CN106148392A - A kind of method obtaining study on temperature sensitive male sterility Semen Maydis - Google Patents
A kind of method obtaining study on temperature sensitive male sterility Semen Maydis Download PDFInfo
- Publication number
- CN106148392A CN106148392A CN201510204544.4A CN201510204544A CN106148392A CN 106148392 A CN106148392 A CN 106148392A CN 201510204544 A CN201510204544 A CN 201510204544A CN 106148392 A CN106148392 A CN 106148392A
- Authority
- CN
- China
- Prior art keywords
- sequence
- semen maydis
- albumen
- nuclease
- zmtms5
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a kind of method obtaining study on temperature sensitive male sterility Semen Maydis.The method of acquisition study on temperature sensitive male sterility Semen Maydis provided by the present invention, comprising the steps: make Semen Maydis reduce or lose the ability of the ZmTMS5 albumen having function, ZmTMS5 protein function described in gained reduces or the Semen Maydis of forfeiture is described study on temperature sensitive male sterility Semen Maydis.The present invention utilizes the fertile gene ZmTMS5 in genome editing technique rite-directed mutagenesis Semen Maydis, it is thus achieved that Semen Maydis study on temperature sensitive male sterility material.The present invention is that the hybrid vigor giving full play to Semen Maydis provides new material.
Description
Technical field
The invention belongs to biotechnology breeding field, relate to a kind of method obtaining study on temperature sensitive male sterility Semen Maydis, relate to especially
And one utilizes genome editing technique rite-directed mutagenesis Semen Maydis temperature sensing male fertile related gene, it is thus achieved that Semen Maydis temperature sensing male
The method of sterile material.
Background technology
Semen Maydis is a kind of main cereal crops and industrial crops, is one of important cereal crops of depending on for existence of the mankind,
Cultivated area most area all over the world.2010, Semen Maydis was the cereal crops that total output ranks first place in the world
(8.44 hundred million tons).
Plant passes through different cultivars intermolecular hybrid, and the hybrid of generation is at growth potential, adaptability, the aspect such as resistance, yield
Having the character being better than two parents, this phenomenon just belongs to hybrid vigor.Semen Maydis belongs to cross pollinated plant, is generation
Utilizing heterotic crop in boundary the earliest, hybrid vigor is to improve corn yield, resistance and the important method of quality.
Maize Production utilize heterotic approach have: one, to produce hybridization by artificial emasculation or machinery emasculation
Kind, the method consumes substantial amounts of human and material resources and financial resources, and there is emasculation not in time, halfway problem；Two,
Cytoplasmic male sterility is utilized to produce cenospecies, the stable fertility of the most T-shaped cytoplasmic male sterilty and easily recovering, therefore
The sterile line majority utilized in the U.S. is T-shaped.But the use that scientist have ignored this T-shaped cytoplasmic male sterilty can be led
Cause cenospecies kytoplasm Focus, thus cause cenospecies easily to be infected by the specialization of corn southern leaf blight T microspecies.The U.S. exists
Large area once used the T-shaped cytoplasmic sterile line production of hybrid seeds in producing, but 1970, corn southern leaf blight pandemic,
Bring massive losses to the Maize Production of the U.S., cause applying of corn male sterility breeding technique to be in and stop on producing
Stagnant state, how finding a kind of new utilizable male sterile method to give full play to the hybrid vigor of Semen Maydis is
Researcher problem demanding prompt solution.
Summary of the invention
In order to solve above technical problem, the invention provides a kind of method obtaining study on temperature sensitive male sterility Semen Maydis.
The method of acquisition study on temperature sensitive male sterility Semen Maydis provided by the present invention, specifically can comprise the steps: to make Semen Maydis drop
Low or forfeiture has the ability of the ZmTMS5 albumen of function, and ZmTMS5 protein function described in gained reduces or funeral
The Semen Maydis lost is described study on temperature sensitive male sterility Semen Maydis.
