (en) 2017-03-21
SG10201506437PA (en) 2015-10-29
SG187674A1 (en) 2013-03-28
JP5938406B2 (en) 2016-06-22
JP6271636B2 (en) 2018-01-31
IL224766A (en) 2017-11-30
CA2807104A1 (en) 2012-02-23
BR112013003506B1 (en) 2022-02-08
WO2012023112A3 (en) 2012-05-18
US20170205415A1 (en) 2017-07-20
WO2012023112A2 (en) 2012-02-23
BR112013003506A2 (en) 2017-03-28
US11022612B2 (en) 2021-06-01
RU2013104137A (en) 2014-09-27
AU2011292809A1 (en) 2013-03-28

Similar Documents

Publication Publication Date Title
JP5301630B2 (en) Use of protein SATB2 as a marker for colorectal cancer
JP5767116B2 (en) Predicting response to platinum-based therapy
US11022612B2 (en) BARD1 isoforms in lung and colorectal cancer and use thereof
KR20080030648A (en) Identification of non-small cell lung carcinoma (nsclc) tumors expressing pdgfr-alpha
US20140295462A1 (en) RBM3 Protein in Colorectal Cancer Prognostics
US8420788B2 (en) Epitopes derived from SATB2 and uses thereof
KR101917677B1 (en) Usefulness of Methionyl-tRNA synthetase (MRS) as a prognostic biomarker of lung cancer
US20160054324A1 (en) Asrgl1 in endometrial cancer
CN118028466A (en) Application of SLC6A6 gene as tumor marker and tumor treatment target

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1227995

Country of ref document: HK

GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20180928