CN106148527A - A kind of molecular marker for reducing milch cow theileriosis assisted Selection and detection method thereof - Google Patents
A kind of molecular marker for reducing milch cow theileriosis assisted Selection and detection method thereof Download PDFInfo
- Publication number
- CN106148527A CN106148527A CN201610543110.1A CN201610543110A CN106148527A CN 106148527 A CN106148527 A CN 106148527A CN 201610543110 A CN201610543110 A CN 201610543110A CN 106148527 A CN106148527 A CN 106148527A
- Authority
- CN
- China
- Prior art keywords
- theileriosis
- milch cow
- molecular marker
- assisted selection
- reducing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The molecular marker that the present invention is provided to reduce milch cow theileriosis assisted Selection is, stearyl-coenzyme A desaturase SCD1 gene (NC_007327), at the SNP mutation of a base C → T of 8586bp, causes 878 amino acids alanine (alanine) in protein peptide chain to sport valine (valine).It includes for the detection method of the molecular marker that reduces milch cow theileriosis assisted Selection: 1) with from sample extraction DNA as sample, use and carry out PCR amplification for the molecular marker primer reducing milch cow theileriosis assisted Selection；2) detecting step 1) obtained in the sequence of PCR primer, according to molecular marker, that is: SCD1 gene (NC_007327) is at the SNP mutation of 8586bp, judge that the genotype of its sample is as CC, CT or TT type, carrying out assisted Selection to reducing milch cow theileriosis, wherein CC type infection rate is the highest, and TT type infection rate is minimum.This molecular marker and detection method thereof have higher accuracy and credibility, effectively susceptibility for milch cow theileriosis kind of cattle can be carried out assisted Selection.
Description
Technical field
The invention belongs to biological technical field, relate to a kind of utilizing the single nucleotide polymorphism of gene to judge milch cow Taylor
Parasitosis infection rate, and for reducing molecular marker and the detection method thereof of milch cow theileriosis assisted Selection.
Background technology
Theileria sergenti (Theilefia sergenti) is to parasitize erythrocyte and lymphocyte through tick-borne
Interior Blood protozoan[1].The zygoblast (Sporozoite) of Theileria sergenti enters in cattle body with the salivary gland of Ticks, huge saliva
After carrying out schizogony in cell and lymphocyte, after repeatedly dividing in entering back into erythrocyte, develop into blood type polypide[2].Though
So this process is lasted the ofest short duration, but is probably pathogenic in the endoerythrocytic piroplasm stage.
Taylor worm, at cattle body parasitic stages, when parasitizing in erythrocyte, can affect the corresponding blood type of cattle body and immunology refers to
Target changes, and therefore can carry out this polypide of Preliminary Identification by monitoring the change of these indexs or monitor ill cattle rehabilitation state[3-4]。
It is reported, the milch cow of infection annular loop detector is compared with normal milch cow, and every physiological and biochemical index difference is extremely notable, shows as body temperature
Raising, heart rate, frequency of respiration, total white blood cells, serum bilirubin, glutamate pyruvate transaminase increase；Hemoglobin, erythrocyte and hematocrit thereof
Constantly declining with the rising of Infestation rat, total serum protein, albumin, cholesterol and glyceride all significantly reduce[5-8].Commonly use clinically
C 3 b receptor of red blood cells rosette rate and red blood cell immune complexes rosett, as evaluating referring mainly to of Immune Function of Animal Erythrocytes
Mark, reflects Cellular Immunity level with the height of T lymhocyte transformation rate.Li Mingzhen refers to equal to more than first passage in 2012
The annular loop detector impact on milch cow immune level is inquired in target change, and result shows hematid immunity function and the cell of ill cattle
Immunocompetence declines, and after illustrating that annular loop detector invades body, can cause immunosuppressant by damage immune organ, cause activation