Wherein, described ZmTMS5 albumen is following (a) or (b):
A () aminoacid sequence is the albumen shown in sequence 1 in sequence table；
B the aminoacid sequence of sequence 1 through replacement and/or the disappearance of one or several amino acid residue and/or is added by ()
Add and the protein that by sequence 1 derives relevant to Semen Maydis study on temperature sensitive male sterility.
In the process, make Semen Maydis reduce described in or lose that to have the ability of ZmTMS5 albumen of function be logical
Cross what genome fixed point editing technique realized.
Genome fixed point editing technique can produce DNA double chain interruption (DSB) on target sequence, and cell starts repair machine
System, can produce site-directed point mutation by this coarse repair mode of non-homologous end joining (NHEJ).Phase
For traditional mutant method for creating, gene site-directed editing technique have high efficiency, in high precision, the advantage such as high flux.
In the present invention, the encoding gene of described ZmTMS5 albumen is arbitrary shown in can being following (a1)-(a5)
DNA molecular:
(a1) DNA molecular shown in sequence 2 in sequence table；
(a2) DNA molecular shown in sequence 3 in sequence table；
(a3) DNA molecular shown in sequence 4 in sequence table；
(a4) under strict conditions with the DNA molecule hybridize of arbitrary restriction in (a1)-(a3) and coding and Semen Maydis
The DNA molecular of study on temperature sensitive male sterility associated protein；
(a5) with the DNA molecular of arbitrary restriction in (a1)-(a4), at least there is more than 90% homology and coding
DNA molecular with Semen Maydis study on temperature sensitive male sterility associated protein.
Wherein, sequence 2 is ZmTMS5 gene sequence in Maize genome, is made up of 4962 nucleotide altogether,
Wherein 1-2000 position is promoter region, and 2001-2290 position is 5 '-UTR, 2291-2270 position,
2880-2975 position, 3084-3197 position, 3375-3443 position, 3533-3607 position, 4027-4101 position
For exon, 2271-2879 position, 2976-3083 position, 3198-3374 position, 3444-3532 position,
3608-4026 position is intron, and 4102-4413 position is 3 '-UTR, and 4414-4962 position is terminator region.
Sequence 3 is the cDNA sequence of ZmTMS5 gene, is made up of 1511 nucleotide altogether, wherein 1-290
Position is 5 '-UTR, and 291-1199 position is the CDS of ZmTMS5 gene, and 1200-1511 position is 3 '-UTR.
Sequence 4 is the CDS of ZmTMS5 gene, is made up of 909 nucleotide altogether.
In the process, described target fragments can be located at described ZmTMS5 albumen encoding gene (genome sequence,
Such as sequence 2) in optional position, as long as described nuclease specificity can be made to cut described target fragments so that institute
State the ability that Semen Maydis reduces or loses the described ZmTMS5 albumen having function.
Described nuclease carries out specificity cutting to described target fragments, is likely to result in insertion mutation and/or disappearance is prominent
Become and/or Substitution.
In practical operation, the most described target fragments both can be one the most multiple, as long as by described core
The specificity of described target fragments is cut and the reduction of described Semen Maydis or forfeiture is had described in function by acid enzyme
The ability of ZmTMS5 albumen.
In the present invention, described nuclease is specially CRISPR/Cas9 nuclease, and described target fragments is in sequence table
DNA molecular sequence shown in sequence 2 meets 5 '-NX-NGG-3 ' or 5 '-CCN-NX-3 ' fragment of series arrangement rule；
N represents any one in A, G, C and T, 14≤X≤30, and X is integer, NXRepresent that X continuous print takes off
Oxygen ribonucleotide.In one embodiment of the invention, the sequence of described function section is sequence 5 in sequence table；
Described hereditary material is insertion sequence between the cleavage site of two restricted enzyme BsaI of pBUN411 carrier
The recombiant plasmid obtained after DNA fragmentation shown in the 1-20 position of sequence 5 in table.
In the process, described cell can be any can be as importing receptor being regenerated as completely through tissue culture
The cell of plant；Described tissue can be any can be as importing receptor whole plant can be regenerated as through tissue culture
Tissue；Concrete, described cell is protoplasm somatocyte or suspension cell；Described be organized as callus, rataria or
Mature embryo.
In the process, in the cell or tissue of described Semen Maydis, import described hereditary material or described non-hereditary material
Method be particle bombardment, Agrobacterium infestation method, PEG induction protoplasm body hit or other any introduction methods.
In the present invention, described Semen Maydis is specially corn variety HiII.
In the present invention, described study on temperature sensitive male sterility is presented as: under the hot conditions of 30-35 DEG C, pollen abortion.
Particularly as follows: the milpa being in pollen mother cell period to be placed in the high-temperature process of 30-35 DEG C, produced through this process
Raw pollen abortion.
The present invention utilizes the fertile gene ZmTMS5 in genome editing technique rite-directed mutagenesis Semen Maydis, it is thus achieved that Semen Maydis temperature
Quick male sterile material.The present invention is that the hybrid vigor giving full play to Semen Maydis provides new material.
Accompanying drawing explanation
Fig. 1 is the setting of ZmTMS5 gene structure display and the target spot utilizing CRISPR/Cas9 technology.
Fig. 2 is the gRNAs of ZmTMS5 gene target site Activity determination in Corn Protoplast.A is protoplasm
PCR/RE testing result in body；B is sequencing result, and wherein, WT represents that wildtype gene sequence, "-" represent and sends out
Give birth to the sequence deleting sudden change, "+" represent and there occurs the sequence of insertion mutation, the numeral of "-/+" back represents deletes
Or the quantity (lower case is the nucleotide inserted) of the nucleotide inserted, M1-M4 represents 4 kinds of mutation types.
Fig. 3 be with PCR/RE detection CRISPR mediation corn variety HiII ZmTMS5 gene mutation body and
Sequencing result.A be mutant PCR/RE testing result (wherein CK be do not do enzyme action process wild type PCR
Product)；B is sequencing result, and wherein, WT represents that wildtype gene sequence, "-" represent and there occurs deletion sudden change
Sequence, "+" represent and there occurs the sequence of insertion mutation, the numeral of "-/+" back represents the nucleotide deleted or insert
Quantity (lower case be insert nucleotide).
Fig. 4 is the photo that the Mutants homozygous of Semen Maydis ZmTMS5 gene is sterile under high temperature (30-35 DEG C).A is tms5
Mutants homozygous strain T0-1；B is wild type control.
Fig. 5 is the photo that the Mutants homozygous of Semen Maydis ZmTMS5 gene can be educated under thermophilic (22-26 DEG C).A is tms5
Mutants homozygous strain；B is wild type control.
Detailed description of the invention
Experimental technique used in following embodiment if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
PBUN411 plasmid: document " Hui-Li Xing, Li Dong, Zhi-Ping Wang, Hai-Yan Zhang,
Chun-Yan Han,Bing Liu,Xue-Chen Wang,Qi-Jun Chen.BMC plant biology.14:327-338
(2014) mistake disclosed in ", the public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity.This plasmid can be same
Time be used for transcribing guide RNA and express Cas9 albumen.
Corn variety HiII: at document " Armstrong, C.L., Green, C.E.Phillips, R.L.Development and
availability of germplasm with high type II culture formation response.Maize Genet.Coop.
News Lett.65,92 93 (1991) " mistake disclosed in, the public can be from Chinese Academy of Sciences's heredity and developmental biology research
Obtained.