T lymphocyte quantity reduce, the cellular immunization of body is disorderly, and immune level is low, ultimately results in Abwehrkraft des Koepers and declines[9]。
Cattle theileriosis has obvious provincialism and seasonality.Other places cattle, purebred cattle and improvement cross-bred ox are to this disease
, apparently higher than local cattle, even if red thin sense Infestation rat is the lowest, also there is obvious clinical symptoms in susceptibility, when being not added with any treatment
Its sickness rate and fatality rate are all up to more than 90%.For a long time, Taylor Se Shi worm immunology diagnosis because antigen is not enough technology
Development is restricted, and therefore many scholars make every effort to search out a kind of method and are suitable for Taylor's Se Shi worm In vitro culture, to get rid of some not
The factor of profit.This disease is main in endemic conditions, and sickness rate is up to 36%～100%, and mortality rate is up to 17.8%～75.4%.Should
Evil of being critically ill is serious, and calf and other places can be caused to introduce cattle mortality, Tsuji etc.[10], Hagiwara etc.[11], Zhang Shoufa etc.[12]First
Rear application severe immune deficiency (SCID) Mus is successfully established Taylor's Se Shi echiuran model, and the foundation of these methods is to Taylor Se Shi worm
Immunological technique develops further.Takahashi etc.[13]In Japanese Cattle erythrocyte, Taylor's Se Shi worm specificity is extracted in nineteen fifty-seven
Albumen, first establishes theileriosis sergenti IFA diagnostic techniques in the world.Matsuba etc.[14]In 1993 with containing P32
The cDNA of gene is probe, show that the population that at least three kinds of genes are different can coexist by Southern hybridization analysis, and
Have the advantage population parasite conversion be likely to occur in host's persistent infection during, consequently, it is possible to escape host immunne response.
Although some progress of the detection technique of Niu Taile worm domestic treatment with external measures, but in producing, few people use, and also do not have
Cattle Taylor's worm resistance is carried out the selection-breeding of system.At present, China's milch cow colony Taylor insect infection rate still maintains higher level, averagely
It is about 25%[15].Therefore, it is badly in need of a kind of molecular marker that can be used for milch cow theileriosis assisted Selection and detection method thereof,
And combine the technology such as traditional cattle breeding, artificial insemination, thus reduce the infection rate of China's milch cow theileriosis, improve milch cow
The lifelong output value of cultivation and the economic benefit of cattle farm.
Stearyl-coenzyme A desaturase (stearoy1CoA desaturease, SCD) is synthesis monounsaturated fatty acid
(MUFA) rate-limiting enzyme, the acyl coenzyme A dehydrogenation of catalysis satisfied fatty acid (SFA), its first-selected substrate is palmitin acyl and stearoyl
Coenzyme A, is converted into palmitoleic acid (palmitoleate) (△ 916:1) and oleic acid (Oleate) in C9-C10 dehydrogenation respectively
(△ 918:1), both are synthesis membrane phospholipid, cholesteryl ester and the substrate of triacylglycerol[16-17], to fatty acid in Adeps Bovis seu Bubali tissue
Composition and intermuscular fat deposition important.Research[18]Showing, marbling scoring character is at three kinds of genes
Certain diversity is shown: with reference to standards of grading, CC type individuality score value is respectively higher than CT and TT type between type (CC, CT and TT)
Individual 0.03 and 0.06 score value, illustrates that CC type individuality intramuscular fat content is of a relatively high.It addition, research[19]It is also shown that
SCD1 gene C 878T site mutation has bigger hereditary effect to china holstein cows fat related traits.
List of references
[1]Jeong W,Kweon CH,Kang SW,et al.Adjuvant effect of bovine heat
shock protein 70 onpiroplasm surface protein,p33of Theileria.sergenti[J]
.Biologicals.2009；37:282-287.
[2] Beijing Agricultural University chief editor.Livestock parasitology [M]. Chinese agriculture publishing house .2003, the third edition.
[3] Tait A, Hall F R.Theileria annulata:control measures, diagnosis and
The potential use of subunit vaccines [J] .Rev Sci Tech, 1990,9 (2): 387-403.