Embodiment 1, the selection of Semen Maydis ZmTMS5 target site also build knockout carrier
One, the selection of ZmTMS5 target site
ZmTMS5 locus item is GRMZM2G147727, is positioned at the 4th article of chromosome of Semen Maydis, comprises outside 6
Aobvious son, 5 introns, altogether 302 aminoacid of coding, it is outer aobvious that the target site that structure knockout carrier selects is positioned at the 1st
In son (Fig. 1).ZmTMS5 gene sequence in Maize genome is as shown in sequence 2 in sequence table, altogether by 4962
Individual nucleotide forms, and wherein 1-2000 position is promoter region, and 2001-2290 position is 5 '-UTR, 2291-2270
Position, 2880-2975 position, 3084-3197 position, 3375-3443 position, 3533-3607 position, 4027-4101
Position be exon, 2271-2879 position, 2976-3083 position, 3198-3374 position, 3444-3532 position,
3608-4026 position is intron, and 4102-4413 position is 3 '-UTR, and 4414-4962 position is terminator region.
The cDNA sequence of ZmTMS5 gene, as shown in sequence 3 in sequence table, is made up of 1511 nucleotide, Qi Zhong altogether
1-290 position is 5 '-UTR, and 291-1199 position is the CDS of ZmTMS5 gene, and 1200-1511 position is 3 '-UTR.
The CDS sequence of ZmTMS5 gene, as shown in sequence 4 in sequence table, is made up of 909 nucleotide altogether.Sequence 2-4
All ZmTMS5 albumen shown in sequence 1 in polynucleotide.
A chain in the target double-strand that CRISPR technology knocks out is utilized to have a following structure: 5-Nx-NGG-3, PAM
(NGG) N in represents any one in A, T, C and G, and the N in Nx represents in A, T, C and G
Any one, x=20.The target sequence of ZmTMS5 gene is as follows, and the base of band underscore is PAM (prototype intervening sequence
Adjoin motif).
ZmTMS5-1:TTCCCATGTATGCGCGG(sequence 5)；
After this knockout carrier maize transformation, under the mediation of gRNA, Cas9 albumen cuts in target sequence region, is formed
DNA double chain interruption, triggers the self-inflicted injury repair mechanism in body, can draw during cell this breach of spontaneous reparation
(this place " suddenlys change " and refers to broad sense sudden change, and the form such as including insertion, disappearance, narrow sense sudden change, these are dashed forward to enter sudden change
In change, the overwhelming majority is gene function Inactivating mutations).
Above-mentioned target sequence ZmTMS5-1 contains MscI restriction endonuclease recognition sequence (sequence in square frame), can be by MscI
Restriction enzyme cleavage.After target sequence region is cut, if it occur that sudden change, then MscI restriction endonuclease recognition sequence quilt
Destroy, it is impossible to cut by restricted enzyme MscI；Without undergoing mutation, can be by restricted enzyme
MscI cuts.
Two, the structure of recombinant vector
1, with restricted enzyme BsaI enzyme action pBUN411 plasmid, the carrier framework of about 12.5kb is reclaimed, name
For BUN411.
2, according to the target site ZmTMS5-1 sequence of design, synthesis is following with sticky end (underscore part)
Primer:
ZmTMS5-1F:GGCGTTCCCATGTATGTGGCCACG；
ZmTMS5-1R:AAACCGTGGCCACATACATGGGAA。
3, ZmTMS5-1F and ZmTMS5-1R is annealed, be formed with the double-stranded DNA name of sticky end
For ZmTMS5-1, the glue in itself and step 1 is reclaimed product BUN411 and connects, obtain recombiant plasmid
pBUN411-TMS5-1.The structure of recombiant plasmid pBUN411-TMS5-1 is described as: by pBUN411 plasmid
Fragment (about 1.2kb) between the recognition sequence of two restricted enzyme BsaI replaces with sequence 5 in sequence table
The recombiant plasmid of gained after DNA fragmentation shown in 1-20 position.
Embodiment 2, maize transformation protoplast and detection recombinant vector activity in protoplast
Recombiant plasmid pBUN411-TMS5-1 embodiment 1 built proceeds to Semen Maydis product by the way of PEG mediates
Plant the protoplast of HiII, then extract the genomic DNA of protoplast, with special primer by PCR amplification bag
ZmTMS5 gene containing target site, then by the MscI enzyme of the pcr amplification product containing target site ZmTMS5-1
Cut (if pcr amplification product has part band not to be cut open, illustrate that in embodiment 1, the target site of design is active),
The pcr amplification product that can not be cut by restricted enzyme is checked order.