[4] Maxie M G, Dolan T T, Jura W G, et al.A comparative study of the disease
In cattle caused by Theileriaparva or T.lawrencei:II.Hematology, clinical
Chemistry, coagulation studies and complement [J] .VetParasitol, 1982,10 (1): 1-19.
[5] Singh A, Singh J, Grewal A S, et al.Studies on some blood parameters
of crossbred calves with experimental Theileria annulata infections[J].Vet
Res Commun, 2001,25 (4): 289-300.
[6] history dawn, Chang Guoxin, Wu Shaoru, etc. the Theileria annulata impact [J] on milch cow physiological-biochemical level. Shanghai
Animal and veterinary communication, 2012 (6): 24-25.
[7] Ramin A G, Asri-Rezaie S, Hemati M, et al.Evaluation of the
erythrocytes and leucocyte alterations in cows infected with Theileria
Annulata [J] .Acta veterinaria, 2011,61:561-574.
[8] Li Mingzhen, Bi Kedong, Zhao Zhongling, etc. the Theileria annulata impact [J] on milch cow immune level. China poultry
Herd veterinary, 2009,36 (7): 141-142.
[9] Luo Jin, Liu Guangyuan, Tian Zhancheng, Xie Junren, Zhang Ping. China based on 18Sr rna gene sequence horse pyriform worm
Taxonomy analyzes [J]. animal classification journal, and 2011,36 (1): 99-103.
[10]Tsuji M,Hagiwara K,Takahashi K,et al.Theileria sergenti
proliferates in SCID mice with bovine erythrocyte transfusion[J].J
Parasitol.1992,78(4):750-752.
[11]Hagiwara K,Tsuji M,Ishihara C,et al.Theileria sergenti infection
in the Bo-RBC-SCID mouse model[J].ParasitoI Res.1993,79(6):466-470.
[12] Zhang Shoufa, Ju Yulin, Jiang Tiemin. the research [J] of Theileria sergenti experimental animal model. herding and beast
Doctor .2003,35 (9): 29-30.
[13]Takahashi K,Yamashita S,Shimizu Y.Role of antibody detected by
the indirect fluorescent antibody test in the clinical signs of cattle
infected with Theileria sergenti[J].Nihon Juigaku Zasshi.1975,37(5):295-301.
[14]Matusba T,Kubota H,Tanaka M.et al.Analysis of mixed parasite
populations of Theileria sergenti using cDNA probes encoding a major
piroplasmsurface protein[J].ParasitoIogy.1993,107(4):3 69-3 77.
[15] Xu Yingtian, Zhang Shoufa, etc. the diagnosis of cattle theileriosis and Prevention Research progress [J]. Yanbian University's agronomy
Report, 1997,19 (4): 271-275.
[16] Mele M, Conte G, Castiglioni B, et al.Stearoyl-coenzyle A
desaturase gene polymorphism and milk fatty acid composition in Italian
Holsteins [J] .J Dairy Sci, 2007,90 (9): 4458-4465.
[17] Enoch H G, Catala A, Strittmatter P.Mechanism of rat microsomal
Stearoyl-CoA desaturase [J], J Biol Chem, 1976,251:5095-5103.
[18] Wang little Long, Chang Lingling, Chen Ying, etc. Chinese holstein cattle SCD1 exon 5 gene pleiomorphism and to Ruzhong
The impact [J] of fatty acid composition. Scientia Agricultura Sinica, 2014,47 (9): 1858-1864.
[19] Wu Xiuxiang, Shi Xuekui, Chang Lingling, etc. cattle SCD1 gene C 878T site genetic polymorphism and China's west gate tower
The effect analysis [J] of your cattle partial fat correlated traits. journal of animal science and veterinary medicine, 2011,42 (3): 363-368.
Summary of the invention
It is an object of the invention to provide a kind of molecular marker that can be used for reducing the assisted Selection of milch cow theileriosis and
Its detection method, and combine the technology such as traditional cattle breeding, artificial insemination, kind of cattle is carried out seed selection and selective pairing, thus reduces me
The infection rate of state's milch cow theileriosis, improves the lifelong output value and the economic benefit of cattle farm of milk cattle cultivating.
The basic ideas of the present invention are: based on prior art situation, such as: 1) the main propagation animal of milch cow theileriosis is
Ticks worm, Ticks worm can select the relatively thin position of milk cow skin parasitic, thus propagate Tai Leshi parasitosis, therefore, milch cow lipidosis with
The propagation of Ticks worm is had a certain impact by subcutaneous fat thickness；2) early-stage Study shows, SCD is to fatty acid in Adeps Bovis seu Bubali tissue
Composition and lipidosis important.Based on the above state of the art, the present invention have studied emphatically SCD1 different genotype
With associating of the infection rate of milch cow theileriosis.By individual as object of study with 866 cow heads, use PCR-SSCP, directly
Order-checking and flight mass spectrum method analyze SCD1 gene genetic polymorphism, in conjunction with its theileriosis infect with eliminate etc. information, warp
Logstic analyzes, and finally found that and has infected the SNP mutation on the SCD1 gene of significant correlation, i.e. SCD1 with milch cow theileriosis
Gene C 878T SNP site.SCD1 gene 878 site SNP reaches significant level (P=to the impact of milch cow Taylor's insect infection
0.011), the probability of TT type milk cattle infected Taylor worm is only 39% (the referring to table 2) that CC type is individual；And it is found to be basis with this,
Establish milch cow assistant breeding and select molecular genetic marker and detection method thereof.
To achieve these goals, technical scheme is as follows:
The invention provides a kind of molecular marker for reducing milch cow theileriosis assisted Selection, it is characterised in that hard
Acyl coenzyme A desaturase SCD1 gene (NC_007327), at the SNP mutation of a base C → T of 8586bp, causes albumen
In matter peptide chain, 878 amino acids-alanine (alanine) sports valine (valine).
Present invention also offers the detection method of a kind of molecular marker for reducing milch cow theileriosis assisted Selection, its
It is characterised by, comprises the following steps:
1) with the DNA of extraction from sample as sample, the molecule mark for reducing milch cow theileriosis assisted Selection is used
Note primer carries out PCR amplification；
2) detecting step 1) in the sequence of PCR primer, according to molecular marker, it may be assumed that SCD1 gene (NC_007327) exists
The SNP mutation of 8586bp, it is determined that the genotype of its sample is CC, CT or TT type, assists reducing milch cow theileriosis
Selecting, wherein CC type infection rate is the highest, and TT type infection rate is minimum.
Alternatively, step 2) in detection method can be common sequencing, now step 1) in use be used for reduce
The nucleotides sequence of the molecular marker primer of milch cow theileriosis assisted Selection is classified as:
F1:5 '-ACCTGGCTGGTGAATAGTGC-3 '；
R1:5 '-TGACATATGGAGAGGGGTCA-3 '.
Alternatively, step 2) in detection method can also use time-of-flight mass spectrometry (TOFMS).Now use for reducing
The nucleotides sequence of the molecular marker primer of milch cow theileriosis assisted Selection is classified as:
F2:5 '-ACGTTGGATGACCCCCGAGAGAATATTCTG-3 '；
R2:5’-ACGTTGGATGTAAGCAGCAGACCACTAGAC-3’；
U:5’-ggGGTTTCCCTGGGAGCTG。
Present invention also offers as above for reducing molecular marker and the inspection of milch cow theileriosis assisted Selection
The application in the judgement relevant to reducing milch cow theileriosis or detection of the survey method.