As follows for the amplification primer sequence containing target site ZmTMS5-1:
Forward primer TMS-1F:CAGCCTAAAGCCCTTCCTCTC (the 2256-2276 position of sequence 2)；
Downstream primer TMS-1R:TGGCTGGGTATGGCGTGATAG (the 2749-2769 position of sequence 2
Reverse complementary sequence).
The enzyme action result detecting recombinant vector activity in protoplast is shown in that a in Fig. 2, swimming lane 1 are the protoplasm after converting
Body, wherein contains the PCR band (size is about 514bp, consistent with expection) that can not be cut by MscI, target is described
Site ZmTMS5-1 is active；Swimming lane 2 be wild type control PCR primer via MscI enzyme action, can be by MscI
Complete degestion is opened；Swimming lane 3 is not do the wild type PCR primer comparison that enzyme action processes.Order-checking (b in Fig. 2) result
Show to create at target site insertion and the disappearance of a small amount of base, it was demonstrated that recombinant vector pBUN411-TMS5-1 is at target position
Gene site-directed editor has been carried out at Dian.
Embodiment 3, maize transformation
Recombiant plasmid pBUN411-TMS5-1 embodiment 1 built imports Semen Maydis product by the method for via Particle Bombardment Transformation
Plant HiII.With the callus of HiII as transformation receptor, after conversion, obtain complete regenerated plant through tissue culture.
Extract transfer-gen plant genomic DNA, with the special primer containing target site ZmTMS5-1, conversion is contained
The genomic DNA of pBUN411-TMS5-1 carries out PCR amplification, PCR primer MscI single endonuclease digestion, specifically grasps
See embodiment 2.
After PCR, enzyme action detection, in T0 generation, obtains the plant of 30 ZmTMS5-1 site homozygous mutations altogether.Part
Enzyme action result is shown in a in Fig. 3, is partial detection in Fig. 3: wherein has 6 strain ZmTMS5-1 sites and isozygotys prominent
The plant become, such as T0-1, T0-4, T0-5, T0-9, T0-12, T0-14 (respectively the swimming lane 1 of a in corresponding diagram 3,
4,5,9,12 and 14, only detect that size is about the purpose band of 514bp), remaining numbering plant (correspondence respectively
Swimming lane 2,3,6,7,8,10,11,13,15 in Fig. 3) it is wild type.To above-mentioned 6 strain ZmTMS5-1
The sequencing result of site Mutants homozygous is shown in b in Fig. 3, and 4 strains (T-1, T-4, T-5, T-9) are at the target site of design
Place's insertion containing 1 base, 2 strains (T-12, the T-14) deletion containing 1bp and 27bp base, these sudden changes
The most finally change the reading frame of ZmTMS5 gene so that it is lose function, it is thus achieved that the mutant of ZmTMS5 gene delection.
Embodiment 4, the pollen fertility of tms5 Mutants homozygous are identified
By breeding, we have obtained in embodiment 3 T1 of tms5 Mutants homozygous strain for seed.By these T1
For mutant and wild type HiII corn planting in greenhouse, all plants are divided into two groups, often all comprise identical in group
Each bar mutant strain plant of quantity and WT lines.When plant is in thermally sensitive pollen mother cell period,
One group carries out high temperature (30-35 DEG C) and processes, and another group carries out thermophilic (22-26 DEG C) and processes.
Detect the leading indicator of pollen fertility during content of starch is breeding in pollen grain, do not have the pollen of starch accumulation not have
Fertility.Pollen Maydis typically reaches maximum loose powder amount about 10 AM, treats tms5 Mutants homozygous plant and wild
After type adjoining tree powder spreading, gather pollen with paper bag.The pollen of tms5 Mutants homozygous and wild type control pollen are respectively
Dye with Wagner's reagent, after 5 minutes, observe coloration result with microscope.