Technical scheme has reached following beneficial effect:
1) impact of milch cow Taylor's insect infection is reached by the molecular marker SCD1 gene 878 site SNP used in the present invention
To significant level (P=0.011) (being shown in Table 2), demonstrate this SNP mutation labelling point with the infection of milch cow theileriosis notable phase
Close so that molecular marker has higher accuracy and credibility；
2) additionally, the application in assistant breeding of this molecular marker to kind of cattle in terms of milch cow Taylor's worm susceptibility
Selection more effectively and more specific aim, thus reduce sickness rate and the infection rate of cattle farm theileriosis, reduce this disease right
The impact of Cow product, can reduce expense produced by other milch cows of buying because of Culled cow simultaneously, improves Cow product effect
Rate and economic worth.
Accompanying drawing explanation
Fig. 1 is SCD1 gene 878 site PCR amplification figure.
Fig. 2 is the PCR-SSCP result of china holstein cows SCD1 gene.
Fig. 3 is china holstein cows SCD1 different genotype sequencer map.
Fig. 4 is SCD1-878 site flight time mass spectrum detection figure.
Detailed description of the invention
In order to illustrate technical scheme and technical purpose, below in conjunction with the accompanying drawings and detailed description of the invention is to the present invention
It is described further.
Embodiment 1
(1) sample collecting: adopt anticoagulation 10mL from milch cow vein, provides its DNA by conventional method；
(2) design of primers: according to the SCD1 gene DNA sequence (NC_007327) of the cattle that GenBank announces, use
Primer5.0 designs following primer, is used for expanding exon 5 Partial Fragment primer sequence:
F1:ACCTGGCTGGTGAATAGTGC
R1:TGACATATGGAGAGGGGTCA
(3) PCR amplification:
PCR reaction system is as follows: cumulative volume 20 μ L, 10x buffer 2.0 μ L, 25mmol L-1Mg2+1.5 μ L, dNTP
(10mmol·L-1) 0.5 μ L, Taq archaeal dna polymerase (5U μ L-1) 0.3 μ L, each (the 10pmol μ L of upstream and downstream primer-1)1.0μ
L, template DNA (100ng μ L-1) 1.0 μ L, ddH2O 12.7μL。
PCR cycle parameter is as follows:
Amplified fragments size is 212bp (see Fig. 1).
(4) to the PCR primer obtained in step (3), check order:
Directly check order with ABI 9700 type sequenator.To order-checking acquired results, with DNAMAN and Chromas software,
Comparing with reference sequences (accession number: NC_007327), and judge its genotype, result is shown in Fig. 2.
Utilizing the primer that this patent designs, detect through SSCP, SCD1 gene shows 3 kinds of genotype in chance sample
(Fig. 2), it is respectively designated as CC, CT and TT genotype, the most respectively different genotype individuality is checked order (Fig. 3).At SCD1 gene
(NC_007327) at 8586bp, find the sudden change (C878T) of a base C → T, cause 878 bit amino in protein peptide chain
Acid-alanine (alanine) sports valine (valine).Mass spectrometry results is combined, with in 866 according to PCR-SSCP
Carrying out statistical analysis based on state's holstein cows, the genotypic frequency of CC, CT and TT is respectively 0.50,0.41 and 0.09, etc.
The frequency of position gene C and T is respectively 0.703 and 0.297 (being shown in Table 1).
Table 1 Chinese holstein cattle SCD1 878 locus gene gene frequency and genotypic frequency distribution:
Embodiment 2
Employing time-of-flight mass spectrometry (TOFMS) (MALDI-TOF System) above SNP is detected.Also may be used
Flight mass spectrum method is used to carry out quick mass detection, and low price.