Result shows: through pollen produced by all tms5 Mutants homozygous strains that high temperature (30-35 DEG C) processes
All (in Fig. 4, a is the pollen staining result of wherein T1 mutant strain one strain plant, uses Wagner's reagent in abortion
After dyeing, color does not changes, and illustrates to lack in pollen starch accumulation, pollen abortion), and what wild type control produced
Pollen fertility is normal, and (in Fig. 4, b is the pollen staining result of wherein WT strain one strain plant, molten with IKI
In black-and-blue after liquid dyeing, having illustrated that much starch accumulates, pollen can be educated)；Through the institute that thermophilic (22-26 DEG C) processes
(in Fig. 5, a is wherein T1 mutant strain to have pollen produced by tms5 Mutants homozygous strain to be fertile pollen
The pollen staining result of another strain plant, in black-and-blue after dyeing with Wagner's reagent, has illustrated that much starch accumulates,
Pollen can be educated), (in Fig. 5, b is wherein another strain plant of WT strain for its fertility and wild type control no significant difference
Pollen staining result, with Wagner's reagent dye after in black-and-blue).
Claims (10)
1. the method obtaining study on temperature sensitive male sterility Semen Maydis, comprises the steps: to make Semen Maydis reduce or lose to produce
Having the ability of the ZmTMS5 albumen of function, ZmTMS5 protein function described in gained reduces or the Semen Maydis of forfeiture is
Described study on temperature sensitive male sterility Semen Maydis.
Method the most according to claim 1, it is characterised in that: described ZmTMS5 albumen be following (a) or
(b):
A () aminoacid sequence is the albumen shown in sequence 1 in sequence table；
(b) by the aminoacid sequence of sequence 1 through the replacement of one or several amino acid residue and/or disappearance and/or
Add and the protein that by sequence 1 derives relevant to Semen Maydis study on temperature sensitive male sterility.
Method the most according to claim 1 and 2, it is characterised in that: in described method, described in make Semen Maydis drop
Low or lose and have the ability of ZmTMS5 albumen of function to be achieved by: to described Semen Maydis cell or
Tissue imports hereditary material or non-hereditary material, then the cell or tissue after importing is trained whole plant；
Described hereditary material is can the DNA circle shape plasmid of express nucleic acid enzyme or DNA linear fragment or in vitro transcription
RNA；Described non-hereditary material is described nuclease or the mRNA expressing described nuclease；Described nuclease can be special
The opposite sex shears the target fragments in the encoding gene of described ZmTMS5 albumen.
Method the most according to claim 3, it is characterised in that: described nuclease is CRISPR/Cas9 nucleic acid
Enzyme, TALEN nuclease, Zinc finger nuclease or all nucleases that can realize genome editor.
Concrete, described nuclease is CRISPR/Cas9 nuclease, and described hereditary material is following (a1) or (a2),
Described non-hereditary material is following (a3):
(a1) guide RNA can be transcribed and express the recombinant vector of Cas9 albumen；
(a2) by transcribing the recombinant vector of crRNA and tracrRNA respectively and expressing the restructuring of described Cas9 albumen
Carrier is constituted；
(a3) it is made up of described Cas9 albumen and described guide RNA；
Described guide RNA is that the palindrome that has being combined into by number of base pairs by crRNA and tracrRNA is tied
The RNA of structure；Described crRNA contains the RNA fragment can being combined with described target fragments complementation；
Concrete, described nuclease is TALEN nuclease, and described hereditary material is following (b1), described non-heredity
Material is following (b2):
(b1) recombinant vector to TALEN albumen can be expressed as；
(b2) described TALEN nuclease, maybe can express the mRNA of described paired TALEN albumen；
Described TALEN albumen is by being capable of identify that described target fragments DNA binding domain in connection and Fok I knot
Structure territory forms；
Concrete, described nuclease is Zinc finger nuclease, and described hereditary material is following (c1), described non-hereditary material
For as follows (c2):
(c1) recombinant vector to ZFN albumen can be expressed as；
(c2) described Zinc finger nuclease, maybe can express the mRNA of described paired ZFN albumen；
Described ZFN albumen is by being capable of identify that described target fragments DNA binding domain in connection and Fok I structure
Territory forms.