The nucleotides sequence of molecular marker primer is now used to be classified as:
F2:ACGTTGGATGACCCCCGAGAGAATATTCTG
R2:ACGTTGGATGTAAGCAGCAGACCACTAGAC
U:ggGGTTTCCCTGGGAGCTG
PCR amplification system and PCR amplification program are as follows:
Wherein, the DNA sample of there is a need to typing is all diluted to 5ng/ μ l, takes 1 μ l DNA sample, by itself and 0.95 μ l
Water, 0.625 μ l PCR buffer are (containing 15mM MgCl2), 1 μ l 2.5mM dNTP, the 25mM MgCl of 0.325 μ l2、1μl PCR
Primer and 0.1 μ l HotStar Taq enzyme (Qiagen) mix.PCR amplification reaction condition be: 94 DEG C 15 minutes；
94 DEG C 20 seconds, 56 DEG C 30 seconds, 72 DEG C 1 minute, totally 45 circulations；Final 72 DEG C 3 minutes.
Using the PCR primer obtained in flight mass spectrum method detection above step, method is as follows:
After PCR amplification, remaining dNTP will be gone phosphoric acid to digest, and reaction system includes that 1.53 μ l water, 0.17 μ l SAP are slow
Rush liquid, 0.3 unit alkali phosphatase (Sequenom).This reaction is carried out 40 minutes at 37 DEG C, and then 85 DEG C make enzyme inactivate in 5 minutes.Alkali
After acid phosphatase processes, the Single base extension primer for SNP is carried out in following reaction system: 0.755 μ l water, 0.2 μ l 10X
IPLEX buffer, 0.2 μ l termination mix, 0.041 μ l iPLEX enzyme (Sequenom), the extension primer of 0.804 μ l 10 μMs.
Single base extension is carried out under the following conditions: 94 DEG C 30 seconds；94 DEG C 5 seconds, 52 DEG C 5 seconds, 80 DEG C 5 seconds 5 follow
Ring, totally 40 circulations；Last 72 DEG C 3 minutes.In terminating reactant, add 6mg cation exchange resin (Sequenom) take off
Salt, adds 25 μ l aqueous suspensions after mixing.Use MassARRAY Nanodispenser (Sequenom) by final typing product
Point sample is on the spectroCHIP (Sequenom) in one piece of 384 hole, and uses Matrix-assisted laser desorption ionization
It is analyzed.Final result is read in real time by MassARRAY RT software system (version number 3.0.0.4), and by MassARRAY
Typer software system (version number 3.4) completes gene type analysis (see Fig. 4).In Fig. 3, abscissa is mass spectroscopy molecular amount unit
(dalton), ordinate is not iso-allele light intensity value.SCD1-878 site detection range is 6000-6300 dalton
Between, wherein C gene test molecular weight is about 6050, and T gene test molecular weight is about 6250.As in corresponding detection molecules amount
There is higher light intensity value at place, then it represents that this individuality has this allele.As bimodal in having at these 2 molecular weight, then this
Body is heterozygote.As above 3 figures represent 3 kinds of SCD1-878 site different genotype (CC, CT and TT) respectively.
In conjunction with its Taylor's worm susceptibility and the information such as eliminate, carry out Logstic recurrence, find SCD1 gene pairs milch cow Taylor
The impact of the susceptibility of parasitosis reaches pole significant level.
In national each Breeding bull station carries out conventional cattle breeding work, increase the molecular marker SCD1 base that the study find that
Because C878T SNP detects, screen wherein TT type individuality bull, and breed with cow, godmother cattle SCD1 base thereafter can be increased
Because of C878T TT and CT type individuality ratio, gradually eliminate CC type cow individuality, thus improve the milch cow repellence to theileriosis,
Reduce the impact on Cow product of this disease, improve Cow product efficiency and economic worth.
By the relation of logistic regression analysis difference SCD1-878 loci gene type Yu milch cow Tai Leshi insect infection rate,
Result is as shown in table 2:
Table 2 milch cow SCD1-878 site different genotype Taylor's insect infection situation synopsis:
By this result of study it can be seen that SCD1 gene 878 site SNP reaches aobvious to the impact of milch cow Taylor's insect infection
Work level (P=0.011), CC is advantage allelotype, and genotypic frequency is 0.50；C is advantage allele, allele
Frequency is calculated as 0.703.Meanwhile, the probability of TT type milk cattle infected Taylor worm is only the 39% of CC type individuality.
The present invention discloses the genotype in the SNP mutation site of SCD1 gene C 878T first and is entering milch cow theileriosis
Application in terms of row assisted Selection.Compared to prior art, the SCD1 gene used when the present invention designs molecular marker primer with
The character such as milk cow production performance, immunity is closely related, its SNP mutation labelling point and the infection significant correlation of milch cow theileriosis,
There is higher accuracy and credibility, thus can effectively susceptibility for milch cow theileriosis kind of a cattle be assisted
Select, to reduce the sickness rate of offspring milch cow, and indirectly improve the output value.
The ultimate principle of the present invention, principal character and advantages of the present invention have more than been shown and described.The technology of the industry
Personnel, it should be appreciated that the present invention is not restricted to the described embodiments, simply illustrating this described in above-described embodiment and description
The principle of invention, without departing from the spirit and scope of the present invention, the present invention also has various changes and modifications, the present invention
Claimed scope is defined by appending claims, description and equivalent thereof.
Claims (5)
1. the molecular marker being used for reducing milch cow theileriosis assisted Selection, it is characterised in that described molecular marker is,
Stearyl-coenzyme A desaturase SCD1 gene (NC_007327), at the SNP mutation of a base C → T of 8586bp, causes egg
In white matter peptide chain, 878 amino acids-alanine (alanine) sports valine (valine).
2. one kind for reducing the detection method of molecular marker of milch cow theileriosis assisted Selection, it is characterised in that include with
Lower step:
1) with the DNA of extraction from sample as sample, use and draw for the molecular marker reducing milch cow theileriosis assisted Selection
Thing carries out PCR amplification；
2) detecting step 1) obtained in the sequence of PCR primer, according to molecular marker, it may be assumed that SCD1 gene (NC_007327) exists
The SNP mutation of 8586bp, it is determined that the genotype of its sample is CC, CT or TT type, assists reducing milch cow theileriosis
Selecting, wherein CC type infection rate is the highest, and TT type infection rate is minimum.
A kind of detection method of the molecular marker for reducing milch cow theileriosis assisted Selection,
It is characterized in that, step 2) in detection method use common sequencing, now step 1) in use be used for that to reduce milch cow safe
The nucleotides sequence of the molecular marker primer strangling parasitosis assisted Selection is classified as:
F1:5 '-ACCTGGCTGGTGAATAGTGC-3 '；
R1:5 '-TGACATATGGAGAGGGGTCA-3 '.
A kind of detection method of the molecular marker for reducing milch cow theileriosis assisted Selection,
It is characterized in that, step 2) in detection method use time-of-flight mass spectrometry (TOFMS), now use for reducing milch cow Taylor worm
The nucleotides sequence of the molecular marker primer of sick assisted Selection is classified as:
F2:5 '-ACGTTGGATGACCCCCGAGAGAATATTCTG-3 '；
R2:5’-ACGTTGGATGTAAGCAGCAGACCACTAGAC-3’；
U:5’-ggGGTTTCCCTGGGAGCTG。
5. the molecular marker for reducing milch cow theileriosis assisted Selection as claimed in claim 1, and such as claim
Described in 2-4 for reduce the molecular mark detection method of milch cow theileriosis assisted Selection with reduce milch cow theileriosis phase
Application in the judgement closed or detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610543110.1A CN106148527B (en) | 2016-07-11 | 2016-07-11 | A kind of molecular labeling and its detection method for reducing milk cow theileriosis assisted Selection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610543110.1A CN106148527B (en) | 2016-07-11 | 2016-07-11 | A kind of molecular labeling and its detection method for reducing milk cow theileriosis assisted Selection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106148527A true CN106148527A (en) | 2016-11-23 |
| CN106148527B CN106148527B (en) | 2019-09-20 |
Family
ID=58061739