5. according to the method described in claim 3 or 4, it is characterised in that: the coding base of described ZmTMS5 albumen
Because DNA molecular shown in arbitrary in following (a1)-(a5):
(a1) DNA molecular shown in sequence 2 in sequence table；
(a2) DNA molecular shown in sequence 3 in sequence table；
(a3) DNA molecular shown in sequence 4 in sequence table；
(a4) under strict conditions with the DNA molecule hybridize of arbitrary restriction in (a1)-(a3) and coding and Semen Maydis
The DNA molecular of study on temperature sensitive male sterility associated protein；
(a5) with the DNA molecular of arbitrary restriction in (a1)-(a4), at least there is more than 90% homology and coding
DNA molecular with Semen Maydis study on temperature sensitive male sterility associated protein.
Method the most according to claim 5, it is characterised in that: described target fragments is positioned at described ZmTMS5
Optional position in the encoding gene of albumen, if can make described nuclease specificity cut described target fragments thus
Make described Semen Maydis reduce or lose the ability of the described ZmTMS5 albumen having function；
Described nuclease the specificity of described target fragments is cut cause insertion mutation and/or deletion mutation and/or
Substitution.
7. according to described method arbitrary in claim 4-6, it is characterised in that: described nuclease is CRISPR/Cas9
Nuclease, described target fragments is to meet 5 '-N in DNA molecular sequence shown in sequence 2 in sequence tableX-NGG-3 ' or
5’-CCN-NX-3 ' fragment of series arrangement rule；
N represents any one in A, G, C and T, 14≤X≤30, and X is integer, NXRepresent X continuously
Deoxyribonucleotide.
Method the most according to claim 7, it is characterised in that: the sequence of described target fragments is in sequence table
Sequence 5；Or
Described hereditary material is to insert between the cleavage site of two restricted enzyme BsaI of pBUN411 carrier
The recombiant plasmid obtained after DNA fragmentation shown in the 1-20 position of sequence 5 in sequence table.
9. according to described method arbitrary in claim 3-8, it is characterised in that: described cell is that any energy is as leading
Enter receptor and the cell of whole plant can be regenerated as through tissue culture；Described be organized as any can as import receptor also
The tissue of whole plant can be regenerated as through tissue culture；
Concrete, described cell is protoplasm somatocyte or suspension cell；Described it is organized as callus, rataria or one-tenth
Cooked flake.
10. according to described method arbitrary in claim 3-9, it is characterised in that: to cell or the group of described Semen Maydis
The method of the described hereditary material of middle importing or described non-hereditary material of knitting is that particle bombardment, Agrobacterium infestation method, PEG lure
Lead protoplasm body to hit or other any introduction methods.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510204544.4A CN106148392A (en) | 2015-04-27 | 2015-04-27 | A kind of method obtaining study on temperature sensitive male sterility Semen Maydis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510204544.4A CN106148392A (en) | 2015-04-27 | 2015-04-27 | A kind of method obtaining study on temperature sensitive male sterility Semen Maydis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106148392A true CN106148392A (en) | 2016-11-23 |
Family
ID=57347769
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510204544.4A Pending CN106148392A (en) | 2015-04-27 | 2015-04-27 | A kind of method obtaining study on temperature sensitive male sterility Semen Maydis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106148392A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106929532A (en) * | 2017-04-07 | 2017-07-07 | 中国农业科学院作物科学研究所 | Artificially creating male sterile line of maize and efficient transfer method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101333533A (en) * | 2008-07-25 | 2008-12-31 | 华南农业大学 | Temperature sensing male fertile gene and use thereof |
| CN103382468A (en) * | 2013-07-04 | 2013-11-06 | 中国科学院遗传与发育生物学研究所 | Site-directed modification method of rice genome |
| CN103667338A (en) * | 2013-11-28 | 2014-03-26 | 中国科学院遗传与发育生物学研究所 | Fixed-point modification method for corn genome |
-
2015
- 2015-04-27 CN CN201510204544.4A patent/CN106148392A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101333533A (en) * | 2008-07-25 | 2008-12-31 | 华南农业大学 | Temperature sensing male fertile gene and use thereof |
| CN103382468A (en) * | 2013-07-04 | 2013-11-06 | 中国科学院遗传与发育生物学研究所 | Site-directed modification method of rice genome |
| CN103667338A (en) * | 2013-11-28 | 2014-03-26 | 中国科学院遗传与发育生物学研究所 | Fixed-point modification method for corn genome |
Non-Patent Citations (2)
| Title |
|---|
| HAI ZHOU 等: "RNase ZS1 processes UbL40 mRNAs and controls thermosensitive genic male sterility in rice", 《NATURE COMMUNICATIONS》 * |
| JUN LI 等: "Generation of thermosensitive male-sterile maize by targeted knockout of the ZmTMS5 gene", 《JOURNAL OF GENETICS AND GENOMICS》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106929532A (en) * | 2017-04-07 | 2017-07-07 | 中国农业科学院作物科学研究所 | Artificially creating male sterile line of maize and efficient transfer method |
| CN106929532B (en) * | 2017-04-07 | 2019-09-24 | 中国农业科学院作物科学研究所 | Artificially creating male sterile line of maize and efficient transfer method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104846010B (en) | A kind of method for deleting transgenic paddy rice riddled basins | |
| CN106544357B (en) | A method of cultivating low cadmium-accumulation rice variety | |
| CN105063083B (en) | Prevent method for creating and its application of the Rice Engineering maintainer of genetic drift | |
| CN110213961A (en) | Crop based on genome editor is engineered and produces plant of short stem | |
| CN106701818A (en) | Method for cultivating rice common nuclear sterile lines | |
| Li et al. | Targeted plant genome editing via the CRISPR/Cas9 technology | |
| CN107988229A (en) | A kind of method for obtaining the rice that tiller changes using CRISPR-Cas modification OsTAC1 genes | |
| CN107326042A (en) | The fixed point of paddy rice TMS10 genes knocks out system and its application | |
| Carman et al. | Apospory appears to accelerate onset of meiosis and sexual embryo sac formation in sorghum ovules | |
| CN109844107A (en) | By manipulation gibberellin metabolism increase can crop the method and composition for short plant type plant | |
| CN106164272A (en) | The plant modified | |
| CN104313034B (en) | The application of male sterility gene OsLAP5 and the method for recovering male sterility of rice | |
| CN106282231B (en) | Construction method and application of mucopolysaccharide storage disease type II animal model | |
| CN104846009B (en) | A kind of construction method of Rice Engineering maintainer and its application | |
| CN102634522A (en) | Gene for controlling rice fertility, encoded protein and application thereof | |
| CN107245495A (en) | The method for creating of the common line with genic sterile of paddy rice and application | |
| CN109234310A (en) | It is quickly obtained the recombinant vector and application method of no transgene gene editor plant | |
| CN108192912A (en) | A kind of induction generates the maternal haploid method of corn | |
| CN102432679A (en) | Rice extensin OsPEX1 and application thereof | |
| Bansal et al. | Genome editing and trait improvement in wheat | |
| Bhowmik et al. | Application of CRISPR-Cas genome editing tools for the improvement of plant abiotic stress tolerance | |
| CN105907865A (en) | Method for identifying corn male fertility gene functions | |
| Mackenzie | The influence of mitochondrial genetics on crop breeding strategies | |
| CN103130884B (en) | Protein relevant to plant spike shape and encoding gene and appliance thereof | |
| CN104379751A (en) | New construct for regulating fertility of wheat and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161123 |
|
| RJ01 | Rejection of invention patent application after publication |