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610543110.1A Active CN106148527B (en) | 2016-07-11 | 2016-07-11 | A kind of molecular labeling and its detection method for reducing milk cow theileriosis assisted Selection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106148527B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105368941A (en) * | 2015-11-12 | 2016-03-02 | 扬州大学 | Molecular marker detection method for assistant selection of production life of dairy cow |
-
2016
- 2016-07-11 CN CN201610543110.1A patent/CN106148527B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105368941A (en) * | 2015-11-12 | 2016-03-02 | 扬州大学 | Molecular marker detection method for assistant selection of production life of dairy cow |
Non-Patent Citations (3)
| Title |
|---|
| ASADOLLAHPOUR NANAEI H等: "Effect of LEPR, ABCG2 and SCD1 gene polymorphisms on reproductive traits in the Iranian Holstein cattle", 《REPROD DOMEST ANIM》 * |
| 李云龙等: "SCD1基因不同基因型的差异表达及与牛奶中脂肪酸组成的相关性", 《中国农业科学》 * |
| 武秀香等: "牛ＳＣＤ１基因Ｃ８７８Ｔ位点遗传多态性与中国西门", 《畜牧兽医学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106148527B (en) | 2019-09-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898107B (en) | Major SNP (single nucleotide polymorphism) marker influencing growth traits of pigs and application thereof in genetic improvement of productivity of breeding pigs | |
| CN104250646B (en) | A kind of molecular labeling relevant to pig feed transformation efficiency proterties and detection method and application | |
| US20120012065A1 (en) | Systems and Methods for Improving Protein and Milk Production of Dairy Herds | |
| CN105969845B (en) | The molecular labeling of eye muscle area character related gene SVEP1 and its application | |
| CN101693923B (en) | HSP70A1A gene SNP loci, application and kit for selecting heat-resistant cows | |
| Zhao et al. | Expression of ovine CTNNA3 and CAP2 genes and their association with growth traits | |
| Mei et al. | Insights into adaption and growth evolution: a comparative genomics study on two distinct cattle breeds from Northern and Southern China | |
| CN104862388B (en) | The SNP marker related to the effective nipple logarithm character of pig and application | |
| CN104480212B (en) | The detection method in cattle PLIN2 gene mononucleotide polymorphism site and detection kit | |
| CN112921101A (en) | Molecular marker related to sheep remaining feed intake and application thereof | |
| CN1712547A (en) | Fluorescent quantitative RT-PCR detecting kit of 2-f(o)etoprotein (AFP)mRNA | |
| CN114921568B (en) | SNP molecular marker related to Qinchuan cattle body ruler and meat quality traits and application thereof | |
| CN108165635A (en) | KIAA1462 gene promoter areas variant sites and its application on egg laying performance of goose is improved | |
| CN106148527B (en) | A kind of molecular labeling and its detection method for reducing milk cow theileriosis assisted Selection | |
| CN105969887B (en) | A kind of relevant SNP site and its application of laying eggs to a kind duck | |
| CN105063037A (en) | Hu sheep prolactin gene SNP locus and application thereof | |
| CN115181805A (en) | Molecular marker related to yellow degree of leg skin of yellow-feathered broilers and application of molecular marker | |
| CN107130037B (en) | Method and special kit for auxiliary detection of cattle growth and carcass traits through TNNI1 gene | |
| Balamurugan et al. | Genetic polymorphism of microsatellite loci in MHC class II exon 2 gene and its association with endoparasitic infestation, predominantly Haemonchus contortus in Salem black goat | |
| CN103882115B (en) | The PCR-SSCP detection kit of Gansu Alpine Merino speed of growth related genes Leptin and detection method | |
| CN110835651A (en) | Primer and kit for detecting indel multiple allele markers of chicken CDKN3 gene promoter region and application of primer and kit | |
| Zhang et al. | Expression profiles of the ovine IL18 gene and association of its polymorphism with hematologic parameters in Hu lambs | |
| Sutopo et al. | Genetic variation of cytochrome b gene in three local goat breeds in Central Java of Indonesia | |
| CN109609655A (en) | Molecular labeling and its application of the OSTN gene as pig immune trait | |
| CN107419024A (en) | Dog hip dysplasia related SNP mark group |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